ID: 1161063537

View in Genome Browser
Species Human (GRCh38)
Location 19:2226904-2226926
Sequence GGAAGGGGCCCAGGAAGGAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 701
Summary {0: 1, 1: 1, 2: 7, 3: 67, 4: 625}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161063537_1161063554 29 Left 1161063537 19:2226904-2226926 CCGGTCCTTCCTGGGCCCCTTCC 0: 1
1: 1
2: 7
3: 67
4: 625
Right 1161063554 19:2226956-2226978 ATGTCCCTGCAGGCCAACCTCGG 0: 1
1: 0
2: 2
3: 161
4: 4307
1161063537_1161063548 2 Left 1161063537 19:2226904-2226926 CCGGTCCTTCCTGGGCCCCTTCC 0: 1
1: 1
2: 7
3: 67
4: 625
Right 1161063548 19:2226929-2226951 CCGGGACCGCAGTTCGCGCTCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1161063537_1161063550 19 Left 1161063537 19:2226904-2226926 CCGGTCCTTCCTGGGCCCCTTCC 0: 1
1: 1
2: 7
3: 67
4: 625
Right 1161063550 19:2226946-2226968 GCTCGGCCCCATGTCCCTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161063537 Original CRISPR GGAAGGGGCCCAGGAAGGAC CGG (reversed) Exonic