ID: 1161055666

View in Genome Browser
Species Human (GRCh38)
Location 19:2189610-2189632
Sequence TGGCTGGTGGCTGTCCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 351}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161055655_1161055666 27 Left 1161055655 19:2189560-2189582 CCTGCATCAGGGCGGAAAGCGAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1161055666 19:2189610-2189632 TGGCTGGTGGCTGTCCAGGCAGG 0: 1
1: 0
2: 3
3: 33
4: 351
1161055660_1161055666 -3 Left 1161055660 19:2189590-2189612 CCAGAAGGGTCTTGGCCAGCTGG 0: 1
1: 0
2: 1
3: 19
4: 291
Right 1161055666 19:2189610-2189632 TGGCTGGTGGCTGTCCAGGCAGG 0: 1
1: 0
2: 3
3: 33
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161055666 Original CRISPR TGGCTGGTGGCTGTCCAGGC AGG Intronic
900341244 1:2190367-2190389 GGGATGGTGGCCGGCCAGGCAGG + Intronic
900390139 1:2430283-2430305 TGGGTGAGGTCTGTCCAGGCAGG - Intronic
901734552 1:11304220-11304242 TGGCTGGTGGCTGGGATGGCAGG + Intergenic
902809231 1:18878976-18878998 TGGCTGGTGGCTGCCGTGTCGGG - Intronic
904054781 1:27662878-27662900 TAGCTGGAGGCTGCCGAGGCAGG - Intergenic
904467380 1:30716385-30716407 TGTGTGGTGGGTGTCCAGCCGGG - Intronic
904617470 1:31757729-31757751 TGGCTGGTGGCTTCACAGGTGGG - Intronic
905178085 1:36150554-36150576 TGGCTCGTGTCTGGACAGGCTGG - Intronic
905765274 1:40595380-40595402 GGTCTGGTGGCGGCCCAGGCCGG - Intergenic
905795707 1:40815352-40815374 TGGAGGGTGTCTGTCAAGGCCGG + Intronic
905942194 1:41873108-41873130 TGGCAGGCGGCTTCCCAGGCAGG + Intronic
908004951 1:59718420-59718442 TGGTTGGTGGCTCTCCTGGAGGG - Intronic
909939396 1:81592858-81592880 TGGCTGTTGGCTGCCTGGGCGGG + Intronic
910121722 1:83797750-83797772 TTGCTGGTGTCTGTCCATGTTGG - Intergenic
914047132 1:144102337-144102359 TGGCTGGTGGCTGGCTTGACTGG + Intergenic
915952848 1:160201311-160201333 TGGCTGGAGGATGTCCTGGAGGG + Exonic
917491251 1:175500493-175500515 TGGCAGGAGGCTGTGCGGGCAGG + Intronic
919054879 1:192557936-192557958 TGGCTGCTGGCTGACCAGGGTGG + Intergenic
919797853 1:201332119-201332141 CGGCTGGGGGCTGTGCAGTCCGG + Exonic
921839255 1:219810968-219810990 TGCCCTGTGGCTTTCCAGGCAGG - Intronic
921968491 1:221118935-221118957 TGGGAAGTGGCTGTCCATGCAGG + Intergenic
922170834 1:223153136-223153158 TGGCTGGTGCCTGGCCACACTGG + Intergenic
922875488 1:228936934-228936956 TGGCTGGTAGATGGCCAGCCCGG + Intergenic
923286448 1:232500942-232500964 TGGCTGTTGGCTGATCAGGATGG - Intronic
923620575 1:235575929-235575951 TGCATTGTGGCTGTGCAGGCTGG + Intronic
1062834081 10:624602-624624 TGGCTGGAGTCTCTCCAGGGCGG + Intronic
1062860541 10:806194-806216 GGGCTGGAGGCTGAGCAGGCTGG + Intergenic
1065358293 10:24864473-24864495 TGGCTGCTGACTGATCAGGCTGG - Intronic
1067169799 10:43897361-43897383 TGGCTGGTGCCTGACCACGCTGG + Intergenic
1067735804 10:48849347-48849369 TGCCTGGTGGATGTGCAGGATGG - Intronic
1069334779 10:67335299-67335321 TGGCTGGTGCCTATCCTGGCAGG - Intronic
1069590651 10:69639753-69639775 TTGCTGGAGGCTGGCGAGGCAGG - Intergenic
1069638591 10:69940754-69940776 TGGCTGGCTGCTGAGCAGGCTGG - Intronic
1069789079 10:71007852-71007874 CGGTTGGTGGCTGGCCTGGCGGG - Intergenic
1069813438 10:71178998-71179020 AGGCTGGTGGCTGTCTAGGGAGG - Intergenic
1070726212 10:78792948-78792970 TGGCTGGGGGCAGACCATGCAGG + Intergenic
1071333629 10:84584775-84584797 CTGCTGGTGGCTGCCCAGGAAGG + Intergenic
1073810489 10:107147361-107147383 GGGCTGATGGCTGTCTAGTCAGG - Intronic
1074688277 10:115979776-115979798 AGGCTGGGGGCTGGTCAGGCAGG + Intergenic
1076251338 10:128986168-128986190 TGGCTGATGGCTGGCAGGGCAGG - Intergenic
1076707446 10:132309334-132309356 AGGCGGGTGCATGTCCAGGCGGG - Intronic
1076707450 10:132309350-132309372 AGGCGGGTGCATGTCCAGGCGGG - Intronic
1076840587 10:133043398-133043420 AGGCAGGAGGGTGTCCAGGCAGG - Intergenic
1077150584 11:1071316-1071338 TGGCTGGGGGCTGGGCAGCCTGG + Intergenic
1077315289 11:1916951-1916973 TGTCTGGTGGCTGCTCTGGCAGG - Intergenic
1077347159 11:2067104-2067126 TGGCTGCTGGCTGATCAGGGTGG + Intergenic
1077471278 11:2761817-2761839 TGGCTGCTTGCAGTCCCGGCCGG + Intronic
1078951135 11:16135948-16135970 TGGCTGCTGGCTGGTCAGGGTGG - Intronic
1081256774 11:40906059-40906081 TGGCTGCTGACTGACCAGGGTGG - Intronic
1081410715 11:42754961-42754983 TGGCTGCTGCCTGACCAGGGTGG - Intergenic
1081731852 11:45377273-45377295 GGGCTGCTGGCTGTCCAGTCTGG + Intergenic
1084314594 11:68337776-68337798 TGGCTGTTGGTGGACCAGGCAGG - Intronic
1084369492 11:68730763-68730785 TGGCTGTTGTCGGCCCAGGCTGG - Intronic
1084505007 11:69560240-69560262 TGGCTGCTGGCTGATCAGGGTGG + Intergenic
1084704974 11:70810846-70810868 TGGCTGCTGCCGGTCCAGCCTGG - Intronic
1084745255 11:71166025-71166047 TTGTTGGTGTCGGTCCAGGCTGG - Intronic
1087155730 11:94900752-94900774 TGGCTGGTGACTGATCAGGGTGG + Intergenic
1089114106 11:116080267-116080289 TGGCTGGAGGCTGGTCAGGGTGG - Intergenic
1089150174 11:116358185-116358207 GGGCGGGTGGCTCCCCAGGCAGG - Intergenic
1089775632 11:120833554-120833576 TACCTGGGGGCTGTTCAGGCAGG - Intronic
1090601825 11:128380089-128380111 TGGGTTGATGCTGTCCAGGCTGG + Intergenic
1091224778 11:133950791-133950813 TGGCTGGTGGCTGGGGAAGCGGG + Intronic
1091899597 12:4134314-4134336 GGGCTGGTGGCTGACCAGCTGGG - Intergenic
1093211936 12:16318167-16318189 TCTTTGGTGGCTGTCCAGGGTGG + Intergenic
1094409065 12:30149991-30150013 TTGTTGGTCTCTGTCCAGGCAGG - Intergenic
1100384570 12:94093579-94093601 TGGCTGGGGGCTGTTCATGCAGG - Intergenic
1102099590 12:110268258-110268280 TGGCAGGTGCCTGTAGAGGCAGG - Intergenic
1102217187 12:111169859-111169881 TGGCTGGTGGCAGGCCAGGGTGG + Intronic
1102240347 12:111320965-111320987 TGGCTGTTTGCTGGCCAGGATGG - Intronic
1102386447 12:112514506-112514528 TGGCTGGGGGCTGAACAAGCAGG - Intergenic
1102535211 12:113576013-113576035 TGGATGGTGGATCTTCAGGCAGG + Intergenic
1103722911 12:122984118-122984140 TGGCTGGCGGCTGGGCAGGCAGG + Exonic
1104488268 12:129170905-129170927 TGGCTGCTGGCTGATCAGGCTGG + Intronic
1104719040 12:131034399-131034421 TGGCGAGTGGCTGGCGAGGCTGG - Intronic
1105512464 13:21061703-21061725 GGGCAGGTGGCGGTCGAGGCCGG - Intergenic
1105571880 13:21610814-21610836 GGGCTGGTGGCTGGCAGGGCTGG + Intergenic
1111281127 13:86026856-86026878 TGGCTGCTGACTGACCAGGGTGG - Intergenic
1111486575 13:88909361-88909383 TGGCAGGTGCTTGTCCAGACAGG + Intergenic
1111575678 13:90151413-90151435 TGGCTGCTGACTGACCAGGGTGG + Intergenic
1112665017 13:101559899-101559921 TGGCTAGTTAGTGTCCAGGCAGG + Intronic
1112890642 13:104226731-104226753 TTGATGTTGGATGTCCAGGCTGG + Intergenic
1113065832 13:106373739-106373761 TGCCTGGTGTCTGTTCATGCTGG - Intergenic
1113695181 13:112341015-112341037 TGGCTGCTGACTGACCAGGGTGG - Intergenic
1113752396 13:112785357-112785379 TGGCTGGTGGCTGTGACAGCAGG - Intronic
1113759825 13:112839549-112839571 TGGTTGGTGGCTGTCCCCTCTGG - Intronic
1113932834 13:113977213-113977235 TGGCTGCTGTCCCTCCAGGCAGG - Intergenic
1119178244 14:72585605-72585627 TGGATGTGGGCTGTCCAGGAAGG + Intergenic
1119180426 14:72601239-72601261 TGGTGGGAGGCTGGCCAGGCTGG - Intergenic
1119268055 14:73276851-73276873 TGTCTGCTGCCTGACCAGGCTGG + Exonic
1120544252 14:85791238-85791260 TGGCTGCTGGCTGATCAGGATGG - Intergenic
1121309592 14:92928447-92928469 TGGGTGCTTGCTGCCCAGGCTGG - Intronic
1121406688 14:93723257-93723279 TTGCTGGTAGCTGTCCAGGCTGG + Intronic
1122290970 14:100680359-100680381 AGGCTGGTGGCAGTGCAGGAAGG - Intergenic
1122500025 14:102191284-102191306 TGGCAGATGGCTTCCCAGGCAGG - Intronic
1122647664 14:103206089-103206111 TTGCTGGGGCCTCTCCAGGCAGG - Intergenic
1122885115 14:104707409-104707431 TGGCTGCTGGCCCTCCACGCTGG - Exonic
1122964434 14:105115400-105115422 TGGCAGGTGGCTTGCCAGGGTGG - Intergenic
1122976446 14:105172792-105172814 TAGCTGGTGGCAGGCCATGCAGG - Intergenic
1123034789 14:105467482-105467504 AGGCTGCTGGGTGTCCTGGCAGG + Intronic
1123038579 14:105481292-105481314 GGGCTGGAGGGTGGCCAGGCAGG - Intergenic
1202849523 14_GL000225v1_random:8257-8279 TCGCTGGTGGATATCCAGGCAGG + Intergenic
1123934177 15:25186188-25186210 GGGGTGGTGGTGGTCCAGGCAGG + Intergenic
1123938799 15:25206815-25206837 GGGGTGGTGGTGGTCCAGGCAGG + Intergenic
1124093482 15:26627989-26628011 TGGCTGCTGGCTGATCAGGGTGG - Intronic
1124461167 15:29893562-29893584 TGGCTGCTGGCTGATCAGGGTGG - Intronic
1125715018 15:41814758-41814780 TGGCTGGAGACTGGCCAGGTTGG + Intronic
1126850683 15:52795161-52795183 CGGAGGGTGGCTGTCCAGCCGGG + Intergenic
1128948329 15:71847649-71847671 TTAGTGGTGGCTATCCAGGCAGG - Intronic
1129049371 15:72766428-72766450 TGGCTGCTGGCTGATCAGGGTGG - Intronic
1129210680 15:74066144-74066166 AGGCTGTTGGCTGTCAGGGCGGG + Intergenic
1129403331 15:75299185-75299207 AGGCTGTTGGCTGTCAGGGCGGG - Intergenic
1129718351 15:77864692-77864714 TGGCCTGTGGCTGTCCATCCAGG + Intergenic
1129847849 15:78776262-78776284 TGGATGGTGGCTGGTCTGGCTGG - Exonic
1130086365 15:80780778-80780800 TGGCTGGGAGCTGTCCATGGTGG - Intronic
1130254058 15:82317654-82317676 TGGATGGTGGCTGGTCTGGCTGG + Intergenic
1130460571 15:84156173-84156195 TGGCCTGTGGCTGTCCATCCAGG - Intergenic
1131058268 15:89389402-89389424 ATGCTGGTGGCTGTGCAGGGTGG - Intergenic
1131302253 15:91210044-91210066 GGGCTTGTGAGTGTCCAGGCAGG + Intronic
1131521125 15:93116506-93116528 TGGATGGTAGCTTTCCAGGAGGG + Intergenic
1131833221 15:96367321-96367343 TGGCGGCTGGCTTTCCAGGGTGG - Intergenic
1131863488 15:96680019-96680041 TGACTGGTGGCTGTTTAGGAGGG - Intergenic
1132177169 15:99725027-99725049 TGGCTGGTCTCAGGCCAGGCGGG - Intronic
1132716078 16:1290415-1290437 AGGCTGCTGGCTGTGCGGGCAGG - Intergenic
1132819275 16:1854936-1854958 TGGCCAGTGACTGTCCATGCTGG - Intronic
1132950305 16:2558052-2558074 AGGCTGGTGTCCTTCCAGGCAGG + Intronic
1132964043 16:2642118-2642140 AGGCTGGTGTCCTTCCAGGCAGG - Intergenic
1133290469 16:4717351-4717373 AGGCTGGTTGTTGGCCAGGCTGG - Intronic
1133323764 16:4931029-4931051 GGGCTGCTGGCTCTGCAGGCAGG + Intronic
1134148713 16:11788538-11788560 TGGTTGGTGGCCCTCCAGGAGGG - Intronic
1134551553 16:15141152-15141174 TGGCTGGAGGCTGGCAGGGCTGG - Intergenic
1136016412 16:27403798-27403820 AGCCAGGTGGCTGGCCAGGCAGG - Intronic
1136487585 16:30583202-30583224 CCGCTGGTGGCTGGCCAGGAGGG + Exonic
1136591925 16:31222862-31222884 TGGCAGCTGGATGTCCAGACGGG - Exonic
1136996682 16:35195561-35195583 GGGCTGGTTGCTGCCCTGGCGGG - Intergenic
1137009458 16:35308843-35308865 GGGCTGGTTGCTGCCCAGGCAGG - Intergenic
1137428592 16:48400225-48400247 TGCCTGCTGGCTGTCCATGGAGG + Intronic
1137582166 16:49640117-49640139 TGGCTGGCGGCTGGAGAGGCGGG - Intronic
1138271035 16:55695994-55696016 TAGCCTGTAGCTGTCCAGGCAGG + Intronic
1139599145 16:67976228-67976250 TGGCTGGTGGGTGGCCACACAGG - Exonic
1139673977 16:68510291-68510313 TGGCCCGTGGGTGTCCGGGCCGG - Intergenic
1141745204 16:85920896-85920918 TGGGTGCTGGCTGTCCCAGCTGG + Intronic
1141807506 16:86351701-86351723 TGGCTGGGAGCTGGACAGGCCGG + Intergenic
1141948357 16:87325110-87325132 GGGCTGGTGGCTGCCCAGGCTGG - Intronic
1143241157 17:5444382-5444404 TGGCTGGTGGGTGTCCGTGGTGG + Exonic
1143537524 17:7550034-7550056 TGGCTGGTGGCTCTCCTGACAGG + Intronic
1143642022 17:8204574-8204596 TGGCTGGGAGCTGACCAGGTGGG + Intergenic
1144067638 17:11639009-11639031 TGGCTGGTGGCAGGACAGGAAGG - Intronic
1144788463 17:17844638-17844660 TGCCTGGAGACTGCCCAGGCAGG + Intronic
1144892267 17:18500889-18500911 TGGCTGGAGGCTTCCCAGGTGGG - Intergenic
1145099653 17:20064029-20064051 TGGCTGGTGGCTGAGTAAGCAGG + Intronic
1145139949 17:20443399-20443421 TGGCTGGAGGCTTCCCAGGTGGG + Intergenic
1145933528 17:28702099-28702121 AGCCGGGTGGCTGTCCAAGCAGG + Exonic
1146270445 17:31481889-31481911 TGGCTGGATGCTGTGCAGACGGG - Intronic
1146599769 17:34204541-34204563 GAGCTGGTGGCTGGCCAGGTTGG - Intergenic
1148091089 17:45022872-45022894 TGCCAGGTGGGTGGCCAGGCAGG - Intergenic
1148129649 17:45255146-45255168 TGGCTGGTGGCTGGAGAAGCTGG + Exonic
1148677326 17:49452853-49452875 TGACTGGGGGCTGGCCAGGGAGG - Intronic
1148783913 17:50135940-50135962 TGGCTGGGGGCTGGGCGGGCTGG - Intronic
1148887013 17:50781238-50781260 TGGCTTCTGGGTGTCCAGGGTGG + Intergenic
1149512521 17:57255894-57255916 TGGCTGGTGTTTGTGCAGGAGGG + Intronic
1150454785 17:65298499-65298521 AGGCTGGAGGATGTCCAGGCAGG + Intergenic
1150512898 17:65775207-65775229 GGGCTGGAGTCTTTCCAGGCAGG - Intronic
1150568282 17:66362418-66362440 TGCCTCTTGGCTCTCCAGGCTGG + Intronic
1151163602 17:72185899-72185921 CGACTGGTGGCTGAGCAGGCAGG + Intergenic
1151284643 17:73101246-73101268 TGGCTGTTGGCTGCCCTGGATGG - Intergenic
1151329625 17:73399163-73399185 TGGCTGGTGGAAGCCCAGGTAGG - Exonic
1151858559 17:76740531-76740553 TGGCTGGTGAATGTCGAGCCAGG - Intronic
1151891698 17:76954772-76954794 TGGGAGGTGGCCGTCCAGGGAGG - Intergenic
1151955499 17:77378199-77378221 TGGGCTGTGGCTGTCCAGGAAGG + Intronic
1152220448 17:79061739-79061761 TGACTGCTGACTGTCCAGGGTGG - Intergenic
1153133004 18:1879152-1879174 TGGCTGGTGACTGATCAGGATGG + Intergenic
1154217987 18:12429532-12429554 CTGCTGGTGGCTCTCCAGCCCGG + Intronic
1156263506 18:35466482-35466504 TGGGTGGGGGGTGTCCAGGAGGG - Intronic
1156623254 18:38878187-38878209 TGGCTGGTGGCTGAGCATGATGG - Intergenic
1160702973 19:517438-517460 TGGGTGGGGGCTGGCCAGGCTGG + Intronic
1161055666 19:2189610-2189632 TGGCTGGTGGCTGTCCAGGCAGG + Intronic
1162070061 19:8147954-8147976 AGGCTGGGGGCTGTCCAGATGGG + Intronic
1162744281 19:12790154-12790176 TGGCTGGAGGCTGCCGCGGCTGG + Intronic
1162936839 19:13985757-13985779 TGGGTCTCGGCTGTCCAGGCAGG + Intronic
1163695355 19:18760932-18760954 TGGCTGGTGGCTGTTCTAGGTGG - Intronic
1165074471 19:33273285-33273307 TGGCAGGTGGGTGGCCAGGAGGG + Intergenic
1166216904 19:41341845-41341867 TGGATGGAGGCCTTCCAGGCTGG - Intronic
1168080077 19:54003650-54003672 TTGCTGGTGGATGGCTAGGCAGG - Intronic
1202687171 1_KI270712v1_random:57901-57923 TGGCTGGTGGCTGCCTTGGCTGG + Intergenic
925556888 2:5141194-5141216 TGGCTGCTGACTGGCCAGGGTGG - Intergenic
927967892 2:27283009-27283031 TGGGTGGTGGCTGTTGTGGCTGG + Intronic
931007931 2:57873695-57873717 TGGTTAGTGGCTTTCCATGCTGG - Intergenic
931208027 2:60166403-60166425 AGGCTTGTGGCTTTTCAGGCAGG + Intergenic
932707694 2:74039344-74039366 GGGCAGGTGGGTGTCCAGGAAGG - Intronic
933960770 2:87406857-87406879 TGGCTGGTGGCTTGCTTGGCTGG - Intergenic
933963523 2:87419232-87419254 TGGCTGGTGGCTTGCTTGGCTGG - Intergenic
933964763 2:87424978-87425000 TGGCTGGTGGCTTGCTTGGCTGG - Intergenic
933964876 2:87425487-87425509 TGGCTGGTGGCTTGCTTGGCTGG - Intergenic
934614222 2:95761354-95761376 TGGGTGGTGGGTGGTCAGGCGGG + Intergenic
934709000 2:96503170-96503192 TGGCTGGAGGCAGTCCAGGGAGG + Intronic
935146283 2:100397775-100397797 GGACTGGTGGCCGTCCAGACAGG - Intronic
935348031 2:102126879-102126901 GGGCCAGTGGCTGTCCAGCCTGG + Intronic
935793433 2:106615366-106615388 GGTCTGTTAGCTGTCCAGGCAGG - Intergenic
936920372 2:117682735-117682757 TGGCTGCTGACTGTTCATGCTGG - Intergenic
937408951 2:121656019-121656041 AGGCTGGTGTGTGTGCAGGCTGG + Intergenic
937417273 2:121725709-121725731 TGGCAGGTGGCTGTTCAGGAAGG + Intergenic
938424135 2:131170442-131170464 TGGCTGCTGGCTGATCAGGGTGG - Intronic
944271180 2:197786218-197786240 TGGCAGGTGGCGGTGCGGGCGGG + Exonic
944813567 2:203352157-203352179 TAGCAGCTGGTTGTCCAGGCTGG + Intronic
946439442 2:219682537-219682559 TGTCAGGGGGCTGTCCAGGTGGG + Intergenic
947500028 2:230664960-230664982 AGGGTGGTGGCTGTGGAGGCGGG - Intergenic
947533719 2:230928133-230928155 AGGCTGGAAGCTGGCCAGGCAGG + Intronic
947707887 2:232291513-232291535 AGGCTGGAGGCTTCCCAGGCCGG + Intronic
947798997 2:232915512-232915534 TGGCTGGTGGCTGTCAGAGCGGG + Intronic
948566387 2:238889951-238889973 TGGGTGGAGGCTGCCCAGCCTGG + Intronic
948583754 2:239005460-239005482 CTGCTGGTAGCTGTGCAGGCAGG + Intergenic
948877331 2:240836699-240836721 TGGCTGGGGGCTGCCCAGCCTGG - Intergenic
1168757556 20:327104-327126 CTGCTGGTGGCTGTGCAGGAGGG - Exonic
1168837917 20:890161-890183 GGGCCTGTGGCTGGCCAGGCTGG - Intronic
1170933020 20:20785841-20785863 TGGCTGTTGGCTGATCAGGATGG - Intergenic
1171117692 20:22540327-22540349 GGGGTGGTGGGTGTGCAGGCAGG + Intergenic
1172006968 20:31824367-31824389 GGGGTGGTGGCTGCCCAGGATGG + Intronic
1173768418 20:45635476-45635498 TGGCTGCTGACTGACCAGGGTGG - Intergenic
1174239499 20:49121955-49121977 TGGCTGGTAGATGGCCAGGTTGG - Intronic
1174386362 20:50190518-50190540 GGGCTGGAGGCTGTCCTGGAAGG - Intergenic
1174500521 20:50980943-50980965 TGGGTGGAGGCAGCCCAGGCAGG + Intergenic
1175828512 20:61950039-61950061 GGGATGGAGGCTGTCCCGGCTGG - Intergenic
1175989185 20:62779046-62779068 TGGCCAGGGGCTGTCCTGGCTGG - Intergenic
1176305468 21:5120850-5120872 TGCCTGGTCACTGTCCAGGGAGG - Intronic
1177162393 21:17562243-17562265 TGACTGGTGGCTGATCAGGATGG + Intronic
1178070814 21:28964316-28964338 TGGCTGCTGACTGACCAGGGTGG - Intronic
1178449806 21:32687344-32687366 TGGCTGGTGTCTGTCTTGTCTGG - Intronic
1178479060 21:32963472-32963494 TGCCTGGTGCCTTCCCAGGCAGG - Intergenic
1178881843 21:36456098-36456120 TGGATGGTGACAATCCAGGCAGG - Intergenic
1179609030 21:42537112-42537134 TGGGTGGTTGGTGCCCAGGCAGG + Intronic
1179769786 21:43606051-43606073 TGGTAGGTGGGTGTCCCGGCAGG - Intronic
1179769797 21:43606102-43606124 TGGTAGGTGGGTGTCCCGGCAGG - Intronic
1179851587 21:44141181-44141203 TGCCTGGTCACTGTCCAGGGAGG + Intronic
1180188799 21:46153121-46153143 GGACTGGGGGCTGCCCAGGCCGG - Intronic
1180553968 22:16561204-16561226 TGGCGGGTGGCTGGCTTGGCTGG - Intergenic
1180554868 22:16565467-16565489 TGGCTGGTGGCTGGCTTGGCTGG - Intergenic
1181132624 22:20742241-20742263 TGGCTGCTGGCTGGCAAGGATGG - Exonic
1181737552 22:24893555-24893577 GTGCAGGTGGCTGTCCAAGCTGG - Exonic
1181830763 22:25558595-25558617 TGTCTGGTGGCTGTCCATCTGGG + Intergenic
1182503315 22:30764309-30764331 TGGCTGGTGGCCCTAGAGGCTGG + Intronic
1183622369 22:38982044-38982066 TGCCTGGTGGTTGGGCAGGCTGG - Intronic
1183627532 22:39013943-39013965 TGCCTGGTGGTTGGGCAGGCTGG - Intergenic
1184091438 22:42295021-42295043 TGGCTGGTGGTGTTCCAGGTGGG - Intronic
1184101884 22:42345096-42345118 TGCCTGGGGACTGTCCAGGAGGG + Intergenic
1184160681 22:42695476-42695498 TGGCTGGTAACTGACCAGCCTGG + Intronic
1184602145 22:45549867-45549889 GGGTTGGTGGCTGTTCAGGGTGG - Intronic
1184783478 22:46660429-46660451 TGGCTGTGGTCTGTCCAGGGTGG + Intronic
1185159182 22:49212639-49212661 TGGAGGGTGTCTGTCCTGGCTGG - Intergenic
1185397840 22:50601525-50601547 AGGCTGCTGGCTCTCCAGGGAGG + Intronic
949346816 3:3084589-3084611 GGGCTGGGGGCTGTGCAAGCAGG - Intronic
950484595 3:13265559-13265581 TGGCAGTGGGCAGTCCAGGCTGG + Intergenic
950582486 3:13871653-13871675 TGGCTGGTGGATTTCAAAGCAGG + Intronic
950928016 3:16761998-16762020 TGGCTGCTGACTGGTCAGGCTGG + Intergenic
953883347 3:46702550-46702572 GGGATGGAGGCTGTGCAGGCAGG + Intronic
954457954 3:50610205-50610227 TGGTTGGTGGCTAGCCAGTCAGG + Intronic
954522615 3:51242831-51242853 TGGCTTGTGTCTGTACTGGCAGG - Intronic
960353478 3:116622153-116622175 TGGCTGGTGGCTGGTAATGCAGG - Intronic
960702475 3:120451299-120451321 TGGCTGGCGGCGGCCCGGGCGGG + Intergenic
961459168 3:127039360-127039382 GGGCTGATGGCTCTCCAGGAAGG - Intergenic
961649068 3:128408474-128408496 GGGCTGGGGGCTGTCCTGGGTGG - Exonic
962927905 3:140012040-140012062 TGGCTGGAGGCTGACAAGGCTGG + Intronic
962935456 3:140076528-140076550 TGGCTGATGGATGTCAATGCCGG + Intronic
962967590 3:140368753-140368775 AGGCTGGTGGACGTTCAGGCTGG + Intronic
963139257 3:141934062-141934084 TGGCTGGTGCCTGCCCGGGTGGG + Intergenic
963736241 3:149020453-149020475 TGGCTGGTGAGTGACAAGGCTGG - Intronic
963786174 3:149536594-149536616 CGCCTGGTGGCTGTCAAGCCTGG + Intronic
964138374 3:153370021-153370043 GGGCTGGTGGCAGTGCTGGCGGG + Intergenic
964511811 3:157460707-157460729 TGGCTGGGTGCTGGCAAGGCAGG + Intronic
965833609 3:172826733-172826755 TGGCTGCTGACTGATCAGGCTGG - Intergenic
967885779 3:194332512-194332534 TGGGTGGTGCCTGCCCTGGCTGG - Intergenic
967971755 3:195004591-195004613 TGGCTGGAGACTGTCCAGTCTGG + Intergenic
968683466 4:1938560-1938582 TGGCTTCTGGGTGCCCAGGCTGG + Intronic
968702274 4:2062726-2062748 AGGCTGGTGGCTGTGCAGAGGGG + Intronic
968764073 4:2459058-2459080 TGGCTGGTGGGTGGCAGGGCAGG - Intronic
968899090 4:3422457-3422479 TGCGTGGTGGCTGTCAAGGCGGG + Exonic
969156838 4:5218834-5218856 TGGCTTCTGGCTCTCCCGGCCGG + Intronic
970537958 4:17048966-17048988 TGGCTGCTGACTGTTCAGGGTGG + Intergenic
970578959 4:17456150-17456172 TGGCTGGTGACTGATCAGGGTGG - Intergenic
971729078 4:30353039-30353061 TGGCTCATGGCTGTGCATGCTGG - Intergenic
973557257 4:52096639-52096661 TAGCTGGTGGCTCTACATGCAGG - Exonic
973588257 4:52413753-52413775 TAGCAAGTGGCTGCCCAGGCAGG + Intergenic
978181150 4:105797596-105797618 TGGCTGCTGACTGACCAGGGTGG + Intronic
984397757 4:179222882-179222904 TGGCTGGTGGCTCTGGAGACTGG - Intergenic
984760122 4:183356554-183356576 TGGCTGCTGGACGCCCAGGCAGG - Intergenic
985102269 4:186470378-186470400 TGGGTGATGGCTGTGCAGGGTGG + Intronic
985223944 4:187738693-187738715 TGGGTGGTGCCAGACCAGGCAGG - Intergenic
985629833 5:1008687-1008709 TCGCTGGTGGGGCTCCAGGCTGG + Intergenic
985651144 5:1108306-1108328 TGGCTGCTGGGCATCCAGGCCGG - Intronic
986502732 5:8417359-8417381 TTGATGGTGTCTGTCCAGGCAGG - Intergenic
986597582 5:9439734-9439756 AGGCTGTGGGCTGTCCATGCTGG - Intronic
986606644 5:9529410-9529432 CAGCTGGTGGGTGTCCAGGCAGG - Intronic
986617374 5:9632369-9632391 TGGCTGCTGACTGATCAGGCTGG + Intronic
987124628 5:14800523-14800545 TGGCTGCTGGCTGATCAGGGTGG - Intronic
987336960 5:16905522-16905544 TGGCTGGTGGCTGTTCCTGCAGG - Intronic
987862765 5:23507556-23507578 TGGCTGGCAGCTGTACAGCCTGG + Intronic
989135589 5:38151343-38151365 TGGCTAATGGCTGTGCAGGGAGG - Intergenic
992888296 5:81180989-81181011 AGGCAGGTGGGTGTCCAGGAGGG - Intronic
993349489 5:86830735-86830757 TGGCTGTTGGCTTCTCAGGCTGG + Intergenic
994628743 5:102254592-102254614 TGGCTGCTGACTGACCAGGGTGG - Intronic
997306981 5:132844940-132844962 TCGCTCTTGGGTGTCCAGGCTGG - Intergenic
997374149 5:133384891-133384913 TGGCTTGTGGCTCCCCATGCTGG + Intronic
998213660 5:140220837-140220859 TGGCTGGCTGGAGTCCAGGCTGG + Intronic
998411124 5:141912323-141912345 TGGGATGTGGCTGTCCAGTCAGG - Intergenic
999327082 5:150650155-150650177 GGGCTGCAGGCTGTCCTGGCCGG - Exonic
1001328539 5:170746307-170746329 TGCCAGGTGGCTTTCCACGCTGG + Intergenic
1001350497 5:170958431-170958453 TGGTTGGTGGGTGTGCAAGCAGG + Intronic
1002212666 5:177608029-177608051 TGGCTGGTGGACGGGCAGGCAGG + Intronic
1002310132 5:178309216-178309238 TGTCTGGTGGCTCTCCTGGGTGG + Intronic
1002794718 6:463254-463276 TGGGTGGTGGTTGGCCAGGTGGG + Intergenic
1003351983 6:5326538-5326560 TGGCTGGTGCCAGTCAGGGCGGG - Intronic
1004178800 6:13363839-13363861 TGCCACGTGGCTCTCCAGGCAGG - Exonic
1007418220 6:41704487-41704509 TGGCTGGTGGTCACCCAGGCAGG - Intronic
1007470746 6:42088657-42088679 TGGCTGGTGGATGCCCTGGCAGG - Intergenic
1008593158 6:53013832-53013854 TGGCTGGTGGCTGGGCAGGTGGG + Exonic
1010435075 6:75820333-75820355 TGGATAGTGGCACTCCAGGCAGG - Intronic
1013636621 6:112034868-112034890 GGGCAGGTGGGTGTGCAGGCAGG + Intergenic
1014568449 6:122979417-122979439 TGGCTGGTCGCTATCCTGACCGG + Intergenic
1014688285 6:124530935-124530957 TGGATGATGGCTGTCCACGTTGG + Intronic
1015897957 6:138035125-138035147 TGCCAGGGGGCAGTCCAGGCAGG - Intergenic
1018255116 6:161910795-161910817 TGGCTGCTGTCTGATCAGGCAGG - Intronic
1018452237 6:163919776-163919798 TGGGTGGTGACTGTCAAGACAGG + Intergenic
1018706112 6:166464217-166464239 TGGCTGTTGTGTGTCCTGGCAGG - Intronic
1018720956 6:166572414-166572436 TGGCTGGTGGCCTCTCAGGCTGG + Intronic
1019495124 7:1334510-1334532 TGGCTGGTGGTTGCCAAGGGCGG - Intergenic
1019610090 7:1932129-1932151 CCGCTGGAGGCTGCCCAGGCTGG + Intronic
1020471295 7:8538230-8538252 TGGCTGGTGACTGGCAAAGCTGG + Intronic
1021815409 7:24442494-24442516 TGGCGGGGGGCTGCCCAGTCCGG - Intergenic
1022414275 7:30164755-30164777 GGGTTGGTGAATGTCCAGGCTGG + Intergenic
1022415397 7:30172725-30172747 TCCCTGGTGACTGTTCAGGCAGG + Intergenic
1023257059 7:38322718-38322740 TGGCTGGTGGCTCATCAGGCCGG - Intergenic
1025035669 7:55591319-55591341 GGGGTGGGGGCTGGCCAGGCAGG - Intergenic
1027504280 7:78996099-78996121 TGGTTGGTGGGTCTCCAGCCAGG - Intronic
1029203747 7:98856000-98856022 TGCAGGGTGGGTGTCCAGGCAGG - Exonic
1029561166 7:101303587-101303609 TTGGTGGTGGCTGACCAGGTTGG - Intergenic
1029596428 7:101539924-101539946 TGGCAGGTCGTTGTCCGGGCTGG - Exonic
1030587569 7:111439662-111439684 TGGCTGCTGACTGACCAGGGTGG + Intronic
1032089148 7:128902624-128902646 CTGCTGGGGGCTGTGCAGGCGGG - Intronic
1032844701 7:135742479-135742501 TGGAAGTTGGCTGCCCAGGCTGG + Intronic
1033119642 7:138656086-138656108 TGGCTGCTGGCTGATCAGGGTGG - Intronic
1035600778 8:895736-895758 AGGATGGTTGCTGTCCAGGTCGG + Intergenic
1035793129 8:2325956-2325978 ATGCTGGCGGCTGTCCATGCTGG + Intergenic
1035799675 8:2395749-2395771 ATGCTGGCGGCTGTCCATGCTGG - Intergenic
1036122769 8:6036263-6036285 CGGGTGGGGGCTGTGCAGGCTGG - Intergenic
1036555058 8:9852022-9852044 TGGCTGGGGGCTGTCTAGGAGGG + Intergenic
1036616573 8:10392404-10392426 TGGCTGGTCAGTGTCAAGGCTGG + Intronic
1036980274 8:13462431-13462453 TGGCTGGCGACAGCCCAGGCTGG + Intronic
1037847416 8:22295962-22295984 CGGCTGGTTGCTCTCCCGGCTGG + Intronic
1038614659 8:29081303-29081325 TGGCTGGTGGCTGCCATGTCAGG - Intronic
1041450621 8:58002852-58002874 TGGCTGGTGACTGATCAGGGTGG + Intronic
1041530373 8:58858810-58858832 TTGCTCTTGGCTGTCCATGCAGG + Intronic
1041709662 8:60882241-60882263 TGGCTGGTTGCTCTCCAGAAAGG + Intergenic
1041757982 8:61334743-61334765 TGGCTGGGATCTGTCCAGGTGGG + Intronic
1041764546 8:61404687-61404709 TGGCTGGTGGATTTGCAGGGAGG + Intronic
1042243252 8:66686030-66686052 TGGCCAGTGTCTGTCCAGCCTGG - Intronic
1043340496 8:79231740-79231762 AGGCATGTGGATGTCCAGGCAGG + Intergenic
1043698334 8:83251043-83251065 TTGCTGGTGACTGTGCATGCAGG + Intergenic
1044030753 8:87233577-87233599 TGGCTGCTGGCTATTCAGGCTGG + Intronic
1045399951 8:101804036-101804058 TGGCTGCTGACTGATCAGGCTGG - Intronic
1045550609 8:103168664-103168686 GGGCTGGTTGCTGTCCAGGCTGG + Intronic
1047415489 8:124661659-124661681 TAGCGGGTGGCTGACCAGGAAGG - Intronic
1047700594 8:127445674-127445696 ATGCTGGTGGCTGCACAGGCTGG - Intergenic
1048065349 8:130962096-130962118 TGGCTGGAGGCTGGCAAGCCTGG - Intronic
1048992593 8:139770072-139770094 TCGCTGGTGTCTGCCCAGGGTGG - Intronic
1049222147 8:141433062-141433084 GGGATGGTGGCTGGCCTGGCAGG + Intergenic
1049384940 8:142338438-142338460 TGGGTGTTGGGTGTCCAGGGTGG - Intronic
1049418904 8:142508216-142508238 TGGCTGGTGGCTGTGCAGCAAGG - Intronic
1049689848 8:143953649-143953671 TGGCTGGGTGCAGTCCACGCAGG - Intronic
1052643823 9:31205799-31205821 TGGCTGGTGTCTATTCAGGTGGG - Intergenic
1053217513 9:36284442-36284464 TGGCTGGTGACTGATCAGGGTGG + Intronic
1057193376 9:93099796-93099818 TGGCTGGGGGCTGGAAAGGCTGG - Intronic
1058196445 9:101982891-101982913 TGGCTGCTGACTGATCAGGCTGG - Intergenic
1060556850 9:124512414-124512436 TGCCTGGTGGCTCTCTGGGCTGG + Intergenic
1061074498 9:128332867-128332889 TGGTTTGAGGCTGTCCAGACTGG + Exonic
1061713615 9:132504778-132504800 TGGGTGGAGGCTTTCCACGCAGG - Intronic
1061908712 9:133711812-133711834 TGTGGGGTGGCTGTCGAGGCAGG - Intronic
1186316987 X:8381889-8381911 TGACTGGAGGCTGGCCACGCAGG + Intergenic
1186740443 X:12512033-12512055 TGGCTGCTGACTGTTCAGGGTGG - Intronic
1190708498 X:53049196-53049218 TGGCAGGTGGGGGTCCCGGCAGG - Exonic
1190890429 X:54562449-54562471 TGGCTGTGGACTGTTCAGGCAGG + Intergenic
1191720445 X:64224391-64224413 TGGCTTGTGGCTGGCCAGCCTGG + Exonic
1197963176 X:132028058-132028080 TGTTTAGTGGTTGTCCAGGCTGG + Intergenic
1198281005 X:135142565-135142587 TGGCTGCTGGCTGACCAGCGTGG + Intergenic
1198289953 X:135229951-135229973 TGGCTGCTGGCTGACCAGCGTGG - Intergenic
1199673314 X:150164427-150164449 TGGGTGCTGGCTGTAGAGGCAGG + Intergenic
1199785914 X:151104676-151104698 TGGGAAGTGGCTGTCCAGACGGG + Intergenic
1201689067 Y:16742531-16742553 TGGTAGGTGGCTGTCCATGTTGG - Intergenic
1202378679 Y:24259007-24259029 TGGCCTGTGGCTGTCCATCCAGG + Intergenic
1202492103 Y:25411114-25411136 TGGCCTGTGGCTGTCCATCCAGG - Intergenic