ID: 1161056868

View in Genome Browser
Species Human (GRCh38)
Location 19:2195108-2195130
Sequence CTGCCACTCAGCCACTGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 194}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161056868_1161056880 2 Left 1161056868 19:2195108-2195130 CCCTTTCAGTGGCTGAGTGGCAG 0: 1
1: 0
2: 1
3: 14
4: 194
Right 1161056880 19:2195133-2195155 GGATGGGTGTGGGGGTGGGAAGG 0: 1
1: 1
2: 59
3: 532
4: 3530
1161056868_1161056879 -2 Left 1161056868 19:2195108-2195130 CCCTTTCAGTGGCTGAGTGGCAG 0: 1
1: 0
2: 1
3: 14
4: 194
Right 1161056879 19:2195129-2195151 AGTGGGATGGGTGTGGGGGTGGG 0: 1
1: 0
2: 20
3: 215
4: 1841
1161056868_1161056877 -6 Left 1161056868 19:2195108-2195130 CCCTTTCAGTGGCTGAGTGGCAG 0: 1
1: 0
2: 1
3: 14
4: 194
Right 1161056877 19:2195125-2195147 TGGCAGTGGGATGGGTGTGGGGG 0: 1
1: 2
2: 18
3: 153
4: 1263
1161056868_1161056885 23 Left 1161056868 19:2195108-2195130 CCCTTTCAGTGGCTGAGTGGCAG 0: 1
1: 0
2: 1
3: 14
4: 194
Right 1161056885 19:2195154-2195176 GGGGATGCTGTTTAGGGAGCAGG 0: 1
1: 0
2: 0
3: 23
4: 198
1161056868_1161056878 -3 Left 1161056868 19:2195108-2195130 CCCTTTCAGTGGCTGAGTGGCAG 0: 1
1: 0
2: 1
3: 14
4: 194
Right 1161056878 19:2195128-2195150 CAGTGGGATGGGTGTGGGGGTGG 0: 1
1: 0
2: 9
3: 177
4: 1401
1161056868_1161056884 17 Left 1161056868 19:2195108-2195130 CCCTTTCAGTGGCTGAGTGGCAG 0: 1
1: 0
2: 1
3: 14
4: 194
Right 1161056884 19:2195148-2195170 TGGGAAGGGGATGCTGTTTAGGG 0: 1
1: 0
2: 1
3: 29
4: 240
1161056868_1161056882 4 Left 1161056868 19:2195108-2195130 CCCTTTCAGTGGCTGAGTGGCAG 0: 1
1: 0
2: 1
3: 14
4: 194
Right 1161056882 19:2195135-2195157 ATGGGTGTGGGGGTGGGAAGGGG 0: 1
1: 2
2: 26
3: 285
4: 2323
1161056868_1161056874 -9 Left 1161056868 19:2195108-2195130 CCCTTTCAGTGGCTGAGTGGCAG 0: 1
1: 0
2: 1
3: 14
4: 194
Right 1161056874 19:2195122-2195144 GAGTGGCAGTGGGATGGGTGTGG 0: 1
1: 0
2: 2
3: 86
4: 790
1161056868_1161056886 27 Left 1161056868 19:2195108-2195130 CCCTTTCAGTGGCTGAGTGGCAG 0: 1
1: 0
2: 1
3: 14
4: 194
Right 1161056886 19:2195158-2195180 ATGCTGTTTAGGGAGCAGGAAGG 0: 1
1: 0
2: 2
3: 17
4: 253
1161056868_1161056875 -8 Left 1161056868 19:2195108-2195130 CCCTTTCAGTGGCTGAGTGGCAG 0: 1
1: 0
2: 1
3: 14
4: 194
Right 1161056875 19:2195123-2195145 AGTGGCAGTGGGATGGGTGTGGG 0: 1
1: 1
2: 7
3: 57
4: 522
1161056868_1161056881 3 Left 1161056868 19:2195108-2195130 CCCTTTCAGTGGCTGAGTGGCAG 0: 1
1: 0
2: 1
3: 14
4: 194
Right 1161056881 19:2195134-2195156 GATGGGTGTGGGGGTGGGAAGGG 0: 1
1: 1
2: 30
3: 293
4: 2137
1161056868_1161056876 -7 Left 1161056868 19:2195108-2195130 CCCTTTCAGTGGCTGAGTGGCAG 0: 1
1: 0
2: 1
3: 14
4: 194
Right 1161056876 19:2195124-2195146 GTGGCAGTGGGATGGGTGTGGGG 0: 1
1: 0
2: 11
3: 92
4: 814
1161056868_1161056883 16 Left 1161056868 19:2195108-2195130 CCCTTTCAGTGGCTGAGTGGCAG 0: 1
1: 0
2: 1
3: 14
4: 194
Right 1161056883 19:2195147-2195169 GTGGGAAGGGGATGCTGTTTAGG 0: 1
1: 0
2: 2
3: 28
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161056868 Original CRISPR CTGCCACTCAGCCACTGAAA GGG (reversed) Intronic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
907418996 1:54333941-54333963 CTGCTACTCAGAGACTGAGATGG + Intronic
907920902 1:58910861-58910883 CAGCCACTCAACCACTCAAGAGG - Intergenic
907986988 1:59542038-59542060 CTGACTCTCAGCCACAAAAATGG - Intronic
910185687 1:84537572-84537594 CTGTCACTCAGCCACAAATATGG + Intergenic
910968890 1:92834206-92834228 ATGCCACTTAACCACTGAAAAGG + Intronic
920685943 1:208109114-208109136 CTGGCTCCCAGCCACTGAGAAGG - Intronic
921310927 1:213842397-213842419 CTGCCAGTTAGCCAGTGAAAGGG - Intergenic
922743824 1:228031902-228031924 CTGCCACTCCCCCTCTGAGAAGG + Intronic
922754167 1:228085473-228085495 CTGTCACTCAGCCACCTACAGGG + Intronic
923573538 1:235138090-235138112 CTGCCACGCAAGCATTGAAAAGG - Exonic
923941074 1:238827876-238827898 ATGTCACTGAGCCACTGAGATGG - Intergenic
1062892514 10:1074728-1074750 CTGCTCCTCAACAACTGAAAGGG - Intronic
1066370886 10:34816852-34816874 CTTCCACTCAGCCATGGGAAAGG + Intergenic
1066482971 10:35815036-35815058 CTGCCACTCATCAACAGAAAGGG - Intergenic
1071455724 10:85850083-85850105 CCTCCACTGAGCCACTGAATCGG + Intronic
1072184786 10:93026419-93026441 CTACCACACAGCCACTGGAATGG - Intronic
1073495533 10:103887687-103887709 CTGCCACTCAGTCTGTGAATGGG - Intronic
1074228271 10:111508713-111508735 CTCACCTTCAGCCACTGAAATGG + Intergenic
1074628449 10:115220880-115220902 TTGCCACTCACTCACTGATAGGG + Intronic
1074912814 10:117927105-117927127 CTTCCCATGAGCCACTGAAAAGG - Intergenic
1075209853 10:120481758-120481780 CTGCCATTTAGCAACTGATACGG + Intronic
1075329085 10:121559659-121559681 CAGCAACTCTGCCCCTGAAATGG - Intronic
1076920641 10:133452567-133452589 ATGTCACTCAGCCATAGAAAGGG - Intergenic
1077110571 11:860381-860403 CTGCCAGCCAGCCAGTAAAAGGG + Intronic
1077899898 11:6479765-6479787 TTGCCACTTAGCCCCTGAAATGG - Intronic
1078589737 11:12629318-12629340 CTGCAAGTCATCCACTGAATTGG - Intergenic
1079141367 11:17812256-17812278 CTGCCTCTCAGCCCCTTAAGAGG + Intronic
1079365255 11:19803435-19803457 CTTCCACTTTCCCACTGAAATGG + Intronic
1080870812 11:36235436-36235458 CTGTCTCCCAACCACTGAAATGG + Intergenic
1081541703 11:44039309-44039331 CTACCACTCAGCCATAAAAAAGG + Intergenic
1083394433 11:62380216-62380238 CAGCCACTAAGCCATTAAAAGGG - Intronic
1083654670 11:64223717-64223739 CAGCCACTCAGACAAGGAAAGGG - Exonic
1083675543 11:64322922-64322944 CTGCCTCTCAGCCACCTACAGGG + Intergenic
1083689939 11:64401414-64401436 CTGACACTGAGCCCCTGATACGG + Intergenic
1085298426 11:75444178-75444200 CTGCCACAGAGCCACTTGAAGGG - Intronic
1087356132 11:97097114-97097136 CTGGCAAACAGCCACTGTAACGG + Intergenic
1087785095 11:102346011-102346033 CTGCCAGTCAGTCACAGAACAGG - Intergenic
1088563249 11:111137236-111137258 CTGCTACTCAGCAATTAAAAGGG - Intergenic
1092670203 12:10853658-10853680 CTGCACCTCAGGCACTGGAAAGG + Intronic
1093833465 12:23796012-23796034 CTGTCATTCAGCCACATAAAGGG + Intronic
1094771750 12:33670913-33670935 CTGGCAGGCAGCCTCTGAAATGG + Intergenic
1100016827 12:90021351-90021373 ATGCCTCTTAGCTACTGAAATGG + Intergenic
1100265854 12:92975171-92975193 CAGCCTGTCAGCCACTGGAAAGG - Intergenic
1102750864 12:115292780-115292802 CTAACAGTCAGCCACTGGAATGG + Intergenic
1103292603 12:119859332-119859354 CTGCTGCCCAGCCATTGAAATGG - Intronic
1103881261 12:124167556-124167578 CTGCTACTTAGCAACTGAATCGG + Intronic
1103953055 12:124562199-124562221 CTGCCACTGAGCAGCTGAACTGG - Intronic
1104069785 12:125334444-125334466 CAGCCACTTAACCGCTGAAAAGG - Intronic
1104852585 12:131884343-131884365 CCCCCACTCAGCCACGGCAAAGG + Intergenic
1104852597 12:131884397-131884419 CCCCCACTCAGCCACGGCAAAGG + Intergenic
1104852611 12:131884451-131884473 CCCCCACTCAGCCACGGGAAAGG + Intergenic
1104852621 12:131884479-131884501 CCCCCACTCAGCCACGGGAAAGG + Intergenic
1106871317 13:34025221-34025243 CTGCCCCACAGCCACTCCAATGG - Intergenic
1107638270 13:42415078-42415100 CTGTGGCTCAGCCACTGGAAAGG - Intergenic
1107965086 13:45590471-45590493 CTGCCACTCAGTCACTCACAGGG - Intronic
1108997139 13:56748273-56748295 GTGCCACACAGCCACTGCCAGGG + Intergenic
1109879048 13:68447150-68447172 TTTCCACACACCCACTGAAAGGG - Intergenic
1112000645 13:95206567-95206589 CTTCCCCTCAGCCATTGAGAGGG - Exonic
1114600577 14:23953118-23953140 CTACCACTTAGCCCCTGTAAAGG + Intergenic
1114604811 14:23988262-23988284 CTACCACTTAGCCCCTGTAAAGG + Intronic
1114610261 14:24035828-24035850 CTACCACTTAGCCCCTGTAAAGG + Intergenic
1116391558 14:44397428-44397450 CTACCATTCTGCTACTGAAATGG + Intergenic
1118002359 14:61535514-61535536 CTGCCATTGAGCTACTCAAATGG - Intronic
1118765154 14:68904590-68904612 CTGCCACTCAGCGGCTAAGAAGG - Intronic
1120371920 14:83646455-83646477 CTGCAACTGAGCAACTGACATGG - Intergenic
1121606906 14:95247225-95247247 CTGGCACTGAGCCACTGTGAAGG + Intronic
1122549703 14:102543392-102543414 CTCCCACCCAGCCACCGGAACGG - Intergenic
1125152726 15:36551650-36551672 CTGCCACTAAGGCTCTAAAAGGG + Intergenic
1126123274 15:45272371-45272393 CTGCCATACAGGCACTGATAAGG - Exonic
1126128386 15:45316522-45316544 ATACTATTCAGCCACTGAAAAGG - Intergenic
1126325550 15:47473237-47473259 CTTCCCCTCAGCCACTGCAGAGG + Intronic
1131110383 15:89761107-89761129 CTGTCACACAGGCACTGAACCGG - Intronic
1131461309 15:92619544-92619566 CACCCTCTCAGCCAGTGAAAAGG + Intronic
1133967220 16:10540112-10540134 CTGCCAGGCAGCCCCTGAGATGG + Intronic
1137026058 16:35476073-35476095 CTGACACTTTGCCACTAAAATGG - Intergenic
1137908309 16:52349344-52349366 ATACCACTCAGTCACAGAAAAGG + Intergenic
1138334429 16:56241363-56241385 ATGCCACTCAGTCACTGAGGAGG + Intronic
1140042958 16:71421620-71421642 CTGCCACTCACCCACAAAAAAGG - Intergenic
1144451610 17:15384620-15384642 CTGTCACTCAGCACCTGACAGGG - Intergenic
1144574531 17:16420491-16420513 TTTCCATTCAGCCACTGCAATGG - Intronic
1146178341 17:30680815-30680837 TTCCCACTCAGCCACTAGAAGGG - Intergenic
1146515960 17:33489502-33489524 CTGGCAATCATGCACTGAAAAGG - Intronic
1146835608 17:36108261-36108283 CTGCCCCTCAGCTAATGGAAAGG + Intergenic
1146850237 17:36215534-36215556 CTGCCCCTCAGCTAATGGAAAGG + Intronic
1147275319 17:39311434-39311456 CTGCCACTTAGAAACTGAAAAGG - Intronic
1148913281 17:50954774-50954796 CTGCCACTCAGCCCTTGCAGGGG + Intergenic
1149098683 17:52876392-52876414 CTGCTGCACAGCCACTGAGATGG + Intronic
1149554506 17:57563669-57563691 CAGACAGTCAGCCACTAAAATGG - Intronic
1150921833 17:69492225-69492247 CTACCACTCAGCCATAGGAATGG - Intronic
1151075590 17:71268676-71268698 CTGCCACACAGACACTGATGTGG + Intergenic
1151754511 17:76065575-76065597 CTGCTACTCAGGCAGTGAAAAGG - Intronic
1155067460 18:22280075-22280097 CTGCCACTCTGGCCCTGAAGGGG + Intergenic
1157879189 18:51304060-51304082 GTGCCACACAGCCACTGCCAGGG - Intergenic
1160709384 19:544115-544137 CTCCCACTCACCTACTGACAGGG - Exonic
1161056868 19:2195108-2195130 CTGCCACTCAGCCACTGAAAGGG - Intronic
1164096103 19:22011043-22011065 CTGTCACTCAGGGCCTGAAAGGG - Intergenic
1164115603 19:22215872-22215894 CTGTCACTCAGGGCCTGAAAGGG - Intergenic
1167280778 19:48567075-48567097 CTGGAATTCAGCCACTCAAAAGG - Intronic
926833161 2:16987422-16987444 CAGCATGTCAGCCACTGAAACGG - Intergenic
928243595 2:29607702-29607724 CTCCCTCTCAGCCACTGTACGGG + Intronic
930152933 2:48076918-48076940 CTGCCACACTGCCACTGTACTGG + Intergenic
930210960 2:48636033-48636055 CTGCCAAACAGCCACTGTGATGG - Intronic
931582894 2:63796509-63796531 GTGCCACACAGCCACTGCCAGGG - Intronic
931916299 2:66960524-66960546 CTTCCACTCACCCACAGGAAGGG + Intergenic
932638073 2:73410645-73410667 CTGTCATTCAGTCCCTGAAAGGG + Intronic
933970592 2:87466932-87466954 CTGCCACCCAGCCGCAGGAAAGG + Intergenic
935972782 2:108546569-108546591 ATGCCAATCAGCCAATGAACAGG - Intronic
936323137 2:111483250-111483272 CTGCCACCCAGCCGCAGGAAAGG - Intergenic
937628235 2:124068237-124068259 GTGCCACACAGCCACTGCCAGGG - Intronic
938314295 2:130315435-130315457 CTGCCTCTCAGCCCCTGAGCAGG - Intergenic
939038975 2:137165177-137165199 CAGCCATTCAGCCACAGAATGGG - Intronic
940159230 2:150693604-150693626 CTGGCTCTCAGCCCCGGAAAAGG - Intergenic
941018273 2:160381597-160381619 CTTCCACTCAGCTCCTGAAGAGG - Intronic
941897496 2:170644020-170644042 CTGCAACTCAGCAAGTCAAATGG + Intronic
942967979 2:181920588-181920610 CTGCCACACATTCCCTGAAAAGG - Exonic
944973218 2:205017792-205017814 CTGCCAGTCACCCAGTGACAAGG - Intronic
945258256 2:207820404-207820426 CTGACCCTCACCCACTCAAAAGG - Intergenic
947955013 2:234181871-234181893 CTACAACTCAGCCAATAAAAAGG - Intergenic
948099847 2:235365048-235365070 TTGCCACTCAGTGACTGAGAAGG + Intergenic
1169199808 20:3703438-3703460 CTGGACCTCAGCCACTGCAAGGG + Exonic
1170096272 20:12649079-12649101 ATACTACTCAGCCACTAAAAGGG - Intergenic
1176289097 21:5034837-5034859 CTGCCAGTCACCCACAGGAAGGG + Intronic
1177361523 21:20078551-20078573 CTGGCACTCATCAACAGAAAGGG + Intergenic
1179728713 21:43355286-43355308 CTGCCACTCAGCCGCGGGAAAGG + Intergenic
1179868138 21:44228767-44228789 CTGCCAGTCACCCACAGGAAGGG - Intronic
1182333378 22:29567202-29567224 CAGCATCTCAGCCACTCAAAGGG - Intronic
1182622210 22:31624298-31624320 CTGCCACACAGGCACTGGCACGG + Intronic
1183454835 22:37916983-37917005 CAGCCACTCAGCCACTCGGAAGG - Intronic
1183650392 22:39150295-39150317 CAGCCACTCACAGACTGAAAGGG - Intronic
1183700730 22:39449545-39449567 CTGGCACTCAGCCATTGAGTGGG + Intergenic
1184249342 22:43251284-43251306 CTGGGGCTCAGCCAGTGAAAAGG + Intronic
1184358255 22:43996811-43996833 TTGCCACTCACACACTCAAATGG - Intronic
1184864831 22:47196297-47196319 CTTCCACCCAGACACTGAGAGGG - Intergenic
952830601 3:37561663-37561685 TTGCCATTCAGCTACTGACAAGG + Intronic
953886304 3:46716098-46716120 CTCTCACTGAGCCACAGAAAGGG - Intronic
956521130 3:70105499-70105521 ATGCCACTCAAATACTGAAACGG - Intergenic
956578793 3:70785754-70785776 ATGCCACTCAGCAATGGAAAGGG - Intergenic
958958638 3:100488287-100488309 ATGCCACTCAGCCAGTGGCATGG - Intergenic
961402255 3:126655588-126655610 CTTCCACTCATCCACCGAAATGG - Intergenic
964169257 3:153749359-153749381 CTGGCAGTCAGCCATTTAAAGGG - Intergenic
966546301 3:181152882-181152904 ATGCTACTCAGCCAATAAAAAGG + Intergenic
968933167 4:3594987-3595009 CTGACACACAGCCAGGGAAAAGG - Intergenic
968940358 4:3634444-3634466 TTGCATCTCAGCCACTGGAAAGG - Intergenic
970044429 4:11835055-11835077 CTGACACAGAGCCACTGGAATGG + Intergenic
970683465 4:18537431-18537453 GTGCCACTCAGTCACTGAAATGG - Intergenic
976279068 4:83308724-83308746 TTGGGGCTCAGCCACTGAAATGG + Intronic
979793020 4:124809933-124809955 CTTCCACTTTCCCACTGAAATGG + Intergenic
981219336 4:142213310-142213332 CTGACAATGAGCCACTGAGATGG - Intronic
982361005 4:154519050-154519072 CAGGCATTCAGCCACTGAACTGG - Intergenic
984092639 4:175393047-175393069 ATGCCACTCAGCAATAGAAAAGG + Intergenic
984498755 4:180532214-180532236 ATGCCACATTGCCACTGAAATGG + Intergenic
987527838 5:19076765-19076787 ATACCACTCAGCCACAAAAAAGG + Intergenic
987602611 5:20091238-20091260 CTGGGACTCAGCCTCTCAAAGGG - Intronic
989987977 5:50725036-50725058 ATACTACTCAGCCACTAAAAAGG - Intronic
990246424 5:53867765-53867787 CTGCCACTTAACCACTCACATGG - Intergenic
990368312 5:55092182-55092204 CTGCCATTCACCTGCTGAAAGGG - Intergenic
990481074 5:56211287-56211309 CTGTTACTCAGGCATTGAAACGG - Intronic
990652832 5:57922013-57922035 CTGATTCTCAGCCACAGAAAGGG + Intergenic
994176970 5:96721495-96721517 CTGTGACTCAGCCTCTGAAGTGG + Intronic
996702110 5:126460683-126460705 CAGCCACGGAGCCACTGAATAGG + Intronic
997844764 5:137276464-137276486 CTGCAACTCAGCCACACAGACGG + Intronic
999336146 5:150718695-150718717 CTGCCACTTAAGGACTGAAAAGG + Intronic
1000104468 5:158045721-158045743 CTGCCAGCCAGCCAAGGAAAAGG - Intergenic
1004317404 6:14601718-14601740 CTGCCACAGAGTCAATGAAAAGG - Intergenic
1005096806 6:22125303-22125325 GTGCCACTCAGCCTTTGCAATGG - Intergenic
1006608993 6:35281257-35281279 CTGTCCCTCAGCCTCTGGAAAGG + Intronic
1007567131 6:42860283-42860305 TTGCCACTCAGCTCCTAAAAAGG + Exonic
1008648330 6:53539008-53539030 CTGCCACTAAGTAGCTGAAAAGG + Intronic
1015793853 6:136990724-136990746 CTTCAACCCAGCCACAGAAAAGG - Intergenic
1016906880 6:149159500-149159522 CTGCCACACAGCATCTCAAAAGG - Intergenic
1017033331 6:150243822-150243844 ATGCTACTCAGCAACAGAAAAGG + Intronic
1019785250 7:2972765-2972787 GTGCTACTCAGCCAATAAAAGGG - Intronic
1020855774 7:13420837-13420859 CTGGTATGCAGCCACTGAAAGGG - Intergenic
1021936400 7:25636362-25636384 AAGCCACTCAGCCACAGAACAGG + Intergenic
1022471555 7:30684594-30684616 CTTTGACTCTGCCACTGAAATGG - Intronic
1023759871 7:43455348-43455370 CTTCCATTCACCCACTCAAAAGG + Intronic
1024995288 7:55269521-55269543 GTGCCAAGCAGCCACTGACATGG + Intergenic
1028288280 7:89031989-89032011 TTGCCTCTAAGCCACTGAACAGG - Intronic
1028667117 7:93359157-93359179 ATGCTACTCAGGCATTGAAAAGG - Intronic
1036411609 8:8506756-8506778 TTCACACTCTGCCACTGAAATGG - Intergenic
1036620469 8:10421847-10421869 CTGCTGCTCAGCCATAGAAATGG + Intronic
1038147239 8:24909759-24909781 CTGTCATTAGGCCACTGAAATGG - Intergenic
1039023393 8:33231617-33231639 CTCCCACTCAGCCCCTGATCAGG + Intergenic
1039690421 8:39858818-39858840 GTGCAACTCAGCCCCAGAAAGGG + Intergenic
1039762596 8:40593619-40593641 CTGCCACCTGGCCAATGAAAGGG + Intronic
1044395913 8:91712071-91712093 CTGCCACCCACACACTGGAATGG + Intergenic
1045651018 8:104341737-104341759 CTTCCACTCAGCCACAAAAAGGG + Intronic
1046299299 8:112265806-112265828 CTGTCACTTAGCCCCTGAAAAGG + Intronic
1048510433 8:135056993-135057015 CTGCCACTCTCCCACTACAAGGG - Intergenic
1049929802 9:445368-445390 GGGACACTCACCCACTGAAAGGG - Intronic
1050839868 9:10134867-10134889 CAGCAGCTCAACCACTGAAATGG + Intronic
1051246268 9:15115153-15115175 CTGCATCTCAGCCACTGGGAAGG - Intergenic
1054456962 9:65436785-65436807 CTGACACACAGCCAGGGAAAAGG + Intergenic
1054874386 9:70079857-70079879 CTCCCACTCAGCCAGATAAAGGG - Intronic
1059147256 9:111911258-111911280 CTAGCACTCAGTCACTGAAGAGG + Intronic
1060004694 9:119989565-119989587 CAGCCACTCTGCCTCTAAAAAGG + Intergenic
1060678789 9:125542880-125542902 CTGCCCCTCGGCCTCAGAAAGGG - Intronic
1060870129 9:127033314-127033336 CTGACAATCAGCCACAGACAGGG - Intronic
1061633674 9:131891134-131891156 ATGGCATTCAGCCACTGTAAAGG + Intronic
1062482766 9:136760041-136760063 CTGCCACTCAGCCAGGGACTGGG - Intronic
1185937537 X:4275708-4275730 CTGGCACTCAGACTCTGGAAAGG - Intergenic
1186515711 X:10164962-10164984 CTGCCACTGAGTCTCTGAATTGG + Intronic
1188089995 X:25952817-25952839 CTTCTACTCAGGCACTGAGAGGG + Intergenic
1190488211 X:50952519-50952541 CTGCCACTGAGCCAGGGAAAGGG - Intergenic
1192538825 X:71950781-71950803 CTGACACCCACCCACAGAAATGG - Intergenic
1194872260 X:99146907-99146929 CTGCAGCTCTGCCACTGAATAGG - Intergenic
1197971903 X:132123131-132123153 CTCCTACTCAGCAACTTAAATGG + Intronic
1198483872 X:137066843-137066865 CTACTACACAACCACTGAAATGG + Intergenic
1200426011 Y:3021022-3021044 TAGCAACTCAGCCACTGCAAGGG - Intergenic