ID: 1161059430

View in Genome Browser
Species Human (GRCh38)
Location 19:2207688-2207710
Sequence TCTCGCTGCGCCTCAGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161059425_1161059430 23 Left 1161059425 19:2207642-2207664 CCAGTCTCCTACTACCTGCACAC 0: 1
1: 0
2: 1
3: 9
4: 202
Right 1161059430 19:2207688-2207710 TCTCGCTGCGCCTCAGCCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 104
1161059426_1161059430 16 Left 1161059426 19:2207649-2207671 CCTACTACCTGCACACTATCGAC 0: 1
1: 0
2: 0
3: 4
4: 34
Right 1161059430 19:2207688-2207710 TCTCGCTGCGCCTCAGCCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 104
1161059427_1161059430 9 Left 1161059427 19:2207656-2207678 CCTGCACACTATCGACCGCACCA 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1161059430 19:2207688-2207710 TCTCGCTGCGCCTCAGCCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 104
1161059428_1161059430 -6 Left 1161059428 19:2207671-2207693 CCGCACCATAGTGAGTATCTCGC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1161059430 19:2207688-2207710 TCTCGCTGCGCCTCAGCCGCAGG 0: 1
1: 0
2: 0
3: 11
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161059430 Original CRISPR TCTCGCTGCGCCTCAGCCGC AGG Intronic
900112293 1:1013495-1013517 GTTCGCTGCCTCTCAGCCGCCGG - Exonic
904053770 1:27656872-27656894 TCTCTCTGGGCCTCAGCTCCAGG + Intergenic
904471157 1:30737252-30737274 TCTCTCTGGGCCTCAGGGGCAGG - Intronic
921023524 1:211258428-211258450 TCTCGCTTCACCTCTGCCGGGGG + Intronic
922917579 1:229271176-229271198 TCCGGCTGGGCCGCAGCCGCTGG + Exonic
923942585 1:238844394-238844416 TCTCCCTGGGCCTGAGCCCCTGG - Intergenic
1063450153 10:6145452-6145474 TCCCGCTGCGCTCCAGCCCCGGG + Intronic
1066180678 10:32958203-32958225 TCCCGCTGGGCCTCTCCCGCGGG + Intronic
1066489652 10:35882596-35882618 TCTCCCTGCCCCTCAGGCACAGG - Intergenic
1068955181 10:62815000-62815022 TCCCGCTGCGCTTCAGCCGAGGG + Intronic
1070407188 10:76107381-76107403 TCTCTCTGCATCTAAGCCGCTGG - Intronic
1071532353 10:86400197-86400219 TCCCGCAGGGCCGCAGCCGCGGG - Intergenic
1072578503 10:96720671-96720693 TCTCGCTGCCCCTGAGCAGGGGG - Intergenic
1074416356 10:113270331-113270353 TCTCCCTTCCCCTCAGCCACTGG - Intergenic
1077311159 11:1889659-1889681 ACTCGCTCGGCCTCAGCGGCGGG + Exonic
1079162001 11:18003796-18003818 TCTCCCTTCCCCTCAGCCCCTGG - Intronic
1084516773 11:69641849-69641871 CCCGGCTGCGCCTCAGCGGCCGG + Intronic
1084700690 11:70784719-70784741 TCTCCCTGGACCTCAGCCACAGG - Intronic
1091656205 12:2348472-2348494 TCTCGCTGAGCCACAGCACCTGG + Intronic
1093710649 12:22326513-22326535 TCTTGCTGAGCCTTAGCCGCAGG - Intronic
1094025809 12:25958860-25958882 TCCCGCGGCGTCTCTGCCGCTGG + Intergenic
1094125032 12:27014421-27014443 TCTCGCTGCGTCACAGCGGCGGG + Intronic
1097226068 12:57477461-57477483 TCTCGCTGCGACTGCGGCGCGGG + Exonic
1100390123 12:94140594-94140616 CCTTGCAGCCCCTCAGCCGCCGG - Intergenic
1103629844 12:122251162-122251184 TGTCGCTGCACCCCAGCCCCAGG - Intronic
1104112485 12:125716934-125716956 TCTGCCTGCGCCCCAGCCACAGG - Intergenic
1107993119 13:45835795-45835817 TCTCACTGCTCCTCAGGCTCTGG + Intronic
1114139681 14:19895483-19895505 TCTCGCTGCTCCTCAGTACCTGG + Intergenic
1114803513 14:25806638-25806660 TCTCCATGCGCCTCAGATGCTGG + Intergenic
1115657585 14:35458924-35458946 TCTCCCTGGGCCTGAGCCTCTGG + Intergenic
1115928807 14:38467627-38467649 TCTCCCTGGGCCTGAGCCTCTGG - Intergenic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1119649790 14:76375633-76375655 TCTTGCTGTGCCTCACCTGCTGG + Intronic
1126436984 15:48646216-48646238 GCTCCCTGCGCCTCTCCCGCCGG + Intergenic
1127394921 15:58537060-58537082 TGTGTCTGCTCCTCAGCCGCAGG + Intronic
1130991311 15:88877593-88877615 TCTCCCTGCCCCTCAGCCTGGGG - Exonic
1132630835 16:916574-916596 TCTCGCTGCGCGCCAGTGGCGGG + Intronic
1133034670 16:3028148-3028170 TCTCGCTGCGCCTGGGCCCCGGG - Exonic
1136414859 16:30096615-30096637 CCTCCCTGGGCCTCAGCCCCCGG - Intronic
1138273467 16:55712943-55712965 TCTCCCTGAGCCTCAGCCTTAGG + Intergenic
1142300898 16:89257293-89257315 TCTCGCGGCGCCTGAGGCCCCGG + Intergenic
1142558440 17:795434-795456 TCTCCCCTCGCCCCAGCCGCTGG + Intergenic
1143139175 17:4731293-4731315 GCCCGCTGCGCCTCAGCCACAGG - Intergenic
1144497526 17:15757894-15757916 CCTCGCTGGGCCTCAGGTGCAGG - Intergenic
1144652106 17:17013737-17013759 CCTCGCTGGGCCTCAGGTGCAGG + Intergenic
1145160890 17:20572944-20572966 CCTCGCTGGGCCTCAGGTGCAGG - Intergenic
1145981488 17:29014871-29014893 TCTCTCTCCACCTCAGCTGCTGG - Intronic
1146893933 17:36527550-36527572 CCATGCTGCGCCTCAGCCCCAGG - Exonic
1147571890 17:41576526-41576548 TCTCGCTGGGTCTCAGGTGCCGG - Intergenic
1149640080 17:58197099-58197121 TCTCGCTGCGGCTCCGCAACCGG + Exonic
1149685456 17:58532094-58532116 ACTCGCTCCGCCCCCGCCGCCGG - Intronic
1155936585 18:31760921-31760943 TCACGCTGCGCCCCCGCCCCGGG - Intergenic
1158763536 18:60419792-60419814 TCTCTCTTCGACTCAGCCCCTGG - Intergenic
1158844306 18:61425449-61425471 TCTCACTGCCCCTCAGACGGTGG + Intronic
1161059430 19:2207688-2207710 TCTCGCTGCGCCTCAGCCGCAGG + Intronic
1161686826 19:5707032-5707054 AGTGGCTGCGCCTCAGCCGCGGG + Intronic
1162021503 19:7870369-7870391 TCTCGCTGCGCCTCCTCTGCAGG - Exonic
1163593142 19:18205294-18205316 TCTCTCGGCGCCTCCGCAGCTGG - Intergenic
1167323023 19:48807802-48807824 TGTAGCTGCCCCTCAGCCCCAGG - Intronic
1168584108 19:57578787-57578809 CCCCGCTGCGCATCAGCCGGTGG - Exonic
927918219 2:26950129-26950151 TGTGCCTGCGCCTCAGCAGCTGG - Exonic
927943206 2:27118697-27118719 TCCCGCCGCGTCTGAGCCGCAGG + Intronic
929242375 2:39665948-39665970 TCCCGCCCCGCCGCAGCCGCCGG - Exonic
934747260 2:96767550-96767572 TCTAGCTGTGCCTCACCCTCTGG + Intronic
937044728 2:118845208-118845230 TCTCGCCGCCCCACAGCTGCCGG - Intronic
946313003 2:218893166-218893188 GCTCGCTGCGCGTCTGGCGCAGG - Exonic
948707693 2:239805187-239805209 TCCCACTGCGCATCAGCCTCAGG - Intergenic
1179775569 21:43659703-43659725 TCTCGCTGGACGCCAGCCGCTGG - Exonic
1181538303 22:23558597-23558619 GCTCACTGCACCTCAGCCTCTGG - Intergenic
1184086764 22:42270306-42270328 TCTCCCTGCCCCTCAGGCCCGGG + Intronic
1185310618 22:50152299-50152321 ACTCGCTGCGTCTGTGCCGCGGG - Intronic
950448890 3:13054665-13054687 CTTCTCTGCGCCTCAGCCTCAGG - Intronic
950473767 3:13203279-13203301 CCTTGCTACGCCTCAGCTGCAGG - Intergenic
951217759 3:20040595-20040617 TCCCCCTGCGCCGCTGCCGCCGG + Exonic
953792689 3:45960286-45960308 TCTAGCAGCACCTCAGCCACCGG + Intronic
957584307 3:82114525-82114547 TCTCCCTGGGCCTGAGCCCCTGG - Intergenic
961446094 3:126982570-126982592 TCTCGCCACGCCTCTGCCGCGGG + Intergenic
961770993 3:129249824-129249846 CCTCACTGGGCCTCAGCCTCCGG - Intronic
964010692 3:151887952-151887974 TCTCACTCAGCCTCAGCCCCAGG - Intergenic
964011565 3:151898419-151898441 TCTCACTCAGCCTCAGCCCCAGG + Intergenic
968235796 3:197029539-197029561 TCTCACTGCCCCGGAGCCGCAGG + Intronic
968899067 4:3422360-3422382 TCTCGCTGCTCCCCAGTCGGAGG + Exonic
968899177 4:3422889-3422911 TCTCTCTGTTCCTCAGCCTCTGG + Exonic
981027769 4:140093985-140094007 TCTGGCTCAGCCTCAGCTGCTGG - Intronic
985272559 4:188207879-188207901 TCTCGCTCTGCCTCAGCCTCCGG - Intergenic
986140685 5:5026726-5026748 TCTCTCTGGGCCTGAGCCTCTGG + Intergenic
992098176 5:73381593-73381615 TCCCGCGGCGCCTCAGCCTCCGG + Intergenic
993807939 5:92436301-92436323 TCTCCCTGGGCCTAAGCCCCTGG + Intergenic
995264140 5:110138725-110138747 TCTCCCTGGGCCTGAGCCACAGG - Intergenic
996743198 5:126821046-126821068 TCTCATTCCGCCTCAGCCACTGG + Exonic
1006047401 6:31308874-31308896 TCTCGCGGCGCCTCCGTCCCGGG - Intronic
1013330306 6:109094562-109094584 CCTCCCAGCGCCTCAGCAGCCGG + Exonic
1013998547 6:116338613-116338635 TCTCTCTGCGCCTAAGCCAAAGG - Intronic
1017564150 6:155666293-155666315 TCTCCCTGCAGCTCTGCCGCAGG - Intergenic
1028567162 7:92246082-92246104 TCCGGCTCCGGCTCAGCCGCTGG - Exonic
1030701539 7:112646744-112646766 TCTCCCTGGGCCTAAGCCCCTGG - Intergenic
1034254588 7:149717619-149717641 TCTCACTGCCCATCAGCCTCTGG + Intronic
1035047802 7:155980782-155980804 TGTCGCTGCCCTTCAGCAGCAGG - Intergenic
1036726003 8:11221690-11221712 TCTCTCTGCCCCTCACCCCCAGG + Intergenic
1037315787 8:17598187-17598209 TCTAGCTGTGCCTCAGCCTCTGG - Intronic
1048945588 8:139444082-139444104 TCACTCTCCTCCTCAGCCGCAGG - Intergenic
1049385960 8:142343127-142343149 TCTGCCTGAGCCTCAGCCTCAGG + Intronic
1053409103 9:37904137-37904159 TCGCGCTGCGCCCCAACCTCGGG - Intronic
1054775792 9:69122328-69122350 GCCCGCTGAGCCTCCGCCGCGGG + Intronic
1057470162 9:95349807-95349829 TCTGGCTGAGACTCTGCCGCCGG + Intergenic
1060731307 9:126038734-126038756 TCTCTCTGACTCTCAGCCGCTGG - Intergenic
1187939796 X:24370607-24370629 TCTCTTTGTGCCTCAGCTGCCGG + Intergenic
1189485895 X:41431456-41431478 TCTCTCTCCACCTCAGCCCCAGG + Intergenic
1192951959 X:76026609-76026631 TCTCCCTGGGCCTGAGCCCCTGG + Intergenic
1193780766 X:85698834-85698856 TCTCCCTGGGCCTGAGCCCCTGG - Intergenic
1194241890 X:91459651-91459673 TCTGGCTGAGCCTGAGCCTCTGG - Intergenic
1197049529 X:122042334-122042356 TCTCCCTGGGCCTGAGCCCCTGG - Intergenic
1198859839 X:141057281-141057303 TCTAGCTGTGTCTCAGTCGCCGG - Intergenic
1198902854 X:141530109-141530131 TCTAGCTGTGTCTCAGTCGCCGG + Intergenic
1202379069 Y:24260678-24260700 CCTCTCTGAGCCTCAGCTGCTGG - Intergenic
1202491713 Y:25409443-25409465 CCTCTCTGAGCCTCAGCTGCTGG + Intergenic