ID: 1161055659

View in Genome Browser
Species Human (GRCh38)
Location 19:2189582-2189604
Sequence GGCTTCTGCCAGAAGGGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 194}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161055649_1161055659 30 Left 1161055649 19:2189529-2189551 CCACCTCGCTTGTGTGTCAAACC 0: 1
1: 0
2: 0
3: 0
4: 63
Right 1161055659 19:2189582-2189604 GGCTTCTGCCAGAAGGGTCTTGG 0: 1
1: 0
2: 0
3: 15
4: 194
1161055655_1161055659 -1 Left 1161055655 19:2189560-2189582 CCTGCATCAGGGCGGAAAGCGAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1161055659 19:2189582-2189604 GGCTTCTGCCAGAAGGGTCTTGG 0: 1
1: 0
2: 0
3: 15
4: 194
1161055650_1161055659 27 Left 1161055650 19:2189532-2189554 CCTCGCTTGTGTGTCAAACCTGA 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1161055659 19:2189582-2189604 GGCTTCTGCCAGAAGGGTCTTGG 0: 1
1: 0
2: 0
3: 15
4: 194
1161055653_1161055659 9 Left 1161055653 19:2189550-2189572 CCTGAAATCTCCTGCATCAGGGC 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1161055659 19:2189582-2189604 GGCTTCTGCCAGAAGGGTCTTGG 0: 1
1: 0
2: 0
3: 15
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161055659 Original CRISPR GGCTTCTGCCAGAAGGGTCT TGG Intronic
902567388 1:17321181-17321203 GGATTCTGCAAGAAGGATGTGGG + Intronic
903179521 1:21598202-21598224 GGTTTCTTCCGGAAGGGTCTCGG - Intronic
906944116 1:50281038-50281060 GGCTTCTGCCTGATGTGACTTGG + Intergenic
907290925 1:53412432-53412454 GGCATCTCCAAGAAGGGTCCCGG - Intergenic
907832605 1:58079265-58079287 TGTTTCTGCCAGGATGGTCTGGG - Intronic
910480992 1:87658176-87658198 GGCTGCTGCCAGAATCGCCTGGG + Intergenic
910712302 1:90194337-90194359 AGCTTCTGCCAGAAGGAATTGGG - Intergenic
911096157 1:94056694-94056716 GGCTGCTGCCAGACTGGCCTTGG + Exonic
913194502 1:116444507-116444529 GGCTTCTACCAGAAAGTACTAGG + Intergenic
915109419 1:153553576-153553598 TGCTTGTGCCAAAAGGGCCTGGG + Intergenic
917876025 1:179287854-179287876 GCCTGCTGCCAGAAGGCACTGGG - Intergenic
919750508 1:201034795-201034817 GGGATCTGCCAGAAGGGGCGGGG - Intergenic
920453992 1:206083883-206083905 GGCTTCGGCCAGAAGGTACATGG + Intronic
1063742894 10:8844202-8844224 GTGTTCTTCTAGAAGGGTCTAGG + Intergenic
1067332318 10:45333738-45333760 TGCTTATGCCACCAGGGTCTTGG - Intergenic
1067572438 10:47381356-47381378 GGAATCTTCCAAAAGGGTCTGGG - Intronic
1068884817 10:62087428-62087450 GGCTTCTACCAAAAGGCTGTTGG - Intronic
1069640876 10:69954785-69954807 GGCTTCTTACTGAAGAGTCTGGG + Intronic
1069909986 10:71753061-71753083 GGCATCTGCCAGCAGGGGCAGGG - Intronic
1070407773 10:76112240-76112262 CCCTTCTGCCAGGAGGCTCTGGG + Intronic
1071664599 10:87542381-87542403 GGCTTGTGCCAGAGAGGTCAAGG - Intronic
1072643081 10:97228612-97228634 GGCTTTTACCAGAAGAGCCTGGG + Intronic
1077138355 11:1012696-1012718 GGCTGCCCCCAGCAGGGTCTGGG - Intergenic
1077269204 11:1667219-1667241 GCCTTGTGCCAGCAGGGCCTGGG + Intergenic
1077271341 11:1683487-1683509 GCCTTGTGCCAGCAGGGCCTGGG - Intergenic
1077330684 11:1982657-1982679 AGCCTCTGCCGGGAGGGTCTGGG + Intronic
1077435965 11:2539305-2539327 TGCTGCTGCCTGAAGAGTCTGGG + Intronic
1077493989 11:2876760-2876782 GGGTTCTGTAAGAAGGGTGTTGG + Intergenic
1078733945 11:14002670-14002692 GGCTCCTGCCACCAGGCTCTTGG - Intronic
1079151743 11:17906065-17906087 TGGTTATGCCAGAAGGGTCAGGG - Intronic
1079912357 11:26326743-26326765 GGCCTCTGCCTGACTGGTCTAGG - Intronic
1080710509 11:34742807-34742829 GGCTGCAGCTATAAGGGTCTAGG - Intergenic
1081817258 11:45954534-45954556 GGCTTCTGGAAGAAGAGGCTTGG - Intronic
1082083606 11:48031284-48031306 GTCTTCTGACACCAGGGTCTGGG - Intronic
1083163143 11:60867800-60867822 GGCTGCTGCCAGAAGGGAGCTGG + Intronic
1083171030 11:60924293-60924315 CGCCTCTGCCAGGAGGGACTCGG - Intergenic
1085267279 11:75244367-75244389 GGCTTCTGCCCTATGGTTCTAGG - Intergenic
1086575225 11:88331886-88331908 GGTTTCTGTAACAAGGGTCTTGG + Intronic
1088966772 11:114730782-114730804 AGACTCTGCCAGAAGGCTCTTGG - Intergenic
1089047529 11:115516148-115516170 GTCTTCTGCCAGTGGTGTCTGGG - Intergenic
1089424439 11:118359907-118359929 GGCCTCTTCCAGGAGGGGCTTGG - Intronic
1089642592 11:119857587-119857609 GGCTTCTGCAAGAACAGGCTAGG - Intergenic
1089778052 11:120852846-120852868 GACTTCTGAGACAAGGGTCTGGG + Intronic
1090661122 11:128882319-128882341 GGCTTCTGCCAGGAAGGGCTGGG - Intergenic
1202813662 11_KI270721v1_random:37836-37858 AGCCTCTGCCGGGAGGGTCTGGG + Intergenic
1093914839 12:24789752-24789774 GTCTTCTTCCAGAAGGATATGGG - Intergenic
1094403813 12:30093127-30093149 GGCATCTGCAAGAAGGGAATAGG + Intergenic
1094469106 12:30786332-30786354 GGCTTCTGGCATGAGGCTCTTGG - Intergenic
1094758969 12:33506604-33506626 TGCTTCTGACAGAAGCGTTTTGG - Intergenic
1100281672 12:93124328-93124350 GGCTTCTGCCAAAACGATATAGG + Intergenic
1101812968 12:108123439-108123461 GGCTTCTGCAAGAAGAGCCGTGG - Intergenic
1101906151 12:108828010-108828032 GGCTTGTGCCTGGAGGGTTTGGG - Intronic
1104895308 12:132161018-132161040 GGCTTCGGCCAGAGGGGGCCAGG - Intergenic
1110175806 13:72554101-72554123 GCCTTCTGCCAGTTGGGTCAGGG + Intergenic
1110828163 13:79997479-79997501 GGATTCTGCCAGGAGGCTGTAGG + Intergenic
1112440196 13:99419554-99419576 GGCTTCAGCCAAAAGGGTTGTGG + Intergenic
1112807731 13:103181388-103181410 TGATTCTGCCAGGAGAGTCTTGG + Intergenic
1115854698 14:37618337-37618359 CTCTTCTGCCAGAAGGTTCAAGG - Intronic
1120998809 14:90436824-90436846 GCCTACTCCCAGAAGGGTGTAGG + Intergenic
1122614478 14:103007724-103007746 CGCCTCTGCCAGAAGGCACTTGG - Intronic
1122901033 14:104782446-104782468 GGCTTGTGGCAGCAGGGTCAGGG - Intronic
1202849552 14_GL000225v1_random:8396-8418 GGCTGCTGTCAGAAGGCTTTGGG - Intergenic
1126180515 15:45780832-45780854 GGCTTCTGCCTCATGGGCCTGGG + Intergenic
1129326074 15:74800889-74800911 GGCTTCAGCCAGGAAGGCCTGGG - Exonic
1129769127 15:78192544-78192566 AGGTTCTGCCTCAAGGGTCTGGG + Intronic
1133443759 16:5842327-5842349 TGCTTCTGGCAGGAGGGTTTAGG + Intergenic
1133600207 16:7332878-7332900 GGCTCCTGACAGAAGGGATTTGG + Exonic
1135980045 16:27140353-27140375 GGATTCAGCCAGGAGTGTCTTGG - Intergenic
1137691420 16:50430596-50430618 GGCATCTGGCAGAAGCCTCTGGG + Intergenic
1137905878 16:52321431-52321453 GGCTTCTGCAAGAGAGGACTGGG + Intergenic
1139421034 16:66849734-66849756 GGCAGGTGGCAGAAGGGTCTGGG - Intronic
1139547134 16:67654581-67654603 GGCTCCTGCCGGCAGGGTCAGGG - Exonic
1139596426 16:67960935-67960957 GGCTTCTGCCAATAGAGCCTTGG + Intronic
1140406458 16:74714402-74714424 GACTTCTGCCAGAATGGCCTCGG - Intronic
1141426995 16:83951189-83951211 AGCATCTGCCAGCAGGGGCTGGG - Exonic
1141506876 16:84483707-84483729 GGCCTCTGCCATCAGGGTCTGGG + Intronic
1141534355 16:84668832-84668854 GGCTTCTGCCAGAACCTCCTGGG + Intergenic
1141697552 16:85627298-85627320 GGCTTCTGGCAGAAGCCTCTAGG + Intronic
1143161863 17:4877208-4877230 AGGTTCTGCCAGGAGGGTGTGGG + Intronic
1144574840 17:16422850-16422872 CGCTTCTTCCAGAAGGGCCAAGG + Exonic
1144766790 17:17737612-17737634 GGCTTCTGGCAGAGGGGGCTGGG - Intronic
1145798429 17:27668854-27668876 GGCCTTTTCCAGAATGGTCTAGG + Intergenic
1145993500 17:29092924-29092946 GGCATCTGCCAGCAGGGCCTTGG + Exonic
1146665921 17:34703427-34703449 GGCTTCTGCCCAATGGCTCTAGG + Intergenic
1147119444 17:38327277-38327299 TGCTTCTGTCAGAAGCATCTGGG + Exonic
1148038551 17:44687940-44687962 GGTTACTGCCAGAAGAATCTGGG + Intronic
1148323202 17:46769742-46769764 GGCTGCTCCCTGAAGGGTTTGGG + Intronic
1148563509 17:48619817-48619839 GGCCTCTGCCTGCAGCGTCTGGG - Intronic
1148739031 17:49881350-49881372 GCATTCTCCCAGCAGGGTCTGGG + Intergenic
1151434814 17:74088628-74088650 GGCCTCTGTCAGTGGGGTCTGGG - Intergenic
1151688233 17:75662498-75662520 GACTTCTGCCTTAAGGCTCTTGG - Exonic
1152446318 17:80346668-80346690 GGCGTCTGCCACGATGGTCTTGG - Exonic
1152637361 17:81435632-81435654 GGGCTCAGCCAGCAGGGTCTGGG - Intronic
1154146698 18:11872885-11872907 GGCTGCTGCCAGCATGGGCTTGG - Intronic
1155399938 18:25427031-25427053 GGCCTCTGCCAGCAGGATCAGGG + Intergenic
1156292447 18:35760208-35760230 AGCTTCTGCCATAAGAGACTAGG + Intergenic
1158660492 18:59383047-59383069 GGCTTCTACTAGAATGGTTTTGG - Intergenic
1159566746 18:70059689-70059711 TGCTTTTGCCAGAATTGTCTTGG - Intronic
1159719182 18:71864897-71864919 GGACTCTGCCAGAAGGCTCCTGG - Intergenic
1160472819 18:79153732-79153754 GGCTTGAGCCAGGAGGGTCAAGG - Intronic
1161055659 19:2189582-2189604 GGCTTCTGCCAGAAGGGTCTTGG + Intronic
1162495548 19:11021387-11021409 GTCTTCTGCCAGAACGTGCTCGG + Intronic
1164477794 19:28588729-28588751 GGCTTCTTCCAGGAGGGGCTAGG - Intergenic
1165754265 19:38282965-38282987 GGCAGCATCCAGAAGGGTCTTGG + Intronic
1165999641 19:39870713-39870735 GGCTACAGACAGAAGGGTCAGGG + Intronic
1166239774 19:41482276-41482298 AGCTCATGCCATAAGGGTCTTGG + Intergenic
1167112168 19:47468916-47468938 GGCTGGTGGCAGAGGGGTCTGGG - Intronic
926940108 2:18126625-18126647 GGAATCTGTGAGAAGGGTCTGGG + Intronic
927088404 2:19692030-19692052 GGCTCCTGCAAGAAGGGCCTGGG + Intergenic
927184355 2:20471478-20471500 AACCTCTGCCAGAAGGGTCCAGG - Intergenic
928118767 2:28566723-28566745 GGCTAGTGTCTGAAGGGTCTCGG + Intronic
928632297 2:33206131-33206153 TGTTTCTGCCAGAAGAGTCAGGG + Intronic
929373347 2:41253695-41253717 GTCTTCTGCTGGAAGGGTGTTGG - Intergenic
929808744 2:45170215-45170237 GGCTTCTTCCTGAAGAGGCTGGG - Intergenic
930606995 2:53502960-53502982 GCCTTCTGCCAGAACAGGCTGGG + Intergenic
934052212 2:88220392-88220414 GGCTTGTCCCAGATGGGGCTAGG - Intergenic
934991534 2:98925089-98925111 AGCTGCTGCCAGTAGGGGCTGGG + Intronic
936108415 2:109645354-109645376 GGATTTGGCCAGAAGGGGCTGGG - Intergenic
936465497 2:112745137-112745159 GGAATAAGCCAGAAGGGTCTAGG + Intronic
936473719 2:112821859-112821881 GGCTGCTCCTAGAAGAGTCTGGG - Intergenic
942266400 2:174230855-174230877 GGCATCTGTTTGAAGGGTCTGGG + Intronic
942604268 2:177673892-177673914 GGCCTCTGTCAGAATGATCTAGG + Intronic
943528398 2:189047711-189047733 TGCAACTGCCAGAAGGGACTGGG + Intronic
945205963 2:207332611-207332633 GGCTTCTGCAGTAATGGTCTGGG - Intergenic
948627930 2:239280596-239280618 GGCCTCTGCCAGGAGGCTCGGGG + Intronic
948868954 2:240788799-240788821 GCCTTCTTCTAGAAGGGTCCAGG + Intronic
1169305493 20:4486768-4486790 GGCCTTTGCCATAAGGGACTAGG - Intergenic
1169759493 20:9075711-9075733 GGTTTCTGCCAGGTGGGCCTAGG + Intronic
1171039024 20:21742710-21742732 GTCTGCTGCCAGGAGGTTCTGGG + Intergenic
1171565505 20:26181577-26181599 GGCCTCTGCCAGCAGGGCCTTGG - Intergenic
1173218476 20:41110955-41110977 GGCTTCTGCACCAAGGATCTAGG - Intronic
1173496004 20:43518242-43518264 GTCTTCTGACAGAAGAATCTGGG + Intronic
1175039056 20:56028315-56028337 CGGTTCTGAAAGAAGGGTCTGGG + Intergenic
1175574479 20:60050506-60050528 GACTTCTGCCAGCAGGGAGTTGG + Intergenic
1175872833 20:62216544-62216566 GGCTGCTGGCAGAAGGGGCACGG - Exonic
1179836305 21:44036106-44036128 AGCTTCTCCCAGAAGGGAGTTGG + Intronic
1182683311 22:32100090-32100112 TACTTCTGCCTGAAAGGTCTGGG - Intronic
1182778568 22:32849574-32849596 GGTTTTTGCCAGAAGAGTCCTGG + Intronic
1183986965 22:41575358-41575380 GGCTTCTGAGGGAAGGGTCCAGG - Exonic
1185142936 22:49113365-49113387 GGCTTCTGCCCAAATGGACTGGG + Intergenic
950188975 3:10963363-10963385 GGCTTCTGCCGCAAGTGCCTTGG - Intergenic
953178850 3:40578373-40578395 GGCTTCTGACAGCTGGGGCTTGG - Intergenic
953210572 3:40871480-40871502 GGCTGCTTCCAGAAGGGACTTGG - Intergenic
956121613 3:65971721-65971743 GGCTTCTCCCAGCAGGGTGCAGG - Intronic
956416013 3:69029979-69030001 TGCTGCTGCCAGCAAGGTCTGGG + Exonic
961181817 3:124883851-124883873 GGATTCTGTCTGAAGGCTCTTGG + Intronic
961615114 3:128173126-128173148 GGCTTTTATTAGAAGGGTCTGGG + Intronic
963039026 3:141055287-141055309 TGCTTCTGCTAGAAGGGGCAGGG + Intronic
963648232 3:147944269-147944291 GGCTTCAGCCAGAAAGGTGGAGG + Intergenic
965666138 3:171095378-171095400 GGCTTCTGGAAGAAGGATTTTGG + Intronic
966344333 3:178961772-178961794 GGCTTCAGCCAGAAAGGTCCAGG - Intergenic
968005769 3:195241685-195241707 GGATTCAGGCAGAAGGTTCTGGG - Intronic
971263311 4:25076502-25076524 GCCTTCTGCCAGAAGGAGCCTGG + Intergenic
972029022 4:34428746-34428768 GGCCTCTGCCAGCAGAGCCTTGG - Intergenic
972474368 4:39436381-39436403 GGGTTCTGCCTACAGGGTCTGGG + Intronic
973558747 4:52112785-52112807 ATTTTCTGCCAGCAGGGTCTAGG + Intergenic
974629526 4:64466082-64466104 GGCCTTTGCCAGAAGAGGCTGGG - Intergenic
979025169 4:115562423-115562445 GCCATCTGCAAGAAGGCTCTGGG + Intergenic
985552085 5:538853-538875 GGCCTGTGCTAGCAGGGTCTTGG - Intergenic
985730423 5:1544412-1544434 GGCTTCTCCCTGAAGCCTCTGGG - Intergenic
987942105 5:24552882-24552904 GGAATCTGTCAGAAGGCTCTGGG - Intronic
988651407 5:33155769-33155791 AGATTCTGCCAAAAGGCTCTTGG + Intergenic
991608755 5:68428986-68429008 GGGTGCTGCCAGAAGGCACTGGG + Intergenic
994232030 5:97317619-97317641 GGCTCCTTCCAGAGGGTTCTTGG + Intergenic
994775252 5:104031180-104031202 GCCCTCTGCCAGAAGAGCCTGGG - Intergenic
996704819 5:126486544-126486566 GTCCTCTGCCAGAAGAGCCTGGG - Intronic
998276874 5:140763079-140763101 TCCTTCTGCCAAAAGGCTCTAGG - Intergenic
999275260 5:150325732-150325754 GGCTGCTCCCAGGAGGGTCCAGG - Intronic
1001155554 5:169269661-169269683 GGCTTCTGCCTGAATGGGGTTGG - Intronic
1001528576 5:172446279-172446301 GGCTTCTGCAGGCAGGGCCTGGG - Intronic
1001622864 5:173103082-173103104 GGCTTCTCCTACAAGGGTCAAGG - Intronic
1001848512 5:174942281-174942303 TGCTGCTCCCAGAAGGATCTCGG - Intergenic
1002082582 5:176746240-176746262 GGATTCTGCCAGCCGTGTCTGGG + Intergenic
1003178990 6:3775960-3775982 GCATTCTGCCTGAAGGGTTTTGG + Intergenic
1004969826 6:20897395-20897417 GGCCTCTGCTATAAGGGGCTTGG - Intronic
1006817915 6:36865607-36865629 GGCATATGCGAGATGGGTCTTGG - Intronic
1007117183 6:39351044-39351066 GACTGCTGGCAGAAGGGTCTTGG - Intronic
1007408637 6:41648980-41649002 GGCAGCTGGCAGAGGGGTCTGGG - Intronic
1008828280 6:55726380-55726402 GGCTTTTACCAGGAGGCTCTAGG + Intergenic
1011158691 6:84363778-84363800 AGCTGCTTCCAGAAGGGTCTAGG - Intergenic
1014457520 6:121653771-121653793 GGTTGCTGCCAGAAGGGACTGGG - Intergenic
1017326117 6:153143293-153143315 GGCTTTTGGCTGAAGGGACTTGG + Intergenic
1017474467 6:154774534-154774556 GTCTTTTGCCACAAGGTTCTTGG + Intronic
1017690183 6:156956301-156956323 GGCTTCTGAGAGAAGGGTGGGGG - Intronic
1018071579 6:160168543-160168565 GGCTGCAGGCAGGAGGGTCTGGG - Intergenic
1018745495 6:166758469-166758491 TGGTTCTGCCAGAAGCGTCCAGG + Intronic
1019437382 7:1028938-1028960 GGCCTCTGCCTGCAGGGCCTGGG - Intronic
1019968341 7:4519741-4519763 GGCTTCTCTCAGATGTGTCTGGG - Intergenic
1022766925 7:33423481-33423503 TGCTTCTGGTAGCAGGGTCTAGG + Intronic
1023125601 7:36951350-36951372 GGCTCCGGCCAAAATGGTCTTGG + Intronic
1025271958 7:57530283-57530305 GGCCTCTGCCAGCAAGGCCTTGG + Intergenic
1029664456 7:101986046-101986068 GGCTTCTGACAGACAGATCTGGG - Intronic
1034041787 7:147885524-147885546 GGCTTCTGCAAGATGGGGCGGGG - Intronic
1034278029 7:149832608-149832630 GGCTTCTTGCAAAAGGGGCTTGG + Intergenic
1037584636 8:20268258-20268280 GGCATCTGCCAGCTGGGGCTGGG + Intronic
1043994918 8:86801492-86801514 AGCTTCTGGCAGCAGGGTATAGG - Intergenic
1045225679 8:100243078-100243100 CACTTCTGCCAGTAGGGTTTAGG + Intronic
1045942474 8:107755184-107755206 GTCTTCTTCCACTAGGGTCTTGG - Intergenic
1046181579 8:110655962-110655984 GGCTACTGCCAAAATGTTCTTGG - Intergenic
1055086088 9:72315539-72315561 GGCTTCTGCTGTAAGGGTCGTGG - Intergenic
1055118113 9:72627231-72627253 TCCTTCTGCCAGAGCGGTCTGGG + Intronic
1059334001 9:113557312-113557334 TGCTGCTGCCAGAAGGGCCAGGG + Intronic
1059551259 9:115231826-115231848 GCCCTCTGCCTGAAGGGACTTGG - Intronic
1062229875 9:135476071-135476093 TCCTCCTGCCAGCAGGGTCTGGG + Intergenic
1186356020 X:8790936-8790958 GCCTTCTCACAGAAGTGTCTAGG + Exonic
1190511137 X:51175493-51175515 GGTTTATACCAGAAGGGCCTTGG - Intergenic
1195675717 X:107506050-107506072 GGGTTATGCTAGAAGTGTCTAGG - Intergenic
1197612776 X:128657654-128657676 GGCTTATACTAGAAGGGCCTTGG + Intergenic
1198110139 X:133495857-133495879 GGCTCCAGCCAGGAGGGACTGGG - Intergenic
1200205344 X:154311603-154311625 GGGTTCTTCCAGAAGAGTGTGGG - Intronic