ID: 1161055658

View in Genome Browser
Species Human (GRCh38)
Location 19:2189576-2189598
Sequence AAGCGAGGCTTCTGCCAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 106}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161055655_1161055658 -7 Left 1161055655 19:2189560-2189582 CCTGCATCAGGGCGGAAAGCGAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1161055658 19:2189576-2189598 AAGCGAGGCTTCTGCCAGAAGGG 0: 1
1: 0
2: 1
3: 3
4: 106
1161055653_1161055658 3 Left 1161055653 19:2189550-2189572 CCTGAAATCTCCTGCATCAGGGC 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1161055658 19:2189576-2189598 AAGCGAGGCTTCTGCCAGAAGGG 0: 1
1: 0
2: 1
3: 3
4: 106
1161055650_1161055658 21 Left 1161055650 19:2189532-2189554 CCTCGCTTGTGTGTCAAACCTGA 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1161055658 19:2189576-2189598 AAGCGAGGCTTCTGCCAGAAGGG 0: 1
1: 0
2: 1
3: 3
4: 106
1161055649_1161055658 24 Left 1161055649 19:2189529-2189551 CCACCTCGCTTGTGTGTCAAACC 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1161055658 19:2189576-2189598 AAGCGAGGCTTCTGCCAGAAGGG 0: 1
1: 0
2: 1
3: 3
4: 106
1161055648_1161055658 28 Left 1161055648 19:2189525-2189547 CCGGCCACCTCGCTTGTGTGTCA 0: 1
1: 0
2: 1
3: 14
4: 150
Right 1161055658 19:2189576-2189598 AAGCGAGGCTTCTGCCAGAAGGG 0: 1
1: 0
2: 1
3: 3
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161055658 Original CRISPR AAGCGAGGCTTCTGCCAGAA GGG Intronic
900575953 1:3382551-3382573 AAGCGAGGCTTGAGCCAGCCGGG + Intronic
903641319 1:24862242-24862264 AACAGCAGCTTCTGCCAGAAGGG - Intergenic
903943894 1:26950021-26950043 AGGCCATGCTTCTCCCAGAAAGG + Exonic
904095844 1:27976623-27976645 TAGAGAGACTTCTGTCAGAAAGG + Intronic
904496931 1:30892325-30892347 AAGCCCAGCTTCTGCCAGTAGGG + Intronic
904676958 1:32204558-32204580 AAGGGAGGCTTCTGTTAGGAGGG - Intronic
909984621 1:82145465-82145487 AAGCCATGGGTCTGCCAGAAAGG + Intergenic
910256955 1:85258543-85258565 AAGCTAGGCTTCTACCAGAAGGG - Exonic
913599328 1:120407650-120407672 AAGCAATGCTCCTGGCAGAAAGG - Intergenic
914088050 1:144471967-144471989 AAGCAATGCTCCTGGCAGAAAGG + Intergenic
914310561 1:146462239-146462261 AAGCAATGCTCCTGGCAGAAAGG - Intergenic
914591546 1:149110902-149110924 AAGCAATGCTCCTGGCAGAAAGG + Intergenic
918162119 1:181911099-181911121 AACAAAGGCTTCTGCCAGAGAGG + Intergenic
918863438 1:189862695-189862717 AAGGGTGGCTTTTACCAGAAAGG - Intergenic
919793600 1:201307983-201308005 AAACCAAGCTTCTGCCAGCAGGG - Intronic
920308042 1:205031411-205031433 AAGCCATGGGTCTGCCAGAAAGG + Intergenic
920442285 1:205989180-205989202 AAGCCAGGGTTCAGCCAGACAGG - Intronic
920845905 1:209592775-209592797 AAGCGAGGCTCTTGGCAGAGGGG - Intronic
923858707 1:237871527-237871549 AAACGATGCTTCTTCAAGAAAGG + Intergenic
1064487341 10:15807739-15807761 AAGAGAGACTTCTTCCAGGAAGG + Intronic
1072773324 10:98163291-98163313 AGGTGAGGCTGCTGTCAGAAAGG + Exonic
1075940720 10:126388371-126388393 AAGGCTGGCTTGTGCCAGAACGG - Exonic
1078564508 11:12403048-12403070 CAGCGAGGCATGTGCCAGCAGGG - Intronic
1078803247 11:14668926-14668948 CAGGGAGGCTTGTGCAAGAATGG - Intronic
1081334783 11:41851485-41851507 TAGCCAGGTTTCTGCCATAATGG - Intergenic
1083941171 11:65896732-65896754 CAGAGAAGCTCCTGCCAGAAAGG - Intronic
1085482776 11:76836651-76836673 GAGGGAGGTTTCTGGCAGAAAGG - Intergenic
1094206236 12:27843747-27843769 ATGCGAAGCTTCTGCAACAAGGG - Intergenic
1096849782 12:54428189-54428211 AAGCCAGTCTGCTGCCACAAAGG - Intergenic
1105020975 12:132816737-132816759 CAGGGAGGCCTCTGTCAGAACGG - Exonic
1106556165 13:30810348-30810370 AAGCCAGGCTCCTGCCCGCAGGG - Intergenic
1108049647 13:46420296-46420318 ATGTGAAGCTACTGCCAGAAGGG - Intronic
1109542170 13:63793577-63793599 ATGTGAAGCTACTGCCAGAAGGG - Intergenic
1111189961 13:84794340-84794362 AAGCAAGGCTTTGACCAGAATGG + Intergenic
1113673152 13:112188604-112188626 ATGCAATGCTTCTGCCAAAACGG - Intergenic
1118536498 14:66772266-66772288 AACTGTGGCTTCTCCCAGAATGG - Intronic
1119108289 14:71945468-71945490 AAGTGAGGTTTCTTCCACAATGG + Intronic
1122469775 14:101958344-101958366 AAGCTAGGCTCCTGCACGAATGG + Intergenic
1125062263 15:35438407-35438429 AACGGAGGCTTCTCCCAAAATGG - Intronic
1128643476 15:69357919-69357941 ATGGGAGGCTTCTTCCTGAAGGG + Intronic
1131600724 15:93846268-93846290 AACCGAGGCAACTGCCGGAACGG + Intergenic
1132558406 16:582707-582729 AAGTGAGCCTGCAGCCAGAAGGG - Intronic
1132625005 16:887496-887518 AGCCGAGGCTTCTGTCAGCAAGG + Intronic
1133794270 16:9033562-9033584 AGACAAGGCTTCTGCAAGAAGGG - Intergenic
1134058673 16:11185953-11185975 AAGCAAGGACACTGCCAGAAAGG - Intergenic
1134324317 16:13193137-13193159 AAGCTAGGCTGCCCCCAGAATGG - Intronic
1140036633 16:71376304-71376326 ATGAGAGGCTTCTAACAGAAAGG + Intronic
1140571152 16:76107808-76107830 AAAGGAGCCTTCAGCCAGAAGGG + Intergenic
1141871895 16:86792562-86792584 AAGCAAGTCCTCTCCCAGAAGGG + Intergenic
1146696393 17:34911785-34911807 GAGGAAGGCTTCTGCCAGGAAGG - Intergenic
1149371162 17:55994486-55994508 AGGCTAGGATTCTGTCAGAAGGG + Intergenic
1149866264 17:60152620-60152642 AAGGGAGGCTTCTCCTGGAATGG + Intronic
1154146700 18:11872891-11872913 AAGCGCGGCTGCTGCCAGCATGG - Intronic
1157051111 18:44166321-44166343 AAGCCTGTCTTCTGACAGAAAGG + Intergenic
1159903203 18:74067004-74067026 AAGCGAGGCATCTGCAGGAGAGG + Intergenic
1161055658 19:2189576-2189598 AAGCGAGGCTTCTGCCAGAAGGG + Intronic
1162014064 19:7834365-7834387 AAATGAGGGTTTTGCCAGAAGGG + Intronic
927088402 2:19692024-19692046 AGGGGAGGCTCCTGCAAGAAGGG + Intergenic
927437173 2:23076687-23076709 AAGCAAGGCTTCTTACAGAAAGG + Intergenic
937478754 2:122238310-122238332 AATTGAGGCTTGTGCCAGCAAGG + Intergenic
944756351 2:202765886-202765908 CGGCGAGGCTTCTGGAAGAAAGG + Exonic
1172166623 20:32903462-32903484 ACACGAGGCTTCTGCCATAGGGG - Intronic
1174353219 20:49982681-49982703 AAGCGAGGCCTCTGCGAGGTGGG - Intergenic
1174892215 20:54407955-54407977 AAGCCAGCCTTTTGCCAGGATGG - Intergenic
1179725239 21:43338281-43338303 AAGCCAGGCTTCAGGCAGACGGG + Intergenic
1180929603 22:19579923-19579945 CAGCGAGGCTTCTGAAGGAAAGG + Intergenic
1184959534 22:47918998-47919020 AATCAAGCCTTCTGCCTGAATGG + Intergenic
951854992 3:27186379-27186401 AAGGGTAGCTTCTGGCAGAAAGG + Intronic
953326136 3:42013786-42013808 AAGCGAGGCGTCCCCCAGAGTGG + Intronic
954801164 3:53187687-53187709 CATCTAAGCTTCTGCCAGAAGGG + Intronic
955004234 3:54954347-54954369 AAGCCCTGCTACTGCCAGAAAGG - Intronic
958605015 3:96346186-96346208 AAACTTGGCTTCTCCCAGAAAGG + Intergenic
960126651 3:114005925-114005947 AAGGGAGGCTTTTCCCACAAAGG + Exonic
966881699 3:184354447-184354469 AAGCCTGGTTTCTGCCAGCAGGG + Intronic
968606002 4:1536097-1536119 AAGTGGGGCTGCTGCCAGCAGGG + Intergenic
969688909 4:8693141-8693163 AAGAGAGGCTTCAGACAGAAGGG - Intergenic
984542339 4:181055398-181055420 AGCTGAGGCATCTGCCAGAAAGG + Intergenic
990575626 5:57120854-57120876 AGAGGAGGCTTCTGCCAAAAGGG + Intergenic
993252861 5:85550449-85550471 AGGCGAGGCTTCGGTCAGATAGG - Intergenic
993333236 5:86625346-86625368 AAGTCAGGATTCTACCAGAAAGG + Intergenic
996213781 5:120843022-120843044 AAGCCAGGGTTCTGTCAGCAAGG + Intergenic
998033478 5:138893264-138893286 AAGTGAGGCTGCTGCCCAAAAGG - Intronic
998204690 5:140150093-140150115 AGGGAAGGCTTCTGGCAGAAGGG - Intergenic
1006518507 6:34557628-34557650 AAGCCAGGCTTCTGTGAGAGTGG - Intergenic
1007379277 6:41476656-41476678 AAGCTAGGCTGATGGCAGAAGGG + Intergenic
1008750676 6:54730328-54730350 AATCAAGGCTTCTGTGAGAAAGG + Intergenic
1009920724 6:70056695-70056717 AATGGATGCTTCTGGCAGAAAGG + Intronic
1015175066 6:130297098-130297120 AAGCAAGCCTGCTGCCAGACAGG + Intronic
1015254755 6:131165754-131165776 ATGCCAGGGTTCTGCCATAAAGG + Intronic
1016046806 6:139489338-139489360 AAGGGAGGCTTTTCCCAAAAGGG - Intergenic
1016356601 6:143225178-143225200 AAGTGTGGCCTCTTCCAGAAAGG + Intronic
1017559655 6:155613816-155613838 AACAGAGGTTTCTGCCAAAATGG + Intergenic
1022015739 7:26346899-26346921 AAGCCAGGCTGCAGGCAGAAGGG - Intronic
1024392527 7:48831771-48831793 AAGAGAGGCTTCACCAAGAATGG + Intergenic
1026400051 7:70000954-70000976 AACCCAGCCTTCTGCCAGGATGG + Intronic
1027538603 7:79439015-79439037 AACCGAGGATTTTTCCAGAAAGG - Intronic
1034041791 7:147885530-147885552 AAGTGTGGCTTCTGCAAGATGGG - Intronic
1035350135 7:158239662-158239684 AAGCGGGGCTGCTGGGAGAAGGG - Intronic
1042175031 8:66030157-66030179 AGGCGAGTCTTCTGCCAGCCGGG + Intronic
1045546066 8:103129787-103129809 AATCCAGTCTTCTGCCAGGATGG + Intergenic
1047398362 8:124524670-124524692 AAGAGAGACTACTGACAGAAGGG + Intronic
1050039152 9:1470587-1470609 AAGCCAGTCTGCTGCCAGACTGG - Intergenic
1055640487 9:78315567-78315589 AAGAGTGGCTGCTGGCAGAAAGG - Intronic
1057314382 9:93959184-93959206 AGCGGAGGCTTCTTCCAGAACGG + Intergenic
1057712854 9:97462890-97462912 AACACAGGCTCCTGCCAGAAGGG - Intronic
1060001373 9:119961958-119961980 AGGGGAGGATTCTGCCAGCAGGG + Intergenic
1189230125 X:39445537-39445559 AAACAAGTCTTGTGCCAGAAGGG - Intergenic
1189264510 X:39703422-39703444 AAACCAGGCTTCTGCTAGCAAGG - Intergenic
1198803072 X:140467390-140467412 AAGGAAAGCTTCTCCCAGAAGGG + Intergenic
1199952103 X:152715067-152715089 AAGCCCGGATTCTGCCAGGATGG - Intronic
1199957580 X:152753381-152753403 AAGCCCGGATTCTGCCAGGATGG + Exonic