ID: 1161055657

View in Genome Browser
Species Human (GRCh38)
Location 19:2189575-2189597
Sequence AAAGCGAGGCTTCTGCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 123}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161055648_1161055657 27 Left 1161055648 19:2189525-2189547 CCGGCCACCTCGCTTGTGTGTCA 0: 1
1: 0
2: 1
3: 14
4: 150
Right 1161055657 19:2189575-2189597 AAAGCGAGGCTTCTGCCAGAAGG 0: 1
1: 0
2: 1
3: 7
4: 123
1161055653_1161055657 2 Left 1161055653 19:2189550-2189572 CCTGAAATCTCCTGCATCAGGGC 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1161055657 19:2189575-2189597 AAAGCGAGGCTTCTGCCAGAAGG 0: 1
1: 0
2: 1
3: 7
4: 123
1161055649_1161055657 23 Left 1161055649 19:2189529-2189551 CCACCTCGCTTGTGTGTCAAACC 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1161055657 19:2189575-2189597 AAAGCGAGGCTTCTGCCAGAAGG 0: 1
1: 0
2: 1
3: 7
4: 123
1161055650_1161055657 20 Left 1161055650 19:2189532-2189554 CCTCGCTTGTGTGTCAAACCTGA 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1161055657 19:2189575-2189597 AAAGCGAGGCTTCTGCCAGAAGG 0: 1
1: 0
2: 1
3: 7
4: 123
1161055655_1161055657 -8 Left 1161055655 19:2189560-2189582 CCTGCATCAGGGCGGAAAGCGAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1161055657 19:2189575-2189597 AAAGCGAGGCTTCTGCCAGAAGG 0: 1
1: 0
2: 1
3: 7
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161055657 Original CRISPR AAAGCGAGGCTTCTGCCAGA AGG Intronic
900575952 1:3382550-3382572 AAAGCGAGGCTTGAGCCAGCCGG + Intronic
904676959 1:32204559-32204581 AAAGGGAGGCTTCTGTTAGGAGG - Intronic
908401175 1:63774188-63774210 CAGGCGAGGCTGCAGCCAGAGGG + Exonic
908899673 1:68942134-68942156 AAAACGTGGCTTTTGCCTGATGG + Intergenic
910256956 1:85258544-85258566 AAAGCTAGGCTTCTACCAGAAGG - Exonic
915255354 1:154624307-154624329 AAAGGGAGGCTGATGTCAGAGGG + Intronic
916413333 1:164569447-164569469 ATAGAGAGGCTTATACCAGATGG + Intronic
919363768 1:196630921-196630943 ACAGGTAGGCTTCTGCCTGATGG - Intergenic
920845906 1:209592776-209592798 CAAGCGAGGCTCTTGGCAGAGGG - Intronic
922653024 1:227357412-227357434 AAAGCCAGGCTGCAGTCAGAGGG + Intergenic
922897758 1:229113696-229113718 AAAGCGAGGGGGATGCCAGATGG - Intergenic
1063157177 10:3390719-3390741 CAAGCGAGGGGTCTACCAGATGG - Intergenic
1066065875 10:31760347-31760369 GAGGCGTGGCTTCTGCCAGGCGG - Intergenic
1075522209 10:123149659-123149681 AAAGAGAGGCTCCTGCCCGCGGG + Exonic
1075757851 10:124829640-124829662 TGAGCCAGGCTTCTGCGAGACGG - Intronic
1076579171 10:131495421-131495443 AAAGCATTGCTTCTGCCAGGTGG + Intergenic
1082802539 11:57425474-57425496 CAAGCTAGGCTGCTGCCTGAAGG + Intronic
1082938058 11:58674935-58674957 AAAGCGAGAGTCCTGCCAGTGGG - Intronic
1084394491 11:68899933-68899955 GACGCCAGGCTTCTGCAAGATGG - Intronic
1085682000 11:78585231-78585253 AAAGGGAGGCTTCTGGGTGATGG + Intergenic
1086949287 11:92875255-92875277 AAAGCAAGACTTCTTCCAAAAGG + Intronic
1089062660 11:115638576-115638598 AAAGAGAGGCTTCTTAGAGAAGG + Intergenic
1089396488 11:118139274-118139296 AAAGGGAAGATTCTTCCAGATGG - Intronic
1090489826 11:127149354-127149376 GAAGAGAGGCTTCTTCCTGAAGG - Intergenic
1093109423 12:15131661-15131683 CCAGCGAGGTTTATGCCAGATGG - Intronic
1093711383 12:22333887-22333909 AAAGGGATGCCTCTGCGAGACGG + Intronic
1095927282 12:47591598-47591620 AAAGAGTGGCTCCTCCCAGAAGG - Intergenic
1098197300 12:68015457-68015479 AAGGTGAAGCCTCTGCCAGAGGG - Intergenic
1099586594 12:84524939-84524961 AAAGTCAGTCTTCTGACAGACGG + Intergenic
1099787420 12:87284354-87284376 CAAGCCAGGCTTCTGCCTAATGG - Intergenic
1103974750 12:124695253-124695275 AAAGGGAGGCTTCCGCAAGTGGG + Intergenic
1104520374 12:129468873-129468895 AAAATCAGGCTTCTTCCAGATGG + Intronic
1110862940 13:80363625-80363647 AAAGAGAGGCTACTGCTACATGG + Intergenic
1116023055 14:39484678-39484700 AAAGTGGAGCTTCTGCCACATGG - Intergenic
1119426541 14:74539053-74539075 GATGCAAGGCTGCTGCCAGAGGG + Intronic
1122371821 14:101233271-101233293 AAGGGGAGGCTCCTGCCAGCCGG + Intergenic
1122995387 14:105261115-105261137 AAAGCCTGGATTCTGCCAGCTGG + Intronic
1125242590 15:37593100-37593122 AAAGAGAGGCTACTGGCAGTAGG + Intergenic
1125935842 15:43634952-43634974 AATGCCAGGCAGCTGCCAGAAGG - Intronic
1125948610 15:43731409-43731431 AATGCCAGGCAGCTGCCAGAAGG - Intergenic
1128793972 15:70451488-70451510 ACAGCCAGGCCTCTGCCCGACGG + Intergenic
1133794271 16:9033563-9033585 AAGACAAGGCTTCTGCAAGAAGG - Intergenic
1136292890 16:29286424-29286446 AGAGCGAGGCTTAGGCCTGACGG - Intergenic
1137457675 16:48630596-48630618 AATGCCAGGCTGCTGCCACAAGG - Intergenic
1137548016 16:49417358-49417380 GAAGAGAGGCTTCCGGCAGAGGG + Intergenic
1139820611 16:69718267-69718289 AAAGAGAGGCTGGGGCCAGAGGG + Intronic
1140581732 16:76238915-76238937 AAAGTAATGCTTCTGCCAGCAGG - Intergenic
1141871894 16:86792561-86792583 AAAGCAAGTCCTCTCCCAGAAGG + Intergenic
1144839800 17:18178893-18178915 ACAGTGAGTCTTCTGGCAGAAGG - Exonic
1146828800 17:36048167-36048189 AAGGAGAGGCACCTGCCAGATGG - Intergenic
1148465077 17:47860096-47860118 AAAGGGAGGCTGAGGCCAGATGG - Intergenic
1149371161 17:55994485-55994507 AAGGCTAGGATTCTGTCAGAAGG + Intergenic
1151381043 17:73725999-73726021 CAAGCCCGGCTGCTGCCAGATGG + Intergenic
1151948171 17:77330664-77330686 CAAGCGAGGCTCCTGACAGCAGG - Intronic
1154311776 18:13272499-13272521 ACAGCGAGACAGCTGCCAGACGG + Intronic
1155586898 18:27376668-27376690 AAAGCGAGGTTTCTTCAAGGAGG - Intergenic
1161055657 19:2189575-2189597 AAAGCGAGGCTTCTGCCAGAAGG + Intronic
1162014063 19:7834364-7834386 AAAATGAGGGTTTTGCCAGAAGG + Intronic
1162431990 19:10634646-10634668 ACATCGAGGCTTCTGCCTCAGGG - Intronic
1164492168 19:28725434-28725456 AAAGAGAGGCTTCAGCCCGTTGG - Intergenic
926308896 2:11660202-11660224 AAAGGGAGGCTGATGCCCGAGGG + Intronic
928353715 2:30588054-30588076 CAAGGAAGGCTTCTACCAGAGGG - Intronic
930046378 2:47176322-47176344 AAGGAGTGGTTTCTGCCAGAGGG - Intronic
930373319 2:50532230-50532252 AATGAGAGGGTACTGCCAGAAGG + Intronic
935072426 2:99706488-99706510 AAAGCCAGGCTCTTTCCAGAGGG - Intronic
936451927 2:112640364-112640386 AAAGAGAGGCTTCTGCTATTGGG - Intergenic
937996444 2:127698122-127698144 AAAGCCAGGCTTCTCCCCGTGGG + Intergenic
938065834 2:128281554-128281576 AAAGTGGGGCTTCTGCCTCATGG - Intronic
944400647 2:199322017-199322039 AGAGCTAAGCTTCTGCCAGTTGG + Intronic
946941285 2:224772459-224772481 ATAGGGAGGCTTCTGCAAGGAGG - Intronic
948190374 2:236053589-236053611 AGAGCGAGGCTTCTGCCAAGAGG - Intronic
948519937 2:238529805-238529827 AAAGAGAAGCTGCTTCCAGAAGG - Intergenic
1169028813 20:2392345-2392367 CAAGCAAGGCTTCCTCCAGAAGG - Intronic
1169724843 20:8717290-8717312 GAAGCCAGGCATCTGCCAGGAGG - Intronic
1172166624 20:32903463-32903485 GACACGAGGCTTCTGCCATAGGG - Intronic
1173402913 20:42740640-42740662 AAAGTCATGCATCTGCCAGAGGG + Intronic
1174057337 20:47807088-47807110 AAAGTCAGGCTTCTGTCAGGAGG + Intergenic
1174353220 20:49982682-49982704 GAAGCGAGGCCTCTGCGAGGTGG - Intergenic
1175572943 20:60037683-60037705 AAAGGGAGGCTGCTCCCAGGTGG + Intergenic
1175759918 20:61555334-61555356 AAAGCAAGGCTGATGCCAGCAGG - Intronic
1179725238 21:43338280-43338302 AAAGCCAGGCTTCAGGCAGACGG + Intergenic
1183535228 22:38397495-38397517 AAAGGGAAGTTTCTGCCAGGAGG - Intronic
1183888772 22:40907619-40907641 AAAGAAAGGCTTCTTCCACAGGG - Exonic
1185228086 22:49664483-49664505 AAACCCAGGTCTCTGCCAGATGG - Intergenic
952951650 3:38530522-38530544 AAAGTGAGTTTTCTACCAGAGGG - Intronic
958636473 3:96753206-96753228 CTAGGGAGGCTTCTGACAGACGG - Intergenic
963173762 3:142277711-142277733 AAGGTGAGCCTTCTGCCAGAGGG - Intergenic
964335089 3:155646292-155646314 AAGGGGAGGCTTCGGCCAGTGGG - Intronic
965224868 3:165975298-165975320 AAAGCGAGAGTTCTGCTAGTAGG + Intergenic
965747145 3:171937530-171937552 AGAGCCAGGTTTCTGACAGAGGG - Intronic
968981199 4:3850570-3850592 AAGCAGAGGCTCCTGCCAGAGGG - Intergenic
969688910 4:8693142-8693164 AAAGAGAGGCTTCAGACAGAAGG - Intergenic
971871916 4:32252014-32252036 AAAGAGAGGCATAAGCCAGAAGG + Intergenic
973552737 4:52051761-52051783 AAAGCTAGACTTCTGGCTGAAGG + Exonic
981941605 4:150287309-150287331 AAAGCAAGGGTTCTTCCAGTAGG + Intronic
982597932 4:157408167-157408189 AATGTGAGGATTCTGCCAGCTGG + Intergenic
984890581 4:184489308-184489330 AAAAAGGGACTTCTGCCAGAAGG - Intergenic
990575625 5:57120853-57120875 AAGAGGAGGCTTCTGCCAAAAGG + Intergenic
991630941 5:68655862-68655884 AAAGTGAGGCCTCTGCCATCAGG + Intergenic
998204691 5:140150094-140150116 AAGGGAAGGCTTCTGGCAGAAGG - Intergenic
1004171057 6:13295877-13295899 AAAGCCAGCCTCTTGCCAGATGG - Intronic
1004187387 6:13432590-13432612 AAGGTGACGCTTCTGCCAGAGGG + Intronic
1011767908 6:90643698-90643720 AAAGCCAGACTTCTGTCGGAGGG + Intergenic
1013951414 6:115786950-115786972 AAAGCGAGCCGACTGACAGAAGG - Intergenic
1016046807 6:139489339-139489361 AAAGGGAGGCTTTTCCCAAAAGG - Intergenic
1020054637 7:5108949-5108971 AAAGCTAGGCTCCTGCCTCAGGG + Intergenic
1022896065 7:34751451-34751473 AATCCGCGGCTTCTGCAAGATGG - Intronic
1023869345 7:44254538-44254560 ACAGCGAGGCTGATGCCAGGTGG - Exonic
1024639812 7:51319338-51319360 AAGGTCAGACTTCTGCCAGAGGG + Intergenic
1024959554 7:54960048-54960070 AAAGTGAAGGTCCTGCCAGAGGG + Intergenic
1032536883 7:132671987-132672009 AAAGCAAGGCATCAGCCACATGG - Intronic
1034041792 7:147885531-147885553 AAAGTGTGGCTTCTGCAAGATGG - Intronic
1037915958 8:22773648-22773670 GGAGGGAGGCTGCTGCCAGAAGG + Intronic
1039218855 8:35305448-35305470 AAACCCAGGCTTCCTCCAGAGGG - Intronic
1040997266 8:53414368-53414390 AAAGCGAGACTCCTGCTAGCAGG + Intergenic
1041416875 8:57620309-57620331 ACAGCGAGGCCTCAGCCTGAAGG + Intergenic
1042175030 8:66030156-66030178 GAGGCGAGTCTTCTGCCAGCCGG + Intronic
1045491728 8:102675308-102675330 AAAGGGAGGAGTCAGCCAGATGG - Intergenic
1047746149 8:127846480-127846502 AAAGGAAGGCTTCAGCCTGAGGG - Intergenic
1048638504 8:136326355-136326377 AAAGACAGACTCCTGCCAGAAGG + Intergenic
1049612234 8:143561047-143561069 AATGCGAGGGTGCTGCCTGAGGG - Exonic
1049969319 9:807677-807699 AAGCCAAGGCCTCTGCCAGATGG + Intergenic
1050096729 9:2074987-2075009 AAAGAGAAGCTTCTTCCAGTAGG - Intronic
1056874925 9:90318946-90318968 AAGGCCAGGACTCTGCCAGAAGG - Intergenic
1057712855 9:97462891-97462913 AAACACAGGCTCCTGCCAGAAGG - Intronic
1059696541 9:116735341-116735363 AAAGACAGGCTTCTGGTAGATGG + Intronic
1060001372 9:119961957-119961979 AAGGGGAGGATTCTGCCAGCAGG + Intergenic
1061719512 9:132543019-132543041 GAAGTGAGGCATGTGCCAGAGGG - Exonic
1062077034 9:134595125-134595147 AAGGGGAGGCTTCAGGCAGAGGG - Intergenic
1062548730 9:137076370-137076392 AAAGGGTAGCTTCTGCCAGTTGG - Intergenic
1188560482 X:31462506-31462528 ACAGCGAGGTTTCTGCTCGAGGG + Intronic
1197887589 X:131234701-131234723 AAAGCAAGGATTTGGCCAGAGGG - Intergenic