ID: 1161063546

View in Genome Browser
Species Human (GRCh38)
Location 19:2226926-2226948
Sequence AGCGCGAACTGCGGTCCCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 32}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161063546_1161063554 7 Left 1161063546 19:2226926-2226948 CCGCCGGGACCGCAGTTCGCGCT 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1161063554 19:2226956-2226978 ATGTCCCTGCAGGCCAACCTCGG 0: 1
1: 0
2: 2
3: 161
4: 4307
1161063546_1161063558 19 Left 1161063546 19:2226926-2226948 CCGCCGGGACCGCAGTTCGCGCT 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1161063558 19:2226968-2226990 GCCAACCTCGGCTCCGTGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1161063546_1161063550 -3 Left 1161063546 19:2226926-2226948 CCGCCGGGACCGCAGTTCGCGCT 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1161063550 19:2226946-2226968 GCTCGGCCCCATGTCCCTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 201
1161063546_1161063557 15 Left 1161063546 19:2226926-2226948 CCGCCGGGACCGCAGTTCGCGCT 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1161063557 19:2226964-2226986 GCAGGCCAACCTCGGCTCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161063546 Original CRISPR AGCGCGAACTGCGGTCCCGG CGG (reversed) Exonic