ID: 1161063541

View in Genome Browser
Species Human (GRCh38)
Location 19:2226913-2226935
Sequence GTCCCGGCGGGAAGGGGCCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 272}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161063541_1161063550 10 Left 1161063541 19:2226913-2226935 CCTGGGCCCCTTCCCGCCGGGAC 0: 1
1: 1
2: 1
3: 26
4: 272
Right 1161063550 19:2226946-2226968 GCTCGGCCCCATGTCCCTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 201
1161063541_1161063554 20 Left 1161063541 19:2226913-2226935 CCTGGGCCCCTTCCCGCCGGGAC 0: 1
1: 1
2: 1
3: 26
4: 272
Right 1161063554 19:2226956-2226978 ATGTCCCTGCAGGCCAACCTCGG 0: 1
1: 0
2: 2
3: 161
4: 4307
1161063541_1161063548 -7 Left 1161063541 19:2226913-2226935 CCTGGGCCCCTTCCCGCCGGGAC 0: 1
1: 1
2: 1
3: 26
4: 272
Right 1161063548 19:2226929-2226951 CCGGGACCGCAGTTCGCGCTCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1161063541_1161063557 28 Left 1161063541 19:2226913-2226935 CCTGGGCCCCTTCCCGCCGGGAC 0: 1
1: 1
2: 1
3: 26
4: 272
Right 1161063557 19:2226964-2226986 GCAGGCCAACCTCGGCTCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161063541 Original CRISPR GTCCCGGCGGGAAGGGGCCC AGG (reversed) Exonic