ID: 1161055667

View in Genome Browser
Species Human (GRCh38)
Location 19:2189611-2189633
Sequence GGCTGGTGGCTGTCCAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 334}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161055660_1161055667 -2 Left 1161055660 19:2189590-2189612 CCAGAAGGGTCTTGGCCAGCTGG 0: 1
1: 0
2: 1
3: 19
4: 291
Right 1161055667 19:2189611-2189633 GGCTGGTGGCTGTCCAGGCAGGG 0: 1
1: 0
2: 2
3: 36
4: 334
1161055655_1161055667 28 Left 1161055655 19:2189560-2189582 CCTGCATCAGGGCGGAAAGCGAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1161055667 19:2189611-2189633 GGCTGGTGGCTGTCCAGGCAGGG 0: 1
1: 0
2: 2
3: 36
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161055667 Original CRISPR GGCTGGTGGCTGTCCAGGCA GGG Intronic
900341245 1:2190368-2190390 GGATGGTGGCCGGCCAGGCAGGG + Intronic
900498591 1:2988430-2988452 GCCTGGTGGCAGTCCTGGAAAGG - Intergenic
900502840 1:3015067-3015089 GGCTTGAGGCTGGCCGGGCAAGG - Intergenic
900645135 1:3705592-3705614 GGCTGTTGGCTGTCCTGGGCTGG + Intronic
900945234 1:5827511-5827533 GCCTGGTGACCGTCTAGGCAGGG - Intergenic
900994486 1:6113059-6113081 GGCTCGTGGCTTTCCACCCATGG + Intronic
900995845 1:6123279-6123301 GGTTAGTGGCTGCCCAGGCCTGG + Intronic
901762444 1:11479655-11479677 GGATGTTGGATGTCCAGGAACGG + Intronic
903121535 1:21219686-21219708 GGCTGGTGGCTCATCAGGCCTGG - Intronic
903512374 1:23885897-23885919 GGCGGGGGGGTGGCCAGGCACGG + Intronic
904054780 1:27662877-27662899 AGCTGGAGGCTGCCGAGGCAGGG - Intergenic
905020556 1:34808116-34808138 GGCTGGTGGCTCTACAGGTCTGG + Intronic
905712694 1:40119979-40120001 GGGTGGTAACTGGCCAGGCATGG + Intergenic
905765273 1:40595379-40595401 GTCTGGTGGCGGCCCAGGCCGGG - Intergenic
905766663 1:40607386-40607408 GGGTGGAGGTGGTCCAGGCAGGG - Intergenic
905942195 1:41873109-41873131 GGCAGGCGGCTTCCCAGGCAGGG + Intronic
906123384 1:43410858-43410880 GGCTTGAGGTTGCCCAGGCAAGG + Intronic
906196683 1:43934271-43934293 GGCTGGTGGATGGGGAGGCAAGG + Intronic
907282425 1:53359848-53359870 GCCTGGTTGCTGTCCACCCAGGG + Intergenic
908411265 1:63867969-63867991 GGCGTGTGGCCCTCCAGGCAGGG - Intronic
910046436 1:82923303-82923325 TGCTTGTGGATATCCAGGCATGG + Intergenic
911049610 1:93659481-93659503 AGCCGGTTGCTGGCCAGGCATGG - Intronic
912820660 1:112865227-112865249 GCGCGGTGGCTGGCCAGGCACGG - Intergenic
914445713 1:147749115-147749137 GTCTGGGAGCTGTCAAGGCATGG - Intergenic
915249757 1:154579616-154579638 GGCTGTTCGCTGTCTAGTCAAGG - Exonic
915367359 1:155323635-155323657 AGCTCGGGGCTGGCCAGGCAGGG - Intronic
916880645 1:169016820-169016842 GGCAGTTGGCTGTCCCTGCATGG - Intergenic
917491252 1:175500494-175500516 GGCAGGAGGCTGTGCGGGCAGGG + Intronic
918185397 1:182122272-182122294 GGCTGGGAGCTGGCCAGGGAAGG - Intergenic
919858394 1:201721114-201721136 AGCTGGGGGCTGTGCAGGGAAGG - Intronic
920544134 1:206801466-206801488 TGCTGGAGGCTGACCAGGAATGG - Intronic
921968492 1:221118936-221118958 GGGAAGTGGCTGTCCATGCAGGG + Intergenic
922074256 1:222227228-222227250 GGCTGTTGTGTGTACAGGCAAGG - Intergenic
1062860542 10:806195-806217 GGCTGGAGGCTGAGCAGGCTGGG + Intergenic
1062999993 10:1908298-1908320 CTCTGGTGTCTGTCCAGGCAAGG + Intergenic
1063380662 10:5583565-5583587 TGCTGGGGGCTGTCCCGGCCTGG + Intergenic
1064730705 10:18327863-18327885 GGTTGGGGGGTGTCCTGGCAGGG + Intronic
1064890064 10:20161279-20161301 GGCTGGGAGCTGGCTAGGCAAGG + Intronic
1066525269 10:36272010-36272032 GGCTTGTGGCTTTCAAGGCCAGG + Intergenic
1067426883 10:46217282-46217304 GGGTGGTGGCTGTACTGGAAGGG + Intergenic
1069574526 10:69517228-69517250 GGCTGGGGGCAGCCCTGGCATGG - Intergenic
1069813437 10:71178997-71179019 GGCTGGTGGCTGTCTAGGGAGGG - Intergenic
1070250105 10:74766084-74766106 GGCAGGAGGCTTTCCAGGGAAGG - Intergenic
1070696217 10:78565332-78565354 GGCTGGTGGCTGGACAGTCTAGG - Intergenic
1072794200 10:98341926-98341948 TGCAGGTGGCTGGCCAGGCGCGG - Intergenic
1073810488 10:107147360-107147382 GGCTGATGGCTGTCTAGTCAGGG - Intronic
1075778752 10:125003819-125003841 AGCTGGTGCCGGTGCAGGCAGGG - Intronic
1075970309 10:126646536-126646558 GACTGGGGCCTGCCCAGGCAGGG - Intronic
1076251337 10:128986167-128986189 GGCTGATGGCTGGCAGGGCAGGG - Intergenic
1076517631 10:131057108-131057130 GGGTGGTGGAAGTCCAGCCATGG - Intergenic
1076760771 10:132604949-132604971 GCCTGGTGGCTGTGCAGACCTGG + Intronic
1076840577 10:133043365-133043387 GGCAGGAGGGCGTCCAGGCAGGG - Intergenic
1076840586 10:133043397-133043419 GGCAGGAGGGTGTCCAGGCAGGG - Intergenic
1077207485 11:1351948-1351970 AGTTGGTGGGGGTCCAGGCATGG - Intergenic
1077289037 11:1780389-1780411 GTGTGGTGGCTGACAAGGCAGGG + Intergenic
1077341450 11:2028159-2028181 GGCTGGCGCCTGTCCGGGCCAGG - Intergenic
1077420092 11:2445945-2445967 GGCAGGGGGCTGTCCAGGATAGG + Intronic
1077613569 11:3659873-3659895 GGCTGTTGGCTGTGTAGGCCAGG - Exonic
1078106509 11:8361379-8361401 GGTTGGTGGCTGCCCAGGAAAGG - Intergenic
1081773614 11:45664217-45664239 GGGAGGTGGCTGTCCAGTCAAGG - Intronic
1082001534 11:47395812-47395834 GGCTGTTGGGTGTCCAGGGGCGG - Intergenic
1083750143 11:64756297-64756319 GGCTGCTGGCAGTCCATGCCAGG - Intronic
1083992458 11:66255105-66255127 GGCAGGTGGGAGTCCAGTCATGG + Intergenic
1084175070 11:67418719-67418741 GGCAAGTGGCTGGCCAGGGAAGG - Intronic
1084979125 11:72819671-72819693 GGCTGGTGTGTGTCCTGGGAAGG - Intronic
1085377221 11:76075760-76075782 GGCTGGTAGCTGCCCAGGGATGG - Intronic
1088686689 11:112290053-112290075 AGGTGGTGACTGTCCTGGCAGGG - Intergenic
1089150173 11:116358184-116358206 GGCGGGTGGCTCCCCAGGCAGGG - Intergenic
1089811586 11:121136348-121136370 GGTGGGGGGCTGTCCAGGAAGGG + Intronic
1090034684 11:123238489-123238511 GGCTGTTGGCTGACATGGCAAGG + Intergenic
1091269343 11:134294652-134294674 GACTGGTGGCTGCCCAGGGCTGG - Intronic
1091899596 12:4134313-4134335 GGCTGGTGGCTGACCAGCTGGGG - Intergenic
1093861384 12:24171511-24171533 GTCTGTTGGCTGGCCAGGCATGG - Intergenic
1096188269 12:49598360-49598382 GTCTGGTGGCTCTCCAGGCTTGG - Intronic
1097180738 12:57170386-57170408 GGCTGGGTGCAGGCCAGGCATGG + Intronic
1098875114 12:75858906-75858928 TGGTGCTGGCTGACCAGGCAAGG + Intergenic
1101266656 12:103095298-103095320 GGCTGGAGGCAGAACAGGCAAGG - Intergenic
1101322868 12:103688675-103688697 GGGTGGGTGCTGACCAGGCATGG - Intronic
1101835109 12:108289541-108289563 GGCTTCTGGCAGTCCAGGCCAGG - Exonic
1102386446 12:112514505-112514527 GGCTGGGGGCTGAACAAGCAGGG - Intergenic
1102703838 12:114864113-114864135 GGCTGGACGCTGGCCAGGCACGG + Intergenic
1103242793 12:119428957-119428979 GGCTGGAGGCTGGCATGGCATGG - Intronic
1105571881 13:21610815-21610837 GGCTGGTGGCTGGCAGGGCTGGG + Intergenic
1107938297 13:45363244-45363266 GGCTGCTGGCTGCTCAGACAAGG - Intergenic
1112328466 13:98459514-98459536 GGACCGTGGCTGGCCAGGCACGG + Intronic
1112448062 13:99484834-99484856 GGCTGGAGGTTGTCTAGACAAGG - Intergenic
1112731253 13:102365290-102365312 CTCTACTGGCTGTCCAGGCATGG - Intronic
1113709115 13:112452516-112452538 GGCTGCTGGCCTGCCAGGCATGG - Intergenic
1113752395 13:112785356-112785378 GGCTGGTGGCTGTGACAGCAGGG - Intronic
1113839304 13:113349750-113349772 GGCCCAGGGCTGTCCAGGCAGGG + Intronic
1113910774 13:113840237-113840259 GGCTAGGGGCTGGCCAGGGAAGG - Intronic
1115364500 14:32542622-32542644 GGTTGGAAGCTTTCCAGGCAGGG + Intronic
1119748227 14:77059460-77059482 GCCTGGTGGCTTTGCAGCCATGG - Intergenic
1119841951 14:77800080-77800102 GTCAGGTGGCTGTCCCCGCACGG + Exonic
1120212195 14:81644315-81644337 AGGTGGAGGCTGGCCAGGCATGG + Intergenic
1120996841 14:90423790-90423812 GGCTGGTGCCTGTCTAGCCCTGG + Intergenic
1121272485 14:92647717-92647739 GGCTGGTGGCAGGACAGGAAGGG - Intronic
1122029984 14:98905161-98905183 GGCTGCTGGGTGTCCTGGCTAGG + Intergenic
1122290969 14:100680358-100680380 GGCTGGTGGCAGTGCAGGAAGGG - Intergenic
1122500024 14:102191283-102191305 GGCAGATGGCTTCCCAGGCAGGG - Intronic
1122647663 14:103206088-103206110 TGCTGGGGCCTCTCCAGGCAGGG - Intergenic
1122890988 14:104732159-104732181 GGCTGGTGGCTCCCATGGCAAGG + Intronic
1122902584 14:104787970-104787992 GGCTGGTGGAGGTCATGGCATGG - Intronic
1123038578 14:105481291-105481313 GGCTGGAGGGTGGCCAGGCAGGG - Intergenic
1123042829 14:105497388-105497410 GCCTGGAGGCTGTCCTGGCGTGG + Exonic
1123097185 14:105772233-105772255 GGCTGGTGGCTGAGAAGGCCAGG - Intergenic
1123476645 15:20595909-20595931 GGCTGGTGGCAATCCCGGGAAGG + Intergenic
1123641366 15:22404455-22404477 GGCTGGTGGCAATCCCGGGAAGG - Intergenic
1128658019 15:69476716-69476738 GGCAGGTGTCTGTACAGGCCAGG - Intergenic
1129889003 15:79058640-79058662 AGGTGGGGGCAGTCCAGGCAGGG + Intronic
1131058267 15:89389401-89389423 TGCTGGTGGCTGTGCAGGGTGGG - Intergenic
1132562558 16:603763-603785 GGCTGGGGGCTGACTCGGCAGGG - Intronic
1132716077 16:1290414-1290436 GGCTGCTGGCTGTGCGGGCAGGG - Intergenic
1132780828 16:1624293-1624315 TGCGTGTGGCTGCCCAGGCAGGG + Intronic
1132951196 16:2563351-2563373 GGGTGCTGGCTGCCCACGCAGGG + Intronic
1132963154 16:2636819-2636841 GGGTGCTGGCTGCCCACGCAGGG - Intergenic
1133323765 16:4931030-4931052 GGCTGCTGGCTCTGCAGGCAGGG + Intronic
1133475437 16:6116854-6116876 GGCTGGTGGCTGTACAGTAAAGG + Intronic
1133965740 16:10530497-10530519 TGCTGGGGGCTGTCCTGGGATGG - Exonic
1134049701 16:11128781-11128803 GGCTGGTGGGTGTGGAAGCAGGG - Intronic
1134477969 16:14592278-14592300 GTCTGGGGGCTATCCAGGTAGGG + Intronic
1134511127 16:14847861-14847883 GACTGGTGCCTCTCCAGGCCTGG + Intronic
1134698769 16:16246357-16246379 GACTGGTGCCTCTCCAGGCCTGG + Intronic
1135315937 16:21444387-21444409 TTCCGGTGGCTGGCCAGGCACGG - Intronic
1135368862 16:21876649-21876671 TTCCGGTGGCTGGCCAGGCACGG - Intronic
1135442954 16:22494494-22494516 TTCCGGTGGCTGGCCAGGCACGG + Intronic
1135614757 16:23901638-23901660 GGCTGGTTGCTGGGCAGGCCTGG - Intronic
1136312613 16:29423129-29423151 TTCCGGTGGCTGGCCAGGCACGG - Intergenic
1136326047 16:29524871-29524893 TTCCGGTGGCTGGCCAGGCACGG - Intergenic
1136440736 16:30264855-30264877 TTCCGGTGGCTGGCCAGGCACGG - Intergenic
1137023449 16:35452207-35452229 GGCTGGTCGCTGCCAGGGCAAGG - Intergenic
1137428593 16:48400226-48400248 GCCTGCTGGCTGTCCATGGAGGG + Intronic
1137652181 16:50130064-50130086 GGCTGCAGGCTGTACAAGCATGG + Intergenic
1138163333 16:54776839-54776861 GGCTGGAGGCTGCCAAGACAGGG - Intergenic
1138271036 16:55695995-55696017 AGCCTGTAGCTGTCCAGGCAGGG + Intronic
1138599501 16:58046350-58046372 GGCTGGTGGGTGCCTAGGCCTGG + Exonic
1139431852 16:66915057-66915079 GGCAGGGGGCTGTGGAGGCAGGG - Intronic
1139546556 16:67652630-67652652 GGCTGGTGGGTACCCAGACAAGG - Intronic
1139887250 16:70217174-70217196 TTCCGGTGGCTGGCCAGGCACGG - Intergenic
1141568559 16:84920158-84920180 GGGAGGTGGCTGTCCATGCATGG + Intronic
1141604961 16:85147371-85147393 GGCTGGTGGCTGACCTTGGACGG + Intergenic
1141735309 16:85848242-85848264 GGCGGCTGCCTGACCAGGCAGGG + Intergenic
1142103923 16:88291947-88291969 GGCTGCTGGCTGCCCAGGGAAGG + Intergenic
1142144254 16:88486213-88486235 GGCTGGGGGGTCTCCAGGAAAGG + Intronic
1142315037 16:89338306-89338328 AGCAGGTGGCTGTCCTGGCTTGG - Intronic
1143389348 17:6551065-6551087 GCCTGGAGTCTGGCCAGGCACGG + Intronic
1143838243 17:9710083-9710105 AGCTGCTGGCTGACCAGGGAGGG - Exonic
1144025667 17:11274114-11274136 GCCTGGTGGCTGCACAGGCTTGG + Intronic
1144254941 17:13458435-13458457 GGTTGGAGGGTCTCCAGGCATGG + Intergenic
1144788464 17:17844639-17844661 GCCTGGAGACTGCCCAGGCAGGG + Intronic
1145099654 17:20064030-20064052 GGCTGGTGGCTGAGTAAGCAGGG + Intronic
1145267229 17:21385685-21385707 GCCTGGAGGCTGTGCTGGCAGGG - Intronic
1146177472 17:30675337-30675359 GGCTGGTGGCAGTGCAGGTGAGG + Intergenic
1146208049 17:30921904-30921926 GGCTGGCGGCTGCCCAGGCCTGG + Exonic
1147188243 17:38724532-38724554 GGGTGGGGCCTGGCCAGGCAGGG + Intronic
1147941265 17:44049983-44050005 GCCTGGTGGGTGTCAAGGGATGG + Intronic
1149468615 17:56898806-56898828 GACTGATGGCGGTCCAGGAAGGG - Intronic
1149638020 17:58185720-58185742 GGCTGGATACTGACCAGGCAGGG + Intergenic
1149795996 17:59520493-59520515 GAATGGTGGCTGTCAAGGGATGG - Intergenic
1149896083 17:60429516-60429538 GGATCTTGGCTGCCCAGGCAGGG - Exonic
1151329624 17:73399162-73399184 GGCTGGTGGAAGCCCAGGTAGGG - Exonic
1151572793 17:74935669-74935691 GGCTGAGGGCTGTGCAGGCGCGG - Intergenic
1151891697 17:76954771-76954793 GGGAGGTGGCCGTCCAGGGAGGG - Intergenic
1151981185 17:77510218-77510240 GGCTGTTTGCTGCCCAGGCCTGG + Intergenic
1152231772 17:79117489-79117511 GGCTGGGGGCTGCCCCCGCAGGG + Intronic
1154112290 18:11580370-11580392 GGCTGGTGTCTGTCCCCTCAAGG - Intergenic
1154980433 18:21498896-21498918 GGCTTGTTGCTGCCCAGACAGGG - Intronic
1155940280 18:31795691-31795713 GGCTGGTTTCTGGCCAGTCAAGG + Intergenic
1157594081 18:48853287-48853309 GGATGGTGGCTGCTCAGGGAAGG + Intronic
1158442901 18:57492955-57492977 GGCTGGGGGCTGGCCAGTCTAGG + Intergenic
1158474051 18:57764211-57764233 GGCAGGTGGCTGCACAGTCATGG - Intronic
1160094518 18:75859668-75859690 GGAGCGTGGCTGACCAGGCAGGG - Intergenic
1160702974 19:517439-517461 GGGTGGGGGCTGGCCAGGCTGGG + Intronic
1161055667 19:2189611-2189633 GGCTGGTGGCTGTCCAGGCAGGG + Intronic
1161139920 19:2641204-2641226 GGCAGGTGAGTGACCAGGCAAGG + Intronic
1162745146 19:12793761-12793783 GGCAGGCGGCTGCCCGGGCACGG + Intronic
1162936840 19:13985758-13985780 GGGTCTCGGCTGTCCAGGCAGGG + Intronic
1162981018 19:14239907-14239929 GGCTGGTGGCAGTGCAGGTGAGG - Intergenic
1163550767 19:17965488-17965510 GGCTCCTGGTGGTCCAGGCAGGG + Intronic
1163759902 19:19130523-19130545 GGCGGGAGGCTGTACAGACACGG - Intronic
1164279774 19:23759263-23759285 GGCTGGGGGCTGTCGGGGTAGGG - Intergenic
1165236803 19:34428414-34428436 GGCTCGTGGTTGTCCCGCCATGG + Exonic
1166075478 19:40411596-40411618 GCTGGGTGCCTGTCCAGGCAGGG - Intronic
1166670044 19:44704182-44704204 GGCCGGGTGCTGGCCAGGCATGG + Exonic
1167414529 19:49363112-49363134 GGCTGGCGGCTGTCCCGGGACGG + Intronic
1167499691 19:49838099-49838121 GGATGCTGGTGGTCCAGGCATGG - Intronic
1167527744 19:49995430-49995452 GGCTGGTGACAGGGCAGGCATGG + Intronic
1168080076 19:54003649-54003671 TGCTGGTGGATGGCTAGGCAGGG - Intronic
925131518 2:1497171-1497193 GGCTGGAGGAGGACCAGGCATGG - Intronic
926113416 2:10196631-10196653 GGCTGCTGGCTGTCCATCCCCGG - Intronic
926682589 2:15675270-15675292 GGCTGCTGGATGTGCTGGCAAGG + Intergenic
928690563 2:33794340-33794362 TTCAGGTGGCTGGCCAGGCATGG + Intergenic
932405802 2:71512034-71512056 GGTTGGAGGCTGCCCAGGCCTGG + Intronic
932494746 2:72140740-72140762 GGATGGTGGGTGGACAGGCAGGG + Intronic
935090406 2:99890499-99890521 GCCTCGTGACTGTCCAGGCAAGG - Intronic
935348032 2:102126880-102126902 GGCCAGTGGCTGTCCAGCCTGGG + Intronic
937417274 2:121725710-121725732 GGCAGGTGGCTGTTCAGGAAGGG + Intergenic
942141098 2:172978224-172978246 TGCTGGGGGCTGTCCCTGCAAGG + Intronic
945243828 2:207700062-207700084 GGCCTGTTACTGTCCAGGCAGGG - Intergenic
945341966 2:208667126-208667148 TGCTGCTGGGTGTACAGGCACGG - Intronic
946374556 2:219300179-219300201 GGCAGTGGGGTGTCCAGGCATGG + Exonic
947291470 2:228580071-228580093 GGAATGTGGCTGTCCAGGCAAGG + Intergenic
947603581 2:231469304-231469326 GGCAGGTGGCAGGCCAGGCGTGG - Intronic
947661668 2:231874132-231874154 GGTTGGTGGATGGTCAGGCATGG + Intergenic
948877330 2:240836698-240836720 GGCTGGGGGCTGCCCAGCCTGGG - Intergenic
1168757555 20:327103-327125 TGCTGGTGGCTGTGCAGGAGGGG - Exonic
1168861206 20:1047239-1047261 CACAAGTGGCTGTCCAGGCAGGG + Intergenic
1169311828 20:4549181-4549203 GGGTGCTGGCTGTGCAGTCAAGG - Intergenic
1170798248 20:19569132-19569154 TGCTGGGGGCTGGCCAGGGAAGG - Intronic
1171249997 20:23639636-23639658 GGCTGTTTCCTGTCTAGGCAGGG - Intergenic
1172006969 20:31824368-31824390 GGGTGGTGGCTGCCCAGGATGGG + Intronic
1172931807 20:38591746-38591768 TGCTGGTGACTGTCCTCGCAGGG - Intergenic
1175828511 20:61950038-61950060 GGATGGAGGCTGTCCCGGCTGGG - Intergenic
1175840181 20:62021638-62021660 AGGAGGTGGCTGTACAGGCAGGG + Intronic
1176051553 20:63122354-63122376 GGCTGATGTCTGTGCAAGCAGGG + Intergenic
1176105215 20:63382596-63382618 GGCTGGTGACAGTCCACACAGGG - Intergenic
1178352318 21:31881020-31881042 TGATGGGGGCTGCCCAGGCAAGG + Intronic
1178404976 21:32316542-32316564 AGCTGGTGGCTGCCCAGGGCCGG - Exonic
1179008091 21:37531839-37531861 GGCTGGAGGCTGTCCAGGAGTGG - Intergenic
1179541151 21:42083929-42083951 GGTGGGTGTCTGCCCAGGCATGG + Intronic
1179553271 21:42156735-42156757 GGGTGGAGTCTGTCCAGGCGAGG + Intergenic
1179842241 21:44084729-44084751 GGCTGGTGGCTGGCATGGGAAGG - Intronic
1180220657 21:46356030-46356052 GGTTGTGGGATGTCCAGGCAGGG + Intronic
1181051471 22:20240176-20240198 GGCTGGGGGCAGCTCAGGCAGGG - Intergenic
1181055943 22:20260559-20260581 TGCTGGTAGCTGGCCAGGCCCGG + Intronic
1183367946 22:37417138-37417160 GGCTGGTGGCTGCCCTGGAGAGG - Intronic
1184035732 22:41917260-41917282 GGCAGGAGGGTGTCCAGGAAGGG - Intergenic
1184791982 22:46705740-46705762 GGTGGGTGACTGGCCAGGCATGG + Intronic
1184893348 22:47392865-47392887 GGCTGGGGGCTGCCCGGTCACGG - Intergenic
1185193074 22:49451197-49451219 GGCTGGGGACTGGCCAGCCACGG - Intronic
950439949 3:13004713-13004735 GGCTGGGGGCTGTCCAGGTGAGG + Intronic
950617535 3:14173192-14173214 AGCTGGTTGCTGACCAGACAGGG - Intronic
952316806 3:32238810-32238832 CGCCGGGGGCTGTCCAGGCGCGG - Exonic
953883348 3:46702551-46702573 GGATGGAGGCTGTGCAGGCAGGG + Intronic
954031025 3:47820020-47820042 GACTTGTGGCTGGCCGGGCATGG + Intronic
954301142 3:49701470-49701492 AGCTGGCGGGTGTCAAGGCAGGG - Exonic
954327510 3:49871523-49871545 GGGTCATGGCTATCCAGGCATGG + Intergenic
954386385 3:50246222-50246244 GGCTGGGGGCTTCCCAGGGACGG + Intronic
954435546 3:50493971-50493993 GGCTGGAGTCAGCCCAGGCAAGG + Intronic
954450325 3:50567986-50568008 GGCTTGAGTCTGTCCTGGCACGG - Intronic
955069533 3:55560587-55560609 AGCTGGTGGCTGTCCTGGGTTGG - Intronic
956056211 3:65301334-65301356 GACTGGTGGCTGGCCATCCAAGG - Intergenic
956466431 3:69524831-69524853 GGCATGTGGCTGTCAAGGTAGGG - Intronic
958748132 3:98162523-98162545 AGCTAGTGGCTGTACAGGCCTGG + Intergenic
959778387 3:110199181-110199203 AGCTGTTGACTGTTCAGGCATGG - Intergenic
960426078 3:117509200-117509222 GGAAGGAGGCTGTCCAAGCAAGG + Intergenic
961649067 3:128408473-128408495 GGCTGGGGGCTGTCCTGGGTGGG - Exonic
962490138 3:135885627-135885649 AGCTGGTGGATGACAAGGCAGGG - Intergenic
962927906 3:140012041-140012063 GGCTGGAGGCTGACAAGGCTGGG + Intronic
963797659 3:149647374-149647396 GGCCACTGGCTGCCCAGGCAGGG + Intronic
964511812 3:157460708-157460730 GGCTGGGTGCTGGCAAGGCAGGG + Intronic
967284325 3:187853709-187853731 GCCTGGTGGCTGAGCAGGGAAGG - Intergenic
967971756 3:195004592-195004614 GGCTGGAGACTGTCCAGTCTGGG + Intergenic
968066042 3:195760333-195760355 AGCGTGTGGCTGTCCAGGGAAGG + Intronic
968516705 4:1018572-1018594 GGCTGGGGGGTGTCTTGGCAGGG + Intronic
968660196 4:1795674-1795696 AGATGGGGGCTGTCCTGGCAGGG - Intronic
968764072 4:2459057-2459079 GGCTGGTGGGTGGCAGGGCAGGG - Intronic
968884292 4:3319012-3319034 GGCTGCTGGCTGGGTAGGCAGGG + Intronic
969358642 4:6647181-6647203 GGCTGGTGGCTGTGTGAGCATGG + Intergenic
969569970 4:8002444-8002466 GACTGGAGGCTGCCCAGTCAGGG - Intronic
970895667 4:21100605-21100627 GGCTGCTGGCTGATCAGGGATGG - Intronic
973166750 4:47087438-47087460 GGTTAGTGGCTCTGCAGGCAAGG - Intronic
973205695 4:47557971-47557993 GGCCAATGGCTGTCCAGGGAGGG - Exonic
973588258 4:52413754-52413776 AGCAAGTGGCTGCCCAGGCAGGG + Intergenic
975063042 4:70027226-70027248 GGCTGGTGGCTGGGGAGGGAGGG - Intergenic
975907755 4:79235103-79235125 AGCTAGTGGCAGTCCAGGCAAGG - Intronic
981320648 4:143387687-143387709 GGAGGGTGAATGTCCAGGCAGGG - Intronic
981646763 4:147007386-147007408 GGCTGGGGCCTGTCCTGGCTAGG - Intergenic
985493530 5:192466-192488 GGCTGGTGGCTGCAGAGGCAAGG + Intronic
985554004 5:547263-547285 GGCTGCAGCCTGTCCAGGTAGGG + Intergenic
986123111 5:4860556-4860578 GGCTGGTGGTGTGCCAGGCACGG + Intergenic
986606643 5:9529409-9529431 AGCTGGTGGGTGTCCAGGCAGGG - Intronic
986672831 5:10158243-10158265 GGCTGGTGGTTCTGCAGGCCAGG + Intergenic
989418008 5:41203227-41203249 GCCTGGAGGCTCTCAAGGCATGG - Exonic
993653516 5:90551033-90551055 AGCTGGTGAAAGTCCAGGCATGG - Intronic
995831213 5:116358182-116358204 GGCTGGGGGCTGAGGAGGCAGGG - Intronic
997469175 5:134107272-134107294 GGCTGGGGGCTCTCTAGGGAGGG - Intergenic
998411123 5:141912322-141912344 GGGATGTGGCTGTCCAGTCAGGG - Intergenic
999283759 5:150381903-150381925 TGCTGGGGGCAGGCCAGGCACGG + Intronic
999327081 5:150650154-150650176 GGCTGCAGGCTGTCCTGGCCGGG - Exonic
1000487344 5:161863675-161863697 GGATGGTGGCATTCCAGGAAAGG + Intronic
1001350498 5:170958432-170958454 GGTTGGTGGGTGTGCAAGCAGGG + Intronic
1001746535 5:174096768-174096790 AGCTGGTGTCTGCCTAGGCATGG + Intronic
1002448616 5:179306677-179306699 GGAAGGTGGATGTCCAGGAAGGG + Intronic
1004178799 6:13363838-13363860 GCCACGTGGCTCTCCAGGCAGGG - Exonic
1006296027 6:33170490-33170512 GGGTGGGGGCTGGCCAGGGAGGG + Intronic
1007418219 6:41704486-41704508 GGCTGGTGGTCACCCAGGCAGGG - Intronic
1007470745 6:42088656-42088678 GGCTGGTGGATGCCCTGGCAGGG - Intergenic
1011789781 6:90885670-90885692 GACTCGGGGCTGTCCAGGCTCGG - Intergenic
1014164417 6:118207577-118207599 GGCTGGGGGATGTGCAGGGATGG + Intronic
1014291192 6:119560760-119560782 GGCTTTTGGATGTCCAGGCTTGG + Intergenic
1016895767 6:149050978-149051000 GGCAGGTGGTTATCTAGGCAGGG + Intronic
1017931347 6:158958443-158958465 GACTGGTGGCTTTCTAAGCAGGG - Intergenic
1018255115 6:161910794-161910816 GGCTGCTGTCTGATCAGGCAGGG - Intronic
1018712210 6:166505271-166505293 GGCTGGGAGGTGACCAGGCAGGG + Intronic
1018847282 6:167564553-167564575 TGGTGGGGGCTGTCCATGCAGGG + Intergenic
1019610091 7:1932130-1932152 CGCTGGAGGCTGCCCAGGCTGGG + Intronic
1019618489 7:1978004-1978026 GGCTGGTGCCTGACCCTGCAAGG - Intronic
1019801516 7:3091551-3091573 AGCTGCTGGCTGTCCTGGAATGG - Intergenic
1020649591 7:10858059-10858081 GGCTTTTGGCGGTGCAGGCAGGG - Intergenic
1021187026 7:17576280-17576302 GCCTGCTGGCAGTCCAGACAAGG + Intergenic
1022414276 7:30164756-30164778 GGTTGGTGAATGTCCAGGCTGGG + Intergenic
1023984114 7:45085410-45085432 GGCTGGGGCCTGTCCCCGCAGGG - Exonic
1024366533 7:48527057-48527079 AGAGGGTGGCTGTGCAGGCAGGG + Intronic
1025035668 7:55591318-55591340 GGGTGGGGGCTGGCCAGGCAGGG - Intergenic
1026812013 7:73475625-73475647 GCATGGTGGCTGGCCCGGCATGG + Intronic
1027051119 7:75021767-75021789 GGCATGGGGCTGGCCAGGCAGGG - Intronic
1027504279 7:78996098-78996120 GGTTGGTGGGTCTCCAGCCAGGG - Intronic
1029544381 7:101202537-101202559 GCCAGGTGGCTGTCCTGGCGTGG - Intergenic
1029612074 7:101631690-101631712 GGGTGATGGCTGGCCAGGGAAGG - Intergenic
1030342905 7:108400916-108400938 GGCTCGTGGCTCTCTGGGCAGGG + Intronic
1032059824 7:128715215-128715237 GGCTGGGGAATGTCCAGGCACGG + Intronic
1032089147 7:128902623-128902645 TGCTGGGGGCTGTGCAGGCGGGG - Intronic
1033416254 7:141163801-141163823 TGCTGTTTGCTGGCCAGGCATGG - Intronic
1034009291 7:147510309-147510331 GGCTGGTGGCTTACATGGCAAGG - Intronic
1034469140 7:151246415-151246437 GGCTGGAGGCAGGGCAGGCAAGG + Intronic
1035793130 8:2325957-2325979 TGCTGGCGGCTGTCCATGCTGGG + Intergenic
1035793264 8:2327205-2327227 TGCTGGTGGCAGACCAGGAAAGG + Intergenic
1035799540 8:2394500-2394522 TGCTGGTGGCAGACCAGGAAAGG - Intergenic
1035799674 8:2395748-2395770 TGCTGGCGGCTGTCCATGCTGGG - Intergenic
1036122768 8:6036262-6036284 GGGTGGGGGCTGTGCAGGCTGGG - Intergenic
1036182039 8:6594075-6594097 GACAGCTGGCTGTCCAGGCAAGG + Intronic
1037841622 8:22249209-22249231 GGTGGGTGGCTGGCCAGGGAGGG - Exonic
1038586059 8:28790247-28790269 GGCTTGTGGTGGTCCTGGCATGG + Intronic
1038614658 8:29081302-29081324 GGCTGGTGGCTGCCATGTCAGGG - Intronic
1039110967 8:34040578-34040600 GGGTTGTGGCTGTGCAAGCACGG + Intergenic
1039311586 8:36322433-36322455 GGCTGGTGGCCCTCAAGGCCAGG - Intergenic
1039819046 8:41120100-41120122 AGCTGGAGGCTGTGCAAGCAAGG - Intergenic
1041325062 8:56654679-56654701 GGCTGGTTTCTGACCAGGCTCGG - Intergenic
1041764547 8:61404688-61404710 GGCTGGTGGATTTGCAGGGAGGG + Intronic
1044766465 8:95580790-95580812 AGCTGGTTTCTGGCCAGGCACGG + Intergenic
1045966460 8:108030469-108030491 GACTAGTGGATGCCCAGGCAAGG + Intronic
1047360500 8:124164592-124164614 GGCTGATGGCTGTCATGACAAGG - Intergenic
1047700593 8:127445673-127445695 TGCTGGTGGCTGCACAGGCTGGG - Intergenic
1047903985 8:129453407-129453429 GGCTGGTGGGAGGCCAGGCGCGG - Intergenic
1047911604 8:129535898-129535920 GGCTGGGCGATGCCCAGGCATGG - Intergenic
1048269931 8:133020431-133020453 GGCTTGTGGCTGCTGAGGCAAGG - Intronic
1049312144 8:141938889-141938911 GGCTGCTGGGTCTCCAGCCAGGG + Intergenic
1049313538 8:141946831-141946853 CGCTGTGGGCTGCCCAGGCATGG - Intergenic
1049356253 8:142189984-142190006 CCGTGGGGGCTGTCCAGGCAGGG + Intergenic
1049418903 8:142508215-142508237 GGCTGGTGGCTGTGCAGCAAGGG - Intronic
1049689847 8:143953648-143953670 GGCTGGGTGCAGTCCACGCAGGG - Intronic
1050309037 9:4334394-4334416 AGCTGGTGGCTGGAGAGGCAAGG + Intronic
1053439940 9:38107906-38107928 GGGTGATGGCTGTGCTGGCATGG - Intergenic
1055928790 9:81538570-81538592 GACTTGTGGCTGTCCAGGGAAGG + Intergenic
1056276336 9:84997781-84997803 GGCTGGGGGGTGTTCAGCCATGG + Intronic
1056708816 9:88973412-88973434 AGCTGGTGGGTGTCCTGGCCTGG - Intergenic
1056773573 9:89496757-89496779 GCCTGCTGGCTGCCCAGGCGAGG - Intronic
1057214543 9:93220650-93220672 GGCTGGGGGCTGTCCAGCCCTGG + Intronic
1057391713 9:94646158-94646180 GGCTATTGGCTGTCCTGGGAAGG + Intergenic
1059518161 9:114914816-114914838 GGCTGGGGGCTATCCTGGCCAGG + Intronic
1060660760 9:125404004-125404026 GGCTAGAGGCTTCCCAGGCAGGG - Intergenic
1060800922 9:126545497-126545519 GGGTGATGGGAGTCCAGGCAGGG - Intergenic
1060932053 9:127495427-127495449 TGCTGGTGCCTGTCCCGGCCAGG + Intronic
1061118306 9:128628259-128628281 GCCCGGTGGCTGGACAGGCACGG - Intronic
1061671015 9:132188205-132188227 GGCTGGAGGCTGCCCAGGAGAGG - Intronic
1061678113 9:132229645-132229667 AGCAGGTGGCTGCCCAGACATGG + Intronic
1062349289 9:136131290-136131312 GGCTAGTGGCCTTCTAGGCAGGG + Intergenic
1062519690 9:136952497-136952519 GGCTGGTGGCTGAGCAGGCCTGG + Intronic
1189255460 X:39635093-39635115 GTCTGCAGGCTGTACAGGCATGG - Intergenic
1190890430 X:54562450-54562472 GGCTGTGGACTGTTCAGGCAGGG + Intergenic
1191826394 X:65369954-65369976 GCTTGGTGGCTGTCTGGGCATGG + Intronic
1198865619 X:141120309-141120331 GACTGGTGGCTGTGCAGGTCTGG + Intergenic
1199933985 X:152553328-152553350 GGTTAGTGGCTCTGCAGGCAAGG + Intergenic
1200254558 X:154573163-154573185 TTCTGGAGGCCGTCCAGGCAAGG + Intergenic
1200263211 X:154631245-154631267 TTCTGGAGGCCGTCCAGGCAAGG - Intergenic
1200988239 Y:9325857-9325879 GGCTGGAGGCTGTGCAGGAGAGG + Intergenic
1202119781 Y:21510337-21510359 GGCTGGAGGCTGTGCAGGAGAGG - Intergenic
1202122232 Y:21533878-21533900 GGCTGGAGGCTGTGCAGGAGAGG - Intronic
1202156773 Y:21895505-21895527 GGCTGGAGGCTGTGCAGGAGAGG + Intronic
1202159221 Y:21919046-21919068 GGCTGGAGGCTGTGCAGGAGAGG + Intergenic
1202185670 Y:22183961-22183983 GGCTGGAGGCTGTGCAGGAGAGG + Intergenic
1202205690 Y:22402435-22402457 GGCTGGAGGCTGTGCAGGAGAGG - Intronic