ID: 1161055665

View in Genome Browser
Species Human (GRCh38)
Location 19:2189606-2189628
Sequence CAGCTGGCTGGTGGCTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 367}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161055655_1161055665 23 Left 1161055655 19:2189560-2189582 CCTGCATCAGGGCGGAAAGCGAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1161055665 19:2189606-2189628 CAGCTGGCTGGTGGCTGTCCAGG 0: 1
1: 0
2: 2
3: 36
4: 367
1161055660_1161055665 -7 Left 1161055660 19:2189590-2189612 CCAGAAGGGTCTTGGCCAGCTGG 0: 1
1: 0
2: 1
3: 19
4: 291
Right 1161055665 19:2189606-2189628 CAGCTGGCTGGTGGCTGTCCAGG 0: 1
1: 0
2: 2
3: 36
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161055665 Original CRISPR CAGCTGGCTGGTGGCTGTCC AGG Intronic
900151243 1:1180182-1180204 CTGCAGGCCGGTGGCTGTTCAGG - Exonic
901044158 1:6385588-6385610 CAGGAGGCTGGTGGCTGGCCAGG - Exonic
901432149 1:9223006-9223028 CAGGTGGATGGGGGCCGTCCAGG - Intergenic
901692753 1:10984242-10984264 CTAGTGGCTGGTGGCAGTCCTGG + Intergenic
901734551 1:11304216-11304238 CAGTTGGCTGGTGGCTGGGATGG + Intergenic
902646694 1:17804555-17804577 CAGCTGGGTGGTGGCTGCAATGG - Intronic
902794790 1:18794025-18794047 CAGCTTGCCGGTGGCTATACCGG - Intergenic
903016587 1:20365910-20365932 CAGCTGGCTTCTGGCTTTGCTGG + Intergenic
903362423 1:22784913-22784935 CACATCGCTGGTGGCTGCCCGGG + Exonic
903807715 1:26017330-26017352 CAGCTGCCTGGGGGCTGCCTGGG - Intergenic
903886924 1:26546111-26546133 AAGCTGGCTTTGGGCTGTCCTGG + Intronic
904034315 1:27550837-27550859 CACGGGGCTGGTGGCTGCCCTGG - Exonic
904489660 1:30850511-30850533 CACCAGGCTGGGGACTGTCCTGG - Intergenic
905020555 1:34808111-34808133 CCGGTGGCTGGTGGCTCTACAGG + Intronic
905086690 1:35386168-35386190 CAGCTGTGTGGTAGCTTTCCAGG + Exonic
905651847 1:39661911-39661933 CTGCTGGCGGCTGGCTGTTCAGG + Intronic
906633082 1:47388893-47388915 CAGCTGGGCACTGGCTGTCCGGG + Intergenic
908004953 1:59718424-59718446 GAACTGGTTGGTGGCTCTCCTGG - Intronic
910380182 1:86618487-86618509 CAACAGGCTGGTGGCTGGGCTGG + Intergenic
913058792 1:115185889-115185911 CAGCTTGCTGGAGGCAGTCGGGG - Intergenic
913088245 1:115458651-115458673 CAGCTGGCTGGTAAGTTTCCTGG - Intergenic
914346020 1:146799212-146799234 CAGCTGGGTGGTGGGTAGCCTGG + Intergenic
917944959 1:179960097-179960119 CAGGTGGCTGGAGCCTGTCCCGG + Intronic
918043078 1:180925058-180925080 CAGCTAGGAAGTGGCTGTCCAGG + Intronic
919054877 1:192557932-192557954 CTGATGGCTGCTGGCTGACCAGG + Intergenic
919691073 1:200528952-200528974 AAGCTGGCTGGTTGCCCTCCAGG + Intergenic
919760174 1:201092925-201092947 CAGCTAGCTGGTGGCAGTGCTGG - Intronic
920801045 1:209187803-209187825 CAGGTGGCTGGTGGATATCAGGG + Intergenic
922711972 1:227841177-227841199 CATCAGGCTGCTGGCTGGCCTGG + Intronic
922741488 1:228016541-228016563 CAGCTGCAAGGAGGCTGTCCAGG + Intronic
922750315 1:228067182-228067204 CAGCTGGCTGCTGGGTGGGCAGG - Intergenic
923167438 1:231379545-231379567 CAGGTGGCTGGGGCCTATCCTGG + Intronic
924123318 1:240824594-240824616 CAGCTTGCTGATTGCTGTCAAGG + Intronic
1062954813 10:1533070-1533092 CAGCTGGCTCGTTACTCTCCAGG - Intronic
1064168496 10:13007215-13007237 TAGTTGGCAGGTGGCTGTGCAGG + Intronic
1065773558 10:29099665-29099687 AAGCTGGCTGGGGCATGTCCTGG + Intergenic
1065993081 10:31031767-31031789 CCGCTGGCAGCTGGCAGTCCCGG - Intronic
1066310179 10:34188507-34188529 CCGTTGGCTGGTGGGTATCCTGG - Intronic
1067091653 10:43268764-43268786 CAGAGGGCTGATGGCTGGCCAGG - Intergenic
1067165656 10:43864549-43864571 CAGCTGGCAGGTGGCAGAGCCGG - Intergenic
1067735805 10:48849351-48849373 AAGCTGCCTGGTGGATGTGCAGG - Intronic
1068880358 10:62042477-62042499 CAGCTAGCTGGTGGGTGGCATGG + Intronic
1069489381 10:68848318-68848340 CAGCTGGGTTGTGCCTGACCTGG - Intronic
1069813440 10:71179002-71179024 GAGGAGGCTGGTGGCTGTCTAGG - Intergenic
1072530783 10:96316706-96316728 CAGCTGGTTGGTGGCAGAGCTGG - Intronic
1073100976 10:101006562-101006584 CAGCGAGCTGGTGGCTCTGCGGG + Exonic
1073196077 10:101693783-101693805 CAGGAGGCTGGAGTCTGTCCAGG - Intronic
1073462593 10:103675023-103675045 CAGCTGGCTGCTGCTTATCCTGG - Intronic
1073850728 10:107614647-107614669 CATTTAGCTGGTGGCTGTGCAGG + Intergenic
1074078439 10:110150054-110150076 GAGCAGGCTGGTGGAAGTCCTGG - Intergenic
1074411262 10:113230529-113230551 TAGCTGCCTGGTGGTGGTCCAGG + Intergenic
1074544561 10:114392618-114392640 CAGCTGGCTGGCAGCGTTCCTGG - Intronic
1074648525 10:115491670-115491692 TAGCTTGCTGGGGTCTGTCCGGG + Intronic
1076053209 10:127351639-127351661 CCCCGGGCTGGTGGCAGTCCTGG - Intronic
1076875817 10:133215041-133215063 CAGCTGGCGCTTGGCTGTCGTGG + Intronic
1076916277 10:133424339-133424361 CAGCTGGCTGGGGGCGGGACGGG + Intronic
1076936384 10:133569134-133569156 CAGCTGGCTGGGGGCGGGACGGG + Intronic
1078545704 11:12245644-12245666 CAGCTGGCCTGTGGCTGACCTGG - Intronic
1079284578 11:19117284-19117306 CGGCCGGGCGGTGGCTGTCCTGG + Intronic
1079989300 11:27230271-27230293 CAGCTGACTGGTGGCTTTCAGGG - Intergenic
1080784217 11:35460212-35460234 CAACAGGCTGGTGTCTGTCTTGG + Intronic
1081744901 11:45466091-45466113 CAGCAGACTGATGGCTGTCATGG - Intergenic
1081886478 11:46501428-46501450 CAGGTGGCTGGAGCCTATCCTGG - Intronic
1082772279 11:57217285-57217307 CTGCTGGCAGGAAGCTGTCCTGG - Intergenic
1082903858 11:58285175-58285197 CAGCTGGGAGGTGGGTGGCCTGG + Intergenic
1083273732 11:61585418-61585440 CAGCTGGAAGTTGGCTGTGCAGG + Intergenic
1083300498 11:61737547-61737569 GAGCTGGCTGGTGGCAGGCTGGG - Intronic
1083784479 11:64935893-64935915 CAGCTTGGTGCTGGCTCTCCAGG + Intergenic
1084560034 11:69899486-69899508 CAGATGGCCTGGGGCTGTCCTGG - Intergenic
1085003467 11:73062070-73062092 CATCTGGCAGGTGCCTGTCTGGG + Intronic
1085294889 11:75425737-75425759 CAACTGGGTGGAGGCTGCCCAGG - Intronic
1086825475 11:91490106-91490128 CAGCTGGGAGGTGGCTAGCCTGG - Intergenic
1088510683 11:110570933-110570955 CGGGTGGCAGGTGCCTGTCCTGG + Intergenic
1089012921 11:115145314-115145336 CAGCAACTTGGTGGCTGTCCAGG + Intergenic
1089327648 11:117668360-117668382 CAGCTGGCTGGGGGCCGCTCTGG - Intronic
1089737957 11:120562925-120562947 CAGCTGCCTGGTGGCAGTGGGGG + Intronic
1090352862 11:126118722-126118744 AAGCCGGCTGGTGGCTGTAGAGG + Intergenic
1090411527 11:126512963-126512985 CAGCTGGATGGTGGCAGGACTGG + Intronic
1090421125 11:126575724-126575746 GGGCTGCCTGGTGGCTGTCCTGG + Intronic
1091231226 11:133989098-133989120 AAGCTAGCTGGTGGCAGCCCTGG - Intergenic
1091236776 11:134027276-134027298 CACCTGGCTGCTGGCTTACCTGG - Intergenic
1092196432 12:6552332-6552354 CAGCAGGGTGGTGGCTGGGCTGG - Intronic
1092197372 12:6557382-6557404 CAGCTGGCTGACTGCTATCCTGG + Exonic
1092360349 12:7831405-7831427 CAGCTGGGTGGGAGCTCTCCAGG + Intronic
1092373002 12:7932787-7932809 CAGCTGGGTGGGAGCTCTCCAGG + Intronic
1095253864 12:40010867-40010889 CAGCTGGCAGATGACTTTCCAGG - Intronic
1095924855 12:47568317-47568339 AAGCTGACTGGTGGGTGTACGGG - Intergenic
1096229909 12:49890975-49890997 CAGCTCACTGGTGGCTGGCAGGG + Intronic
1098226641 12:68331725-68331747 CAGGTAGCTGGTAGCTGTCAGGG - Intronic
1100493171 12:95100463-95100485 CAGCTGGCTGCTTGCTGCCGTGG + Intronic
1101813512 12:108128628-108128650 GATCTGGCTGGTGGCTGCACAGG - Intergenic
1102552240 12:113699925-113699947 CAGCAGGCTGATGGCTGATCTGG - Intergenic
1103530077 12:121595093-121595115 CTGCTGGCTGGTGGCGGTGGAGG - Intergenic
1105571879 13:21610810-21610832 CTGCGGGCTGGTGGCTGGCAGGG + Intergenic
1106231944 13:27827106-27827128 CAGCTGACTGGATGCTGTCATGG + Intergenic
1106543966 13:30714643-30714665 CAGCCTGCTGATGGCTGTCTTGG + Intronic
1107690475 13:42948165-42948187 CAGCTGGCTGCTGGGCCTCCCGG - Intronic
1107944190 13:45402809-45402831 CAGCTGGCTGGAGACTGTAGTGG - Intronic
1108061940 13:46542085-46542107 CAGCTGGCTGTTGGCCTTGCTGG + Intergenic
1110630059 13:77697721-77697743 CAGCTCGGTGGTGGCTGCCGCGG + Intergenic
1115313140 14:31999446-31999468 CAGCTGGCTAGTGGATGAGCAGG + Intergenic
1116905337 14:50397764-50397786 GAGAGGGCTGGTGGCTGCCCTGG + Intronic
1121121023 14:91376030-91376052 CTGCTGGCTGTTGGCTGACTGGG - Intronic
1121271035 14:92638489-92638511 AAGGTGGCAGGAGGCTGTCCTGG + Intronic
1121638126 14:95467439-95467461 AAGCTGGGTGGTGGTTGGCCGGG - Intronic
1121712995 14:96053068-96053090 CAGTTGGCCTGGGGCTGTCCTGG - Intronic
1121717404 14:96086239-96086261 CAGCTAGCTGGTGACTCACCAGG - Intronic
1122094389 14:99360825-99360847 CAGCTGGGTGATAGCTGGCCGGG - Intergenic
1122112981 14:99514687-99514709 TGGCTGGCTGGAGGCTGCCCTGG - Exonic
1122804164 14:104248263-104248285 CATCTGAGTGGTGGCTGCCCAGG + Intergenic
1122992173 14:105241598-105241620 CAGGTGGCCAGTGGCTCTCCTGG - Intronic
1202833286 14_GL000009v2_random:59056-59078 CAGCTGGCTGCATGCTGCCCTGG - Intergenic
1125525111 15:40369645-40369667 CAGCTTGCTGGTGGCTGTGCTGG - Exonic
1127804060 15:62502462-62502484 CAGCTGCCTGGTGCCTGACCTGG + Intronic
1127866486 15:63037381-63037403 CAGCTGGGAGGTGGCAGTGCAGG - Intergenic
1128061758 15:64739757-64739779 CAGCTGGCTTGTGACTGTAAAGG - Intergenic
1128103532 15:65026042-65026064 CAGCTGGTTGGTGCCTCCCCAGG - Intronic
1128456730 15:67835424-67835446 CGGCTGGCTAGTGGGGGTCCCGG + Intergenic
1129067118 15:72914635-72914657 CTATTGGCTGGGGGCTGTCCAGG - Intergenic
1129167697 15:73788158-73788180 CTGCTGGTTGAGGGCTGTCCTGG - Intergenic
1129604376 15:77017681-77017703 CAGCTGGAAAGTGGCTGGCCTGG - Intronic
1129718444 15:77865049-77865071 CAGGCAGCAGGTGGCTGTCCAGG + Intergenic
1129859677 15:78850891-78850913 CAGCTAGCTAGTGGCAGTGCTGG - Intronic
1131674374 15:94655830-94655852 CAGGTGGCTGGAGCCTGTCCTGG + Intergenic
1132833753 16:1942505-1942527 CAGGTGCCTGGTGGCACTCCTGG + Intronic
1133640646 16:7713951-7713973 CAACTTGCTGGTGGCAATCCAGG + Intergenic
1133840059 16:9399817-9399839 CAGCTGGCAGCTTGCTTTCCTGG + Intergenic
1133965742 16:10530502-10530524 CAGGATGCTGGGGGCTGTCCTGG - Exonic
1134089473 16:11383935-11383957 CAGCAGGCGGGGAGCTGTCCCGG + Exonic
1135700004 16:24624099-24624121 CAGCTGGCTGTTGGCTAGCTGGG + Intergenic
1136075828 16:27816747-27816769 CAGCTGGCTTGTGGCAGGGCTGG + Intronic
1136279747 16:29201393-29201415 CAGCTGGCTGGGGGCAGTGGCGG - Intergenic
1137693908 16:50448533-50448555 TAGCTAGCTGGTGGCAGTGCTGG + Intergenic
1141096662 16:81167906-81167928 CAGCAGCCAGGTGGGTGTCCAGG - Intergenic
1141920779 16:87134073-87134095 CAGATGGCTGCTGGGTGTGCTGG - Intronic
1142256487 16:89016147-89016169 GTGCTGGCTGTTGGCTGTGCTGG - Intergenic
1142256497 16:89016243-89016265 GTGCTGGCTGTTGGCTGTGCTGG - Intergenic
1142256578 16:89016946-89016968 GTGCTGGCTGTTGGCTGTGCTGG - Intergenic
1142309068 16:89301678-89301700 CAGCAGCCTGGAGGCTGTCCAGG - Intronic
1142373304 16:89694779-89694801 CATCTGGCCGGTGGGCGTCCTGG + Exonic
1143547117 17:7604030-7604052 CTTGTGGCTGGTGGCTGGCCCGG - Exonic
1143893587 17:10120236-10120258 GAGGTGGCCGGTGGCTGGCCTGG - Intronic
1144128319 17:12222589-12222611 CAGGTGGCTGGTTTCTGACCAGG + Intergenic
1144458606 17:15439335-15439357 ACGCTGCCTCGTGGCTGTCCAGG + Intronic
1144785116 17:17827182-17827204 CAGCTCCTTGGTGGCCGTCCTGG - Intronic
1146457972 17:33021840-33021862 CATCTGGCTGGGGGGTGTTCTGG + Intronic
1146812433 17:35914678-35914700 CAGGTGGCTGATGGCTGAGCTGG + Intergenic
1147451162 17:40505362-40505384 CAAATTTCTGGTGGCTGTCCTGG + Intergenic
1151284644 17:73101250-73101272 CAGGTGGCTGTTGGCTGCCCTGG - Intergenic
1151329626 17:73399167-73399189 CCGCTGGCTGGTGGAAGCCCAGG - Exonic
1151354200 17:73548842-73548864 CAGCTGGAAGGTGGCTTCCCTGG + Intronic
1151817189 17:76477131-76477153 CCCCAGGCTGGTGGCTGGCCTGG + Intronic
1152221801 17:79072844-79072866 CTGCAGGCTCTTGGCTGTCCTGG - Intergenic
1152563080 17:81088311-81088333 CAGCTGCCTGCTGGGGGTCCAGG + Intronic
1152739723 17:82013613-82013635 CTGCTGCCTGGGGGATGTCCAGG + Intronic
1152863650 17:82709829-82709851 CACATGGCTGCTGCCTGTCCTGG + Intergenic
1152940301 17:83167697-83167719 CAGGTGGCTGGAGCCTATCCCGG - Intergenic
1153823788 18:8856115-8856137 TAGATGGCTGGTGACTGTCAGGG + Intergenic
1154402323 18:14051935-14051957 CAGTTGGCAGGTGGCTGACATGG + Intergenic
1155473087 18:26210624-26210646 CAGCTTGCAGGTGGCTATCATGG + Intergenic
1157557843 18:48624330-48624352 CTGCTGGGTGGTGGCTGAGCTGG + Intronic
1159883799 18:73885132-73885154 AAGCTGGCTGGGGGATGCCCTGG + Intergenic
1160134309 18:76259496-76259518 CAGCAGGCTGGCCTCTGTCCTGG - Intronic
1160316360 18:77851435-77851457 CAGCTGGCACTTGGCTGTCAAGG + Intergenic
1160763446 19:797134-797156 CAGCTGGCGCGTGGCTTTGCGGG - Exonic
1160765604 19:806227-806249 GAGCCGGCGGGTGGCTGTGCGGG + Intronic
1160832751 19:1111314-1111336 CAGCTGCCGGGTGGGTTTCCAGG - Intronic
1160899057 19:1417817-1417839 CAGAGGGCTGGGGGCTGGCCAGG + Intronic
1160938712 19:1610075-1610097 CAGCTGGCTGGGGACTGTCTTGG - Exonic
1160985682 19:1837523-1837545 CTGCTGGGTGGTGGAGGTCCAGG - Intronic
1161055665 19:2189606-2189628 CAGCTGGCTGGTGGCTGTCCAGG + Intronic
1161334628 19:3706118-3706140 CAGAAGGCTGGTGGCTCTCCCGG - Intergenic
1161775853 19:6261697-6261719 CATCTGGGTGGTGGGAGTCCAGG - Intronic
1162326625 19:10003372-10003394 CAGCTGACTGATGACTGTCAGGG - Intronic
1162400952 19:10446301-10446323 GCGCTGGCTGGTGGCCGCCCCGG - Exonic
1163034015 19:14561317-14561339 TTGCTGGCTGGTGGCTGACTTGG + Intronic
1163195306 19:15715401-15715423 CAGATGGCTGGGAGCAGTCCAGG + Intergenic
1163449905 19:17370608-17370630 AAGCAGGTTGGTGGCTGTCAGGG + Intronic
1163862664 19:19750309-19750331 CAACTGGCTGGGAGCTGCCCTGG - Intergenic
1164071613 19:21774347-21774369 CAAGTGGCTGTTGGCTGTCTAGG + Intergenic
1164272916 19:23689032-23689054 CAAGTGGCTGTTGGCTGTCTAGG + Intergenic
1164522631 19:28990712-28990734 CCGCTGGCTGGTGGGGGCCCTGG - Intergenic
1164726644 19:30469803-30469825 GAGGTGGATGGTGCCTGTCCTGG + Intronic
1164759936 19:30721036-30721058 AAGCTGGGTGGTGGCTGCCAGGG - Intergenic
1165120288 19:33554342-33554364 CAGCTGGCTGTTGGGTCCCCAGG + Intergenic
1167414527 19:49363107-49363129 GAGACGGCTGGCGGCTGTCCCGG + Intronic
1167503120 19:49858290-49858312 CAGCCAGCTGGTGGCTGTGCAGG + Intronic
1167534421 19:50040541-50040563 CAGCAGGCTGGCTGCTCTCCTGG - Intronic
1167621566 19:50563699-50563721 CAGCTGGCTGATGGCTGGGGTGG - Intronic
1202639383 1_KI270706v1_random:68640-68662 CAGCTGGCTGCTAGCTGCCCTGG + Intergenic
925078416 2:1039885-1039907 CAGGAGGCTGGCGGCTGTCCTGG + Intronic
925370832 2:3344193-3344215 CATCTGCCTGGTGGCCGTCAGGG - Intronic
925380232 2:3419713-3419735 CAGCTCGCTGGTGGGTGCCGTGG + Intronic
925793989 2:7523226-7523248 CAGCTGGCTGGTGGGTAGCTGGG - Intergenic
926378097 2:12254598-12254620 CAGCTGGCAGGTGGCTGAGTAGG - Intergenic
928390905 2:30910311-30910333 CAGCTAGTTGGTGGCAGCCCAGG + Intergenic
928924138 2:36559705-36559727 CAGCCGCCTGGTGCCTCTCCAGG - Intronic
931246495 2:60496725-60496747 AGGCTACCTGGTGGCTGTCCTGG - Intronic
932768955 2:74489917-74489939 TAGCTGGTTGGTGGCTGCCATGG + Intronic
933764055 2:85695238-85695260 CTCCTGGCTGGTGGGAGTCCAGG - Intronic
934112158 2:88754105-88754127 CAGATGGCTGGGAGCTGGCCTGG - Intergenic
934708998 2:96503166-96503188 TGGCTGGCTGGAGGCAGTCCAGG + Intronic
935110055 2:100084405-100084427 CAGCTAGCTGGTGGCAGAGCAGG + Intronic
936124924 2:109780803-109780825 CAGCTAGCTGGTGGCAGAGCAGG - Intergenic
936219769 2:110590665-110590687 CAGCTAGCTGGTGGCAGAGCAGG + Intergenic
937521741 2:122720710-122720732 CAGCTGGGAGGTGGGTGGCCTGG + Intergenic
937912358 2:127081777-127081799 CAGCTGGGTGGTGGGTGCCTGGG - Intronic
938008785 2:127811545-127811567 CAGCTAGCTGGTGGCAGCCCTGG + Intergenic
938598315 2:132811683-132811705 CAGCTGGGTGGTGGGTAGCCTGG - Intronic
939148033 2:138440130-138440152 CAGGTAGCTGGTGCCTTTCCTGG + Intergenic
940565066 2:155350905-155350927 CATCAGGCTGGTGCCTGTCTGGG - Intergenic
940709432 2:157144231-157144253 CAGCTGGCAGGTGGGTATCCTGG - Intergenic
941547152 2:166865681-166865703 AAGGTGGCTGATGGCTCTCCAGG - Intergenic
944426075 2:199584686-199584708 CACCTGGCTGGTGGAAGTACTGG + Intergenic
945204540 2:207318259-207318281 CAACAGGCTTGTGGCTGCCCTGG - Intergenic
946183758 2:217965135-217965157 CTGCTGGCTGGTGGATTTCTGGG + Intronic
946294940 2:218776654-218776676 GAGCTGGGTGGTAGCTGCCCTGG + Intergenic
946583907 2:221161881-221161903 CAACTGGGTGGTTTCTGTCCAGG + Intergenic
947012672 2:225582928-225582950 CAGCGGGCTCGTGGGTGTCCGGG - Exonic
947168261 2:227284474-227284496 CAGCCGGTTGGTGGCTGAGCAGG + Intronic
947670595 2:231933349-231933371 AAGCTGGGTGGTGGCTGAGCCGG + Intergenic
947789936 2:232859614-232859636 CAGCTGGGTGGTGGTTCTCCTGG + Intronic
948328149 2:237142865-237142887 CAGCTGGTAAGTGGCTGGCCTGG - Intergenic
948807081 2:240457666-240457688 CACCTGGCTCGAGGCTGTCCTGG - Intronic
949017827 2:241723425-241723447 TGGCTGGCTGGTGGCTGCTCTGG + Intronic
1169245878 20:4024153-4024175 CAGCTGGCTTCTTGATGTCCTGG - Intergenic
1169479171 20:5962078-5962100 AAGGTGGCTGGGGGCTGGCCAGG + Intronic
1169775214 20:9244979-9245001 ATGTTGGCTGGTGGCTGTCTGGG + Intronic
1169956421 20:11108165-11108187 CAGCTGGCTGGGGGCTGATAAGG + Intergenic
1170933021 20:20785845-20785867 CAGTTGGCTGTTGGCTGATCAGG - Intergenic
1171131026 20:22653021-22653043 GAACTGGCTGGTGCCAGTCCCGG + Intergenic
1171215165 20:23347120-23347142 CAGATGGCTGGTGGCTGAGCTGG + Intergenic
1173023207 20:39285027-39285049 CAGCAGTGTGGGGGCTGTCCTGG - Intergenic
1173201227 20:40956670-40956692 CAGCTGGTTGGTGGCTCAGCTGG + Intergenic
1173525097 20:43726237-43726259 CAGCTGGCAGTTTACTGTCCTGG + Exonic
1174188385 20:48722942-48722964 CAGCTGGCTGGTGCCGGTGGGGG - Intronic
1175203000 20:57290836-57290858 CAGCAGGCTGGTAGCTGCCCCGG - Intergenic
1175247225 20:57589470-57589492 CAGGTGGCAAGTGGCTGTGCAGG - Intergenic
1176109511 20:63405026-63405048 CCCCTGGCTGGTGGGGGTCCTGG - Intergenic
1176215682 20:63946606-63946628 CAGGTGGCAGGAGCCTGTCCAGG + Exonic
1176647713 21:9366249-9366271 CAGCTGGCTGCATGCTGCCCTGG + Intergenic
1178929146 21:36802311-36802333 CATCTGTCTGTTGGTTGTCCAGG + Intronic
1179563866 21:42234492-42234514 CACCTGGCTGGGGGCTGCACTGG + Intronic
1179642754 21:42758034-42758056 CAGCTGCCTGCTGCCTGTACAGG - Intronic
1180074444 21:45455575-45455597 CTGCTGCCTGGCGGCTGCCCGGG + Exonic
1180228288 21:46411479-46411501 GAGCCGGCTGCTGGCTGACCAGG + Exonic
1180362560 22:11913224-11913246 CAGCTGGCTGCAAGCTGCCCTGG - Intergenic
1180825091 22:18856231-18856253 CAGCTCTCTTGTGGCTGCCCAGG - Intronic
1181001599 22:19990311-19990333 CAGCTGGATGGGGTCTGTTCTGG - Intronic
1181187638 22:21118316-21118338 CAGCTCTCTTGTGGCTGCCCAGG + Intergenic
1181211560 22:21292177-21292199 CAGCTCTCTTGTGGCTGCCCAGG - Intergenic
1181397947 22:22634709-22634731 CAGCTCTCTTGTGGCTGCCCAGG + Intergenic
1181536485 22:23548946-23548968 CCGCTGGCTGGTGGTTCTCCAGG + Intergenic
1181580317 22:23824567-23824589 CAGCTGGGTGCTGGCTTCCCAGG + Intronic
1181651459 22:24261349-24261371 CAGCTCTCTTGTGGCTGCCCAGG - Intergenic
1181705917 22:24649390-24649412 CAGCTCTCTTGTGGCTGCCCAGG + Intergenic
1181838337 22:25629593-25629615 CACCTGGCTGGTGGGTGGGCAGG + Intronic
1182549499 22:31093292-31093314 CAGCTGGCTGGTGGCGGGCTGGG + Intronic
1183441482 22:37825390-37825412 CTGCTGGCTGGTGGCGGCCAGGG + Exonic
1184289197 22:43489299-43489321 CAGGAGGCCGGGGGCTGTCCAGG + Intronic
1184337278 22:43861472-43861494 CAGCTGGTGAGTGGCTGACCTGG - Intronic
1184388413 22:44189153-44189175 CTTCTGGCTTGTGGCTGTCAGGG - Exonic
1185234721 22:49705211-49705233 CACCTGGCTGGTGCCTGAGCTGG - Intergenic
1185375077 22:50478914-50478936 GAGCTGCCTGGGGGTTGTCCAGG - Intergenic
1203215390 22_KI270731v1_random:3255-3277 CAGCTCTCTTGTGGCTGCCCAGG + Intergenic
1203275237 22_KI270734v1_random:82137-82159 CAGCTCTCTTGTGGCTGCCCAGG - Intergenic
950093100 3:10311269-10311291 CAGGTGGTTGGAGCCTGTCCTGG - Intronic
950160124 3:10754170-10754192 CAGCTGGCTCGGAGCTCTCCAGG - Intergenic
950263778 3:11560389-11560411 CAGCTCCTTGCTGGCTGTCCTGG - Intronic
950439948 3:13004708-13004730 AGGGTGGCTGGGGGCTGTCCAGG + Intronic
950577067 3:13838322-13838344 CTGCTGGCTGGTGCATGTGCAGG + Intronic
950615006 3:14151136-14151158 CACGTGACTGGTGGCTGTCATGG - Intronic
950775439 3:15345992-15346014 CTGCTGGCTGGGGGCTCACCTGG + Intergenic
951205545 3:19922574-19922596 CTCCTGGCTGCTGGCTTTCCAGG - Intronic
954201409 3:49025533-49025555 CAGCTGGACGGGGGCTTTCCCGG - Intronic
954415880 3:50393085-50393107 CAGCTGGCTGTCGGGTGTCAGGG - Intronic
955069535 3:55560592-55560614 TACTTAGCTGGTGGCTGTCCTGG - Intronic
955080940 3:55657250-55657272 TGGCTGGCTGGAAGCTGTCCTGG + Intronic
955503355 3:59606780-59606802 CAGCTGGTTGGTGCCTGTTTGGG + Intergenic
956808088 3:72836954-72836976 CATCTGGCTAGTGGGTATCCCGG + Intronic
960702473 3:120451295-120451317 CTGCTGGCTGGCGGCGGCCCGGG + Intergenic
961361600 3:126371418-126371440 CAGCACGCTGGTGGCTCTGCAGG + Intergenic
963139255 3:141934058-141934080 CAGCTGGCTGGTGCCTGCCCGGG + Intergenic
963602812 3:147392281-147392303 CAGCCGCCTGGTGGCCCTCCGGG - Intronic
965771155 3:172182291-172182313 AGTCAGGCTGGTGGCTGTCCGGG + Intronic
968642060 4:1719929-1719951 CAGATGGCCAGTGGCTGGCCAGG - Intronic
968789156 4:2647550-2647572 CAGGTGGCAGGTGGCTCACCAGG + Intronic
969397238 4:6930170-6930192 TAGCTGGGTGGCGTCTGTCCGGG + Intronic
969463975 4:7343912-7343934 CAGCTGGGAGGTGGCAGTGCCGG + Intronic
969589245 4:8112250-8112272 TGGCTGGCTGGTGGCAGACCAGG - Intronic
970077388 4:12239354-12239376 CACATGGCTGGTGCCTGGCCTGG + Intergenic
970209666 4:13696290-13696312 CAGCTGGGTGGGGGGTGTCCAGG + Intergenic
973588256 4:52413749-52413771 CAGCTAGCAAGTGGCTGCCCAGG + Intergenic
974433158 4:61824573-61824595 CAGCTGGCTGGTAGTTGTGTTGG + Intronic
978817823 4:112929579-112929601 CAGCTGGCTAGTGCCTATGCTGG - Intronic
982271966 4:153599731-153599753 CATGTGGCTAGTGGCTGTCTTGG - Intronic
982750716 4:159157949-159157971 CACCTGGCTGCTGCCTGTCTCGG - Intronic
984323526 4:178224138-178224160 CAGCTGGGAGGTGGCTAGCCTGG + Intergenic
985281461 4:188290577-188290599 CTGCTGGTTCATGGCTGTCCTGG + Intergenic
1202766742 4_GL000008v2_random:154509-154531 CAGCTGGCTGCATGCTGCCCTGG + Intergenic
985579580 5:689761-689783 CATCTGGGTGGGGGCTGCCCCGG + Intronic
985579640 5:689921-689943 CAACTGGGTGGGGGCTGCCCTGG + Intronic
985594426 5:781820-781842 CATCTGGGTGGGGGCTGCCCCGG + Intergenic
985594486 5:781980-782002 CAACTGGGTGGGGGCTGCCCTGG + Intergenic
985650654 5:1105780-1105802 CAGCTGGCTGGGGGCCCTCCTGG - Intronic
985888257 5:2696745-2696767 CAGCTGTCTCCTGGGTGTCCAGG + Intergenic
986608297 5:9544996-9545018 CACCTGGCTGGTGGTTCCCCAGG + Intronic
986955388 5:13143891-13143913 GAGATGGCTGGTGACTGCCCAGG - Intergenic
989963415 5:50441374-50441396 CAGCCGGCTGCTGGCGTTCCCGG + Intronic
991547577 5:67800458-67800480 CATCTGGGTGGTGTCTGTTCTGG - Intergenic
992886281 5:81163170-81163192 CAGCTGGCAGGTGGTTGTAGAGG - Intronic
995975797 5:118033875-118033897 CAGCTGGCTGGCCGCTGGCCAGG + Intergenic
997285370 5:132674282-132674304 CTGGTGGTTGGTGGCAGTCCAGG + Intronic
998969299 5:147574207-147574229 GAGCTGGCTTGTGTCAGTCCTGG + Intergenic
999056964 5:148588120-148588142 CAGCTGGTTGGTGGCAGAGCAGG - Intronic
999327083 5:150650159-150650181 CAGTGGGCTGCAGGCTGTCCTGG - Exonic
1002849602 6:982110-982132 CATCTGGAAGGTGGCTGACCAGG + Intergenic
1003941009 6:11026556-11026578 CAGTTTCTTGGTGGCTGTCCTGG - Intronic
1005421553 6:25656402-25656424 AAGCAGGCTGGTTGCTCTCCTGG - Intronic
1006094097 6:31645010-31645032 CGGGTGGCTGGTGGCTGGCGGGG + Exonic
1007720013 6:43879256-43879278 CAGCCGGCTGCTGCCTGGCCTGG + Intergenic
1008056131 6:46947836-46947858 CTGCTGGCAGGTGGATGTCCAGG - Intronic
1010750866 6:79614839-79614861 TACCTGGCTGCTGTCTGTCCTGG - Intergenic
1011858057 6:91719786-91719808 CAGCTGGCTCATGGCAGACCTGG + Intergenic
1015601640 6:134916348-134916370 CTGGTGGAAGGTGGCTGTCCAGG + Intergenic
1016458521 6:144257680-144257702 CCTCTGGCTTGAGGCTGTCCAGG - Intergenic
1017144319 6:151220236-151220258 CAGAAGGCTGCTGTCTGTCCCGG - Intergenic
1017874851 6:158516043-158516065 CAGCTGGCTTTTCGCTGTCAAGG + Intergenic
1018053970 6:160035859-160035881 CAGCTGGCTGGGGTCTGGGCTGG + Intronic
1018857683 6:167687127-167687149 CTGCTGCCTGCTGGCTGCCCTGG + Intergenic
1019479429 7:1259804-1259826 CTTCTGGCTCGTGGCTGTCCCGG + Intergenic
1019515727 7:1439061-1439083 CAGCGAGCTGTTGGCTGTGCTGG - Intronic
1019625617 7:2014367-2014389 CGGCTGGCAGGTGTCTGTCAGGG - Intronic
1019631294 7:2051228-2051250 CAGCTGGATGATGCCTGGCCTGG + Intronic
1020006932 7:4788208-4788230 CAGCTGCCTGGAGGCCTTCCGGG + Exonic
1022941733 7:35248699-35248721 CTCCTGGCTGGTGGCTGGCAAGG - Exonic
1023109680 7:36796617-36796639 CAGGTGGCTGGAGCCTCTCCTGG - Intergenic
1023257060 7:38322722-38322744 CAGCTGGCTGGTGGCTCATCAGG - Intergenic
1023888970 7:44379465-44379487 CAGGAGGCTGCTGACTGTCCAGG + Exonic
1025787914 7:64660293-64660315 CAACTGGCTGTTGGCTGTCTAGG + Intergenic
1026233019 7:68501773-68501795 CAACTGGATGGTATCTGTCCAGG + Intergenic
1030246997 7:107393567-107393589 CAGCTGCTTGGTGGCAGGCCAGG + Intronic
1031603431 7:123741156-123741178 CAGGTGGCTGGAGCCTATCCTGG - Intronic
1033342363 7:140502088-140502110 CAGCTGGCTGCAAGCTGCCCTGG - Intergenic
1034854112 7:154524513-154524535 CAGCTGGATGTTGGCTGATCTGG + Intronic
1034870541 7:154679462-154679484 CAGCTCCCTGGTGGTTGCCCAGG - Intronic
1034886147 7:154800550-154800572 CCGCTGGCTGTTCACTGTCCGGG + Intronic
1035076500 7:156181044-156181066 CTGCGGGCTGGAGGGTGTCCTGG - Intergenic
1035793263 8:2327200-2327222 TAGCTTGCTGGTGGCAGACCAGG + Intergenic
1035799541 8:2394505-2394527 TAGCTTGCTGGTGGCAGACCAGG - Intergenic
1036656950 8:10683008-10683030 CAGCTGGGTGGATGCTGACCTGG - Intronic
1037352678 8:17978360-17978382 CAGCTGGCTGTTGTCTAGCCAGG + Intronic
1037484106 8:19331328-19331350 CACCTGGCTGGTGTGTGTGCTGG - Intronic
1037588447 8:20294358-20294380 CAGCCGGCTGGTGGCTGGTGGGG - Intronic
1037777101 8:21842731-21842753 CTGATGGCTGCTGGCTCTCCTGG - Intergenic
1037880958 8:22573157-22573179 CAGCTGGCTGGCAGCTGTACTGG - Intronic
1038261897 8:26002975-26002997 GAGCTGTCTGGGAGCTGTCCAGG - Intronic
1039406424 8:37316706-37316728 CATCTGGCTGGTGGAGTTCCCGG - Intergenic
1039587249 8:38717676-38717698 CAGCTGGCTGGTGACAGACGTGG + Intergenic
1039797038 8:40924533-40924555 CAGGTGGCTGGTGGGTCTCTGGG + Intergenic
1040101830 8:43512780-43512802 CAGCTGGCTGCAAGCTGCCCTGG - Intergenic
1041872664 8:62652641-62652663 CAGCTTGCTGGTTGCTGGTCTGG + Intronic
1042675531 8:71317563-71317585 TAGCTGTATGGTGCCTGTCCAGG + Exonic
1043394322 8:79821986-79822008 CACCTGGCTGTTGGCAGTCAGGG - Intergenic
1046097073 8:109575061-109575083 CAGCTTCCTGGTGGATCTCCTGG - Exonic
1047583125 8:126238578-126238600 CAGCATGCTTGGGGCTGTCCTGG + Intergenic
1048364839 8:133729737-133729759 CAGTTGACTGGTGAGTGTCCAGG - Intergenic
1048834977 8:138510356-138510378 CAGGTGGGAGGTGGCTGTGCAGG - Intergenic
1049055621 8:140234366-140234388 CATGTGGCTGGTGGCTGCCATGG + Intronic
1049081779 8:140448862-140448884 CTGCTGCTTGGTGGCTGCCCGGG + Intronic
1049165412 8:141122463-141122485 CAGTGGGCTGGCGTCTGTCCTGG - Intronic
1049601115 8:143508130-143508152 CAGATGGCTGGAGGGTGTGCGGG - Intronic
1052877076 9:33575352-33575374 CAGCTGGCTGCATGCTGCCCTGG - Intergenic
1053312164 9:37026919-37026941 CCGGGGGCTGCTGGCTGTCCCGG - Intronic
1053498929 9:38569042-38569064 CAGCTGGCTGCATGCTGCCCTGG + Intronic
1053662268 9:40292257-40292279 CAGCTGGCTGCATGCTGCCCTGG - Intronic
1054522342 9:66084027-66084049 CAGCTGGCTGCATGCTGCCCTGG + Intergenic
1055741996 9:79399786-79399808 CAGATTGATGGTGGCTCTCCAGG + Intergenic
1057441020 9:95083222-95083244 CGGCTGGCAGGAGGCTCTCCAGG + Intronic
1057678376 9:97153534-97153556 CAGCTGGCTGCCTGCTGCCCTGG + Intergenic
1057830628 9:98403464-98403486 CAGCTGGCTAGTGGCAGAGCAGG - Intronic
1057877029 9:98765522-98765544 CACCTGGCTGGTGGCTGAGGTGG - Intronic
1059518160 9:114914811-114914833 CAGTTGGCTGGGGGCTATCCTGG + Intronic
1060493366 9:124100811-124100833 CAGCTGGGAGCTGGCTGGCCTGG - Intergenic
1061294155 9:129667821-129667843 CAGCTGCCTGGAGGCTGCCAAGG - Intronic
1061324111 9:129852422-129852444 CAGCTGGTTTGTGGCAGACCAGG + Intronic
1061388391 9:130303681-130303703 CAGCTGGCTGGAGACTCGCCTGG - Intronic
1061729248 9:132600745-132600767 CAGATGGCAGGTGGCAGTGCTGG + Intronic
1061803516 9:133125994-133126016 GAGATGGCTGGGGGCAGTCCAGG + Intronic
1061805987 9:133138040-133138062 CAGCAGGCTGGTGGCGGCACCGG - Intronic
1062101017 9:134728609-134728631 CAGCAGGCTGGTCGCTCTGCGGG + Intronic
1062374454 9:136255672-136255694 CACCTGGCTGGAGGCTGCCCAGG - Intergenic
1203707899 Un_KI270742v1:69182-69204 CAGCTGGCTGCATGCTGCCCTGG - Intergenic
1203547495 Un_KI270743v1:139388-139410 CAGCTGGCTGCATGCTGCCCTGG + Intergenic
1185762091 X:2696349-2696371 CTGCAGGCTGCAGGCTGTCCAGG + Intronic
1185875130 X:3695897-3695919 CAGCGGGGTGGTGGCACTCCAGG - Intronic
1188108498 X:26169898-26169920 CAGCTGCCTGGTGTCTCTCAGGG - Intergenic
1188480317 X:30630534-30630556 CAGCTGGCTTCTTGATGTCCTGG - Intergenic
1189781311 X:44516907-44516929 GAGCTGGCTAGTGGGTGTACTGG - Intergenic
1190708499 X:53049200-53049222 TAGCTGGCAGGTGGGGGTCCCGG - Exonic
1191080598 X:56505847-56505869 CAGCTGGGTGGTGGGTAGCCTGG + Intergenic
1192102115 X:68275994-68276016 TTGCTGGGTGCTGGCTGTCCTGG - Intronic
1192201551 X:69069469-69069491 CTGCTGGCTGGTGGCTGAGCTGG - Intergenic
1195583133 X:106531646-106531668 CATCTGGCTGTTGGCTGACCTGG + Intergenic
1198706543 X:139454998-139455020 CTGCTGGATGGTAACTGTCCTGG + Intergenic
1199977156 X:152900827-152900849 CAACTGGATGGTGGCTGAGCTGG - Intergenic