ID: 1161063548

View in Genome Browser
Species Human (GRCh38)
Location 19:2226929-2226951
Sequence CCGGGACCGCAGTTCGCGCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 16}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161063538_1161063548 -3 Left 1161063538 19:2226909-2226931 CCTTCCTGGGCCCCTTCCCGCCG 0: 1
1: 2
2: 1
3: 39
4: 342
Right 1161063548 19:2226929-2226951 CCGGGACCGCAGTTCGCGCTCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1161063537_1161063548 2 Left 1161063537 19:2226904-2226926 CCGGTCCTTCCTGGGCCCCTTCC 0: 1
1: 1
2: 7
3: 67
4: 625
Right 1161063548 19:2226929-2226951 CCGGGACCGCAGTTCGCGCTCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1161063533_1161063548 12 Left 1161063533 19:2226894-2226916 CCCAGACGCACCGGTCCTTCCTG 0: 1
1: 0
2: 1
3: 6
4: 88
Right 1161063548 19:2226929-2226951 CCGGGACCGCAGTTCGCGCTCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1161063532_1161063548 15 Left 1161063532 19:2226891-2226913 CCGCCCAGACGCACCGGTCCTTC 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1161063548 19:2226929-2226951 CCGGGACCGCAGTTCGCGCTCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1161063534_1161063548 11 Left 1161063534 19:2226895-2226917 CCAGACGCACCGGTCCTTCCTGG 0: 1
1: 0
2: 1
3: 4
4: 94
Right 1161063548 19:2226929-2226951 CCGGGACCGCAGTTCGCGCTCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1161063531_1161063548 18 Left 1161063531 19:2226888-2226910 CCTCCGCCCAGACGCACCGGTCC 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1161063548 19:2226929-2226951 CCGGGACCGCAGTTCGCGCTCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1161063541_1161063548 -7 Left 1161063541 19:2226913-2226935 CCTGGGCCCCTTCCCGCCGGGAC 0: 1
1: 1
2: 1
3: 26
4: 272
Right 1161063548 19:2226929-2226951 CCGGGACCGCAGTTCGCGCTCGG 0: 1
1: 0
2: 0
3: 0
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161063548 Original CRISPR CCGGGACCGCAGTTCGCGCT CGG Exonic