ID: 1161063549

View in Genome Browser
Species Human (GRCh38)
Location 19:2226935-2226957
Sequence ATGGGGCCGAGCGCGAACTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 31}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161063549_1161063554 -2 Left 1161063549 19:2226935-2226957 CCGCAGTTCGCGCTCGGCCCCAT 0: 1
1: 0
2: 0
3: 4
4: 31
Right 1161063554 19:2226956-2226978 ATGTCCCTGCAGGCCAACCTCGG 0: 1
1: 0
2: 2
3: 161
4: 4307
1161063549_1161063557 6 Left 1161063549 19:2226935-2226957 CCGCAGTTCGCGCTCGGCCCCAT 0: 1
1: 0
2: 0
3: 4
4: 31
Right 1161063557 19:2226964-2226986 GCAGGCCAACCTCGGCTCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 75
1161063549_1161063558 10 Left 1161063549 19:2226935-2226957 CCGCAGTTCGCGCTCGGCCCCAT 0: 1
1: 0
2: 0
3: 4
4: 31
Right 1161063558 19:2226968-2226990 GCCAACCTCGGCTCCGTGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161063549 Original CRISPR ATGGGGCCGAGCGCGAACTG CGG (reversed) Exonic