ID: 1161063545

View in Genome Browser
Species Human (GRCh38)
Location 19:2226925-2226947
Sequence GCGCGAACTGCGGTCCCGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 52}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161063545_1161063557 16 Left 1161063545 19:2226925-2226947 CCCGCCGGGACCGCAGTTCGCGC 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1161063557 19:2226964-2226986 GCAGGCCAACCTCGGCTCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 75
1161063545_1161063558 20 Left 1161063545 19:2226925-2226947 CCCGCCGGGACCGCAGTTCGCGC 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1161063558 19:2226968-2226990 GCCAACCTCGGCTCCGTGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1161063545_1161063554 8 Left 1161063545 19:2226925-2226947 CCCGCCGGGACCGCAGTTCGCGC 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1161063554 19:2226956-2226978 ATGTCCCTGCAGGCCAACCTCGG 0: 1
1: 0
2: 2
3: 161
4: 4307
1161063545_1161063550 -2 Left 1161063545 19:2226925-2226947 CCCGCCGGGACCGCAGTTCGCGC 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1161063550 19:2226946-2226968 GCTCGGCCCCATGTCCCTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161063545 Original CRISPR GCGCGAACTGCGGTCCCGGC GGG (reversed) Exonic
901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG + Intergenic
910676504 1:89821397-89821419 GCCCGAGCTGCGGTTGCGGCCGG + Intronic
918601997 1:186375238-186375260 GCGCGCACTTCGGTCGCGGGCGG - Exonic
1073305820 10:102502683-102502705 GCGCTAGCGGCGGACCCGGCTGG - Exonic
1076793349 10:132787757-132787779 GCGGGAACTGCGGGGCCGGGGGG + Intergenic
1077495344 11:2884422-2884444 GCGAAAACTGCGCTCCCGGGGGG + Intronic
1084146159 11:67266462-67266484 GCCCCGACTGCAGTCCCGGCGGG + Exonic
1100679776 12:96907055-96907077 GCGGGAACTGCGGGCCGGGGCGG - Intergenic
1103541993 12:121672618-121672640 GCGCGCGCCGCGGGCCCGGCCGG + Intronic
1122795006 14:104201642-104201664 GCCCCAACTGAGGCCCCGGCTGG + Intergenic
1129387011 15:75201868-75201890 GCGCCGTCTGCGGTCCCGGGCGG - Intronic
1132987726 16:2776822-2776844 GCGCGAGCTGCGCTCGCCGCGGG - Intronic
1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG + Exonic
1142209871 16:88803925-88803947 GCGCGGAGTGCGGGCCTGGCGGG - Exonic
1142378897 16:89721010-89721032 GCGCGTACTGCGGGCCCCACGGG + Intronic
1142763902 17:2055611-2055633 CCGTTACCTGCGGTCCCGGCGGG - Intronic
1148496264 17:48055023-48055045 GTGAGAGCTGCGGTCCAGGCGGG - Intronic
1152778893 17:82217838-82217860 GCGGGGCCTGCGGTCCTGGCCGG + Intergenic
1160725808 19:617367-617389 GCTCGAACTGCGGGCCAGGGCGG - Intronic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1166364651 19:42272380-42272402 GCGGCAGCTGCGGTCCCAGCGGG + Intronic
1166688030 19:44807825-44807847 GCGCCCACTGCATTCCCGGCTGG + Intergenic
938318333 2:130345445-130345467 GCGGGAACTGGGGTCTCGGGAGG - Exonic
940640852 2:156342709-156342731 CCGCGAACCGCGCTCCCCGCAGG - Intergenic
1171994529 20:31721909-31721931 GTTTGAACTGCGGTACCGGCGGG - Exonic
1176178693 20:63739938-63739960 CAGCGCACTGGGGTCCCGGCCGG - Exonic
1179976840 21:44873305-44873327 GCGGGAGCTGCCGTCGCGGCTGG - Intronic
1180094898 21:45551867-45551889 GCGCGAACCCCAGTCACGGCGGG - Intergenic
969299122 4:6287176-6287198 GTGAGGACTGCGGTGCCGGCAGG + Intronic
974409193 4:61517293-61517315 GTGCGCCCTGCGGTCCCCGCAGG + Intronic
979674521 4:123397675-123397697 CCGGGCACTCCGGTCCCGGCAGG - Exonic
985616564 5:926573-926595 GCGCGGACGGCGGCCCCCGCAGG - Intergenic
994670269 5:102755164-102755186 GGGCGAGCGGCGGACCCGGCTGG + Intronic
1002424508 5:179167296-179167318 GCGAGAACAGCGGCCCGGGCCGG + Intronic
1002440846 5:179263576-179263598 GCGTGAGCTGCGCTCCTGGCCGG + Intronic
1021731261 7:23597629-23597651 GCGAGAGGTGCGGGCCCGGCTGG - Intronic
1024312207 7:47979605-47979627 GCGCGAACAGTGGTTCCGCCCGG + Intergenic
1029441037 7:100586715-100586737 CGGCGAACTGCGTTCCCGGCCGG - Intronic
1035247851 7:157576577-157576599 GCGCGCACTGCCCTGCCGGCGGG + Intronic
1035728987 8:1841854-1841876 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035728994 8:1841872-1841894 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035729001 8:1841890-1841912 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035729008 8:1841908-1841930 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035729034 8:1841980-1842002 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035729041 8:1841998-1842020 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035729048 8:1842016-1842038 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035729055 8:1842034-1842056 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1035729062 8:1842052-1842074 GCGGGAACTGGGGCCGCGGCGGG + Intronic
1042253013 8:66775200-66775222 GCGCCAGCTGCGCTCCCTGCGGG - Exonic
1044734792 8:95268732-95268754 GCGCGGACTGCGGGCTCTGCGGG + Intronic
1049585397 8:143430490-143430512 CCGCGGGCGGCGGTCCCGGCGGG + Intergenic
1057139732 9:92719138-92719160 CCGCGAGCTGCTGGCCCGGCTGG - Exonic
1061808440 9:133149092-133149114 GCGCGGCCTCCGGTCCCCGCCGG + Intronic
1061978827 9:134088099-134088121 GCGTGAACTGCAGGCCAGGCTGG - Intergenic
1190862626 X:54358638-54358660 GCGCGCACTGCGGTCCTGGGGGG - Intronic