ID: 1161062069

View in Genome Browser
Species Human (GRCh38)
Location 19:2220171-2220193
Sequence GGTGCTAATGCCCACGGTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 73}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161062057_1161062069 30 Left 1161062057 19:2220118-2220140 CCAGTCCCGTGCTGCAGCCCCGT 0: 1
1: 0
2: 2
3: 13
4: 175
Right 1161062069 19:2220171-2220193 GGTGCTAATGCCCACGGTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 73
1161062058_1161062069 25 Left 1161062058 19:2220123-2220145 CCCGTGCTGCAGCCCCGTGACCC 0: 1
1: 0
2: 5
3: 14
4: 208
Right 1161062069 19:2220171-2220193 GGTGCTAATGCCCACGGTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 73
1161062064_1161062069 4 Left 1161062064 19:2220144-2220166 CCCTCGTCCACACTTGAAAAGCA 0: 1
1: 0
2: 0
3: 10
4: 119
Right 1161062069 19:2220171-2220193 GGTGCTAATGCCCACGGTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 73
1161062061_1161062069 12 Left 1161062061 19:2220136-2220158 CCCGTGACCCCTCGTCCACACTT 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1161062069 19:2220171-2220193 GGTGCTAATGCCCACGGTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 73
1161062065_1161062069 3 Left 1161062065 19:2220145-2220167 CCTCGTCCACACTTGAAAAGCAG 0: 1
1: 0
2: 0
3: 11
4: 121
Right 1161062069 19:2220171-2220193 GGTGCTAATGCCCACGGTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 73
1161062059_1161062069 24 Left 1161062059 19:2220124-2220146 CCGTGCTGCAGCCCCGTGACCCC 0: 1
1: 0
2: 3
3: 28
4: 278
Right 1161062069 19:2220171-2220193 GGTGCTAATGCCCACGGTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 73
1161062062_1161062069 11 Left 1161062062 19:2220137-2220159 CCGTGACCCCTCGTCCACACTTG 0: 1
1: 0
2: 0
3: 5
4: 117
Right 1161062069 19:2220171-2220193 GGTGCTAATGCCCACGGTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 73
1161062060_1161062069 13 Left 1161062060 19:2220135-2220157 CCCCGTGACCCCTCGTCCACACT 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1161062069 19:2220171-2220193 GGTGCTAATGCCCACGGTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 73
1161062063_1161062069 5 Left 1161062063 19:2220143-2220165 CCCCTCGTCCACACTTGAAAAGC 0: 1
1: 0
2: 1
3: 6
4: 79
Right 1161062069 19:2220171-2220193 GGTGCTAATGCCCACGGTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 73
1161062067_1161062069 -3 Left 1161062067 19:2220151-2220173 CCACACTTGAAAAGCAGATTGGT 0: 1
1: 0
2: 1
3: 12
4: 177
Right 1161062069 19:2220171-2220193 GGTGCTAATGCCCACGGTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161062069 Original CRISPR GGTGCTAATGCCCACGGTGC TGG Exonic
902333209 1:15741028-15741050 TGTGCAAATGCCCACAGGGCGGG - Exonic
915261002 1:154676808-154676830 GGAGTTATTGCCCACGGTGCAGG + Intergenic
920953192 1:210592912-210592934 GGTGCATATGCACAAGGTGCAGG + Intronic
1064113695 10:12559871-12559893 GGTGCCAAAGCCCAGGATGCTGG + Intronic
1064591668 10:16898679-16898701 GGTCTTAATGCCCAAGGTGAAGG + Intronic
1069698385 10:70404457-70404479 GTCGCTGATGGCCACGGTGCGGG - Exonic
1079465557 11:20726420-20726442 GGTGCTAGTGACTAGGGTGCTGG - Intronic
1084935818 11:72586112-72586134 GGTGCTGGTGAGCACGGTGCTGG + Exonic
1090167894 11:124570784-124570806 GGTGCTGATGCCGAGGATGCTGG - Exonic
1090336954 11:125975598-125975620 GGTACTGATGCCCATGGTCCTGG - Intronic
1090503313 11:127283132-127283154 GGTGCCAAAGCCCAGGGGGCAGG + Intergenic
1091029784 11:132175368-132175390 GGTGCTAATGCTTATGGAGCTGG - Intronic
1091602739 12:1927915-1927937 GGTGCTCATGCCCACCCTCCTGG - Intergenic
1092289549 12:7150993-7151015 GGGGCTGGTGACCACGGTGCAGG - Exonic
1098700001 12:73611793-73611815 GGTGCATATGCACAAGGTGCAGG - Intergenic
1106914665 13:34499697-34499719 GGGGCTAATTCCTACTGTGCAGG - Intergenic
1108775669 13:53762058-53762080 GCTGCTAATGGCCAGTGTGCTGG - Intergenic
1113026249 13:105944519-105944541 TGTGCTACTACCCATGGTGCTGG + Intergenic
1113412695 13:110104574-110104596 GTTGCTAATTCACAAGGTGCAGG + Intergenic
1114409552 14:22487842-22487864 GGTTCTAATGAGCAGGGTGCAGG + Intergenic
1130223691 15:82043126-82043148 GCTGCTAGTGCGCACCGTGCTGG - Exonic
1133055236 16:3142495-3142517 GGTGGTAGTGCCGACGGAGCTGG - Exonic
1133153825 16:3857699-3857721 GGTGCAAATGCTCTGGGTGCAGG - Intronic
1134065549 16:11225847-11225869 GCTGCTCATGCCCACCTTGCGGG + Intergenic
1135983713 16:27168396-27168418 GGTGGTAGTGCCCAGGGTGATGG + Intergenic
1148090853 17:45021831-45021853 GGTGCTAAGGCCCAAAGTGAGGG + Intergenic
1155183387 18:23367421-23367443 GCTGCTAAAGCCCACTGTGGGGG - Intronic
1156376505 18:36519582-36519604 GGTGCTCCTGCACACAGTGCTGG - Intronic
1160522879 18:79518845-79518867 GCGGCCAGTGCCCACGGTGCAGG + Intronic
1161062069 19:2220171-2220193 GGTGCTAATGCCCACGGTGCTGG + Exonic
1162475884 19:10899131-10899153 GCTGCTAAAGCCCGCGGAGCCGG - Intronic
1165060734 19:33204172-33204194 GGTGAGACTGCCCACGGGGCTGG - Intronic
1165764751 19:38343615-38343637 GGGGCTAAAGCCCCTGGTGCTGG + Exonic
1167049533 19:47069939-47069961 GGTGCCAGTGCCCACGCTGCAGG - Intronic
1167394301 19:49217739-49217761 GATGCTGCTGGCCACGGTGCAGG + Intergenic
1167524995 19:49978091-49978113 GGTGCTGCTGACCACGGGGCCGG + Intronic
926415178 2:12642723-12642745 GGTGAGAATGCCCACTTTGCTGG + Intergenic
927217125 2:20674109-20674131 GGTGCTACTACCAACTGTGCTGG - Intergenic
930046785 2:47179572-47179594 TGTGCTAATGACCAAGGTGAAGG + Intergenic
933647143 2:84822015-84822037 GGTGGGAATGCCCACGGCGAGGG + Exonic
934953107 2:98592785-98592807 GGGGCCGATGTCCACGGTGCTGG - Intronic
936521178 2:113212940-113212962 GGGGCTAAGGCCCACGGTGGAGG - Intergenic
939146277 2:138418978-138419000 GGTGCTAGTGCCTAGGGTGCTGG + Intergenic
946622383 2:221573358-221573380 GGTGCCAGTGCCCCCGGGGCCGG - Intronic
946710740 2:222502766-222502788 GTTGCTAAAGCCAACAGTGCTGG + Intronic
947298675 2:228663832-228663854 AGAGCTAATGCCCAATGTGCTGG + Intergenic
1173566353 20:44041156-44041178 GGTGCTAAAGGCCACCCTGCTGG - Intronic
1174895986 20:54450394-54450416 GTTCCTAAGGCCCAGGGTGCTGG - Intergenic
1183220944 22:36512637-36512659 GCTCCAAATGCCCAAGGTGCTGG + Intronic
954314302 3:49792866-49792888 GGTGCTGGTGGCCACTGTGCTGG + Exonic
954400340 3:50316330-50316352 GGTGCTCATGGCCATGGTGGGGG - Intergenic
961350334 3:126296577-126296599 GGTGCTAATCCCTAGGCTGCAGG - Intergenic
963840301 3:150097938-150097960 GGTGCTAATGCCATTGGTGAGGG - Intergenic
970464360 4:16307968-16307990 GGAACTCATGCCCACGGTGTGGG + Intergenic
978579150 4:110215493-110215515 GGTTCATATGCCCACTGTGCAGG + Intergenic
978761349 4:112358361-112358383 GGTGCTACAGCCCAGGGGGCCGG - Intronic
988680380 5:33479356-33479378 GGGGCAAATGCCCAAAGTGCAGG - Intergenic
993851506 5:93015657-93015679 AGTTCTAATGCCTAGGGTGCTGG - Intergenic
996397471 5:123027477-123027499 GGTGCCCGTGCCCTCGGTGCTGG - Intronic
999256339 5:150211767-150211789 GGTGCTTCTTCCCACGGGGCAGG + Intronic
1001682591 5:173569817-173569839 GGATCTGAGGCCCACGGTGCTGG - Intergenic
1004835261 6:19523696-19523718 GGCACTAATGCCCTGGGTGCTGG + Intergenic
1009407307 6:63327926-63327948 GGAGTTACTGCACACGGTGCAGG - Intergenic
1018501070 6:164411601-164411623 GGTGCTCCTGCCCACGCTGGGGG - Intergenic
1019706780 7:2500537-2500559 GGTGATAGTGACCAGGGTGCAGG - Intergenic
1019925502 7:4189481-4189503 GGGGCTAAAGGCCACAGTGCTGG - Intronic
1033683581 7:143620175-143620197 GATGCTTATGGCCATGGTGCGGG - Intergenic
1033701032 7:143837463-143837485 GATGCTTATGGCCATGGTGCGGG + Intergenic
1034269693 7:149797582-149797604 GGAGCTTATGCCCACGGGGCAGG + Intergenic
1039249174 8:35642950-35642972 AGTGTTAATGCCCACGGAGCAGG + Intronic
1039609540 8:38908309-38908331 GGTGCTAAAGCCCTCTGGGCAGG + Intronic
1041527429 8:58822922-58822944 GGGGCTAATTCCTACTGTGCAGG + Intronic
1047778454 8:128092461-128092483 GGGGCCAATGGCCAGGGTGCCGG - Intergenic
1047807306 8:128373837-128373859 GGTGCTAATGCTGCTGGTGCTGG + Intergenic
1053061538 9:35036020-35036042 AGGGATAATGCCCACGGTCCTGG - Intergenic
1059393885 9:114018267-114018289 GGTGCTGATGCCCAGGCAGCAGG + Intronic
1061719190 9:132541281-132541303 GGTGCCAACGCCCACTGAGCAGG - Intronic
1189919777 X:45892075-45892097 GGAGCTAAGGCCTACGGTTCTGG - Intergenic
1192988891 X:76428826-76428848 GGTGCTCAGGCCCTCGGTGGCGG - Exonic
1200809077 Y:7463527-7463549 GGTGCTAATGCTCACTATGTGGG + Intergenic