ID: 1161063550

View in Genome Browser
Species Human (GRCh38)
Location 19:2226946-2226968
Sequence GCTCGGCCCCATGTCCCTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 201}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161063534_1161063550 28 Left 1161063534 19:2226895-2226917 CCAGACGCACCGGTCCTTCCTGG 0: 1
1: 0
2: 1
3: 4
4: 94
Right 1161063550 19:2226946-2226968 GCTCGGCCCCATGTCCCTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 201
1161063545_1161063550 -2 Left 1161063545 19:2226925-2226947 CCCGCCGGGACCGCAGTTCGCGC 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1161063550 19:2226946-2226968 GCTCGGCCCCATGTCCCTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 201
1161063543_1161063550 3 Left 1161063543 19:2226920-2226942 CCCTTCCCGCCGGGACCGCAGTT 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1161063550 19:2226946-2226968 GCTCGGCCCCATGTCCCTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 201
1161063533_1161063550 29 Left 1161063533 19:2226894-2226916 CCCAGACGCACCGGTCCTTCCTG 0: 1
1: 0
2: 1
3: 6
4: 88
Right 1161063550 19:2226946-2226968 GCTCGGCCCCATGTCCCTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 201
1161063546_1161063550 -3 Left 1161063546 19:2226926-2226948 CCGCCGGGACCGCAGTTCGCGCT 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1161063550 19:2226946-2226968 GCTCGGCCCCATGTCCCTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 201
1161063544_1161063550 2 Left 1161063544 19:2226921-2226943 CCTTCCCGCCGGGACCGCAGTTC 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1161063550 19:2226946-2226968 GCTCGGCCCCATGTCCCTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 201
1161063537_1161063550 19 Left 1161063537 19:2226904-2226926 CCGGTCCTTCCTGGGCCCCTTCC 0: 1
1: 1
2: 7
3: 67
4: 625
Right 1161063550 19:2226946-2226968 GCTCGGCCCCATGTCCCTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 201
1161063542_1161063550 4 Left 1161063542 19:2226919-2226941 CCCCTTCCCGCCGGGACCGCAGT 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1161063550 19:2226946-2226968 GCTCGGCCCCATGTCCCTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 201
1161063538_1161063550 14 Left 1161063538 19:2226909-2226931 CCTTCCTGGGCCCCTTCCCGCCG 0: 1
1: 2
2: 1
3: 39
4: 342
Right 1161063550 19:2226946-2226968 GCTCGGCCCCATGTCCCTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 201
1161063541_1161063550 10 Left 1161063541 19:2226913-2226935 CCTGGGCCCCTTCCCGCCGGGAC 0: 1
1: 1
2: 1
3: 26
4: 272
Right 1161063550 19:2226946-2226968 GCTCGGCCCCATGTCCCTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 201
1161063547_1161063550 -6 Left 1161063547 19:2226929-2226951 CCGGGACCGCAGTTCGCGCTCGG 0: 1
1: 0
2: 0
3: 4
4: 25
Right 1161063550 19:2226946-2226968 GCTCGGCCCCATGTCCCTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161063550 Original CRISPR GCTCGGCCCCATGTCCCTGC AGG Exonic
900375624 1:2353325-2353347 GCCGGCCCCCCTGTCCCTGCTGG + Intronic
900473984 1:2867902-2867924 GCTGGGCCCCTTCCCCCTGCAGG - Intergenic
901655444 1:10766859-10766881 GCTGGGCCCCATCTCTCTGTGGG - Intronic
901762429 1:11479600-11479622 GCTCCGCACCATCTCCCCGCGGG + Intronic
903339314 1:22644019-22644041 GCTGGGCCCCACGTCCATCCCGG - Exonic
907387998 1:54138275-54138297 GCATGGCCCCATGTCTCTGTGGG - Intronic
912735990 1:112149874-112149896 GCTCTGCCCCTTGGCTCTGCAGG - Intergenic
913552017 1:119925397-119925419 GCTCCTCCCCACTTCCCTGCTGG - Exonic
915622318 1:157093099-157093121 GCTCTGCCCCAGGCCCCTGCCGG - Exonic
920378880 1:205524327-205524349 GCTCAGCCGCATGTCCCGCCGGG + Exonic
920927681 1:210358060-210358082 GCTCTGCCCCATGTCATTGTGGG - Intronic
922099175 1:222468230-222468252 GCTGGGCCTCATGTGGCTGCAGG - Intergenic
922735860 1:227978016-227978038 GCTGGGCCTCATGTGGCTGCAGG + Intergenic
923040962 1:230319483-230319505 GCAAGGCCCCATGGCCCTCCCGG + Intergenic
923141420 1:231163536-231163558 GCACGGCCCCGCGGCCCTGCTGG - Exonic
1062973495 10:1665991-1666013 GCTGGGCCCCAGCTCCCTGCAGG - Intronic
1063019568 10:2114306-2114328 GCTGGGCTCCAAATCCCTGCTGG - Intergenic
1066464325 10:35639926-35639948 CATCGGCACCATGTTCCTGCTGG - Exonic
1067937802 10:50625319-50625341 CCTCTGTCCAATGTCCCTGCCGG - Intergenic
1073147204 10:101288657-101288679 GCTCTGCCCCCTCTCCCTGGAGG - Intergenic
1073177054 10:101563057-101563079 CATGGGCTCCATGTCCCTGCTGG - Intergenic
1075555428 10:123427425-123427447 GCACAGTCCCATCTCCCTGCCGG - Intergenic
1076809973 10:132881412-132881434 GGGCAGCCCCATGTCCCTGCTGG + Intronic
1077351629 11:2095717-2095739 GCCCTGCCCCAGCTCCCTGCAGG + Intergenic
1077377976 11:2214547-2214569 GCTCCTCCCCAGGTCCTTGCGGG + Intergenic
1077838602 11:5947544-5947566 GCTCAGCCTCCTCTCCCTGCTGG + Exonic
1077840406 11:5968278-5968300 GCTCAGCCTCCTCTCCCTGCTGG - Exonic
1077843787 11:6002776-6002798 GCTCAGCCTCCTCTCCCTGCTGG - Exonic
1077846217 11:6027476-6027498 GCTCAGCCTCCTCTCCCTGCTGG - Exonic
1078092815 11:8277857-8277879 GCTCAGCCCCATGGCCCAGTCGG - Intergenic
1078404159 11:11054686-11054708 GCTGGGACTTATGTCCCTGCTGG - Intergenic
1078934252 11:15938203-15938225 GCTGGGCCCCAGCTCCCAGCTGG + Intergenic
1083658754 11:64242377-64242399 GCTCAGCCTCATGTCTCTGTGGG - Exonic
1083720648 11:64602029-64602051 GCCCCTCCCCATGTCCCTCCAGG + Exonic
1083840136 11:65299536-65299558 GATCCGCGCCATGGCCCTGCCGG - Intronic
1084399781 11:68936866-68936888 GCTGGGCCACCGGTCCCTGCTGG - Exonic
1084547623 11:69822249-69822271 GCCCAGCCCCCTGCCCCTGCCGG - Intergenic
1084744260 11:71157962-71157984 GCTGGGCCTCTTGTTCCTGCTGG - Intronic
1084751212 11:71205391-71205413 GCTCTGCCTCGTGCCCCTGCTGG + Intronic
1085279818 11:75322593-75322615 CCCTGCCCCCATGTCCCTGCTGG - Intronic
1087755229 11:102047803-102047825 CCTCTGCCCCAGGTCCATGCTGG + Exonic
1088188891 11:107205327-107205349 GCTCTGCCCCATGACTTTGCAGG + Intergenic
1088666272 11:112097074-112097096 TGCCTGCCCCATGTCCCTGCTGG + Intronic
1089466681 11:118690270-118690292 GCTGTGCCCCTTGTCCCAGCCGG - Intergenic
1091205665 11:133819129-133819151 GCTGGGCACCAGGTCCCTGCAGG + Intergenic
1091302803 11:134518299-134518321 GCTCACCACCATGTCACTGCTGG - Intergenic
1092720141 12:11433151-11433173 CCTCAGCCCCTTGTCCCTGAAGG + Intronic
1095971329 12:47903937-47903959 GCTCTGCTCCAGCTCCCTGCTGG - Intronic
1096503579 12:52079896-52079918 GCTCGGCGTGCTGTCCCTGCTGG + Intergenic
1099969921 12:89490038-89490060 GCTGGTACCCAGGTCCCTGCCGG - Intronic
1102333300 12:112054891-112054913 GCTCAGCACCTTGCCCCTGCAGG + Intronic
1103477970 12:121232542-121232564 GAGAGGCCCCTTGTCCCTGCAGG - Intronic
1103920524 12:124396965-124396987 GCTTGGTCCCGTGGCCCTGCTGG - Intronic
1105941372 13:25150860-25150882 TCTTGGCCCCCAGTCCCTGCAGG - Intergenic
1106758022 13:32841473-32841495 GCTCGGCTACATGACCCAGCTGG + Intergenic
1110443159 13:75547962-75547984 GCTCTGCAGCAAGTCCCTGCTGG + Intronic
1110711247 13:78653330-78653352 ACACTGCCCCATGTCCCTGGGGG + Intronic
1112183871 13:97110107-97110129 GCGCGGTCCCACGGCCCTGCGGG + Intergenic
1113673813 13:112194811-112194833 GCTCACCCCGTTGTCCCTGCAGG + Intergenic
1114364543 14:22012670-22012692 GGGCAGCCACATGTCCCTGCAGG + Intergenic
1117953883 14:61108033-61108055 GCTGGTCCCCATTTCCCTACTGG + Intergenic
1118963970 14:70562122-70562144 GCTCTGCCCCATGGCTCTGCAGG - Intergenic
1119226433 14:72947764-72947786 TCTGGGCCTCAGGTCCCTGCTGG + Intronic
1122262575 14:100531674-100531696 CCTCTGCCCCATGTGGCTGCTGG + Intergenic
1122515480 14:102305321-102305343 GCTCGGCTCGCTCTCCCTGCTGG + Intergenic
1125387036 15:39148702-39148724 GCTTTGCCCCATGTCCATTCGGG + Intergenic
1127719299 15:61684025-61684047 GCCCGGGCCCAAGTCCCAGCTGG - Intergenic
1128278024 15:66370491-66370513 ACCCCGCCCCATGCCCCTGCTGG - Intronic
1128603437 15:69016506-69016528 GCTCTGCCCCAAGTCAATGCAGG + Intronic
1129270076 15:74414946-74414968 GCTGGTCTCCATGTCACTGCAGG - Exonic
1131260529 15:90885186-90885208 GCTTCACCACATGTCCCTGCAGG + Exonic
1131394804 15:92077731-92077753 GCTCAGAGCCATATCCCTGCTGG - Intronic
1132599430 16:767350-767372 GCTCGGGCCCCTCTCCCGGCGGG + Intronic
1134112106 16:11522085-11522107 GCTGGGCCCCACCTCCCTGTGGG - Exonic
1136069553 16:27779535-27779557 TCTCTGCCACATGTCCCTCCTGG + Exonic
1136568865 16:31085066-31085088 GCTGTGCCCCCTGCCCCTGCCGG - Intronic
1139506238 16:67399456-67399478 GCTGTGCCCCCTCTCCCTGCAGG - Exonic
1139513866 16:67442164-67442186 GCTCTGGCCCAGGCCCCTGCAGG + Intronic
1139972864 16:70787127-70787149 GCTCAGCCCCATGTTCCAACTGG + Intronic
1141134651 16:81457588-81457610 GCTCTGCCACATGTCCCCGGGGG + Intronic
1141675413 16:85514808-85514830 GCTCCTCTCCCTGTCCCTGCAGG + Intergenic
1142053381 16:87975364-87975386 CCTCAGCCCCACGTCCCTTCTGG + Intronic
1142065413 16:88059601-88059623 TCTCGGCCCCACGTTCCTGCAGG + Intronic
1142216755 16:88833919-88833941 GCTGGGACCCTTGCCCCTGCTGG + Intronic
1142979788 17:3664892-3664914 GCTGGGTCCCAGGCCCCTGCAGG + Intronic
1143001222 17:3796466-3796488 GCACAGCCCCATGTCCCAGAGGG - Intronic
1144643481 17:16952626-16952648 GCCCGGCCTCTTGTCCCTGATGG + Intronic
1145265290 17:21376950-21376972 GCCCGGCCCCAGTTCCCCGCAGG + Intronic
1145356993 17:22168056-22168078 GCTCTGCCCCATGGCTTTGCAGG + Intergenic
1145379550 17:22379515-22379537 GCTCGGCCCCTTGTGACTCCTGG - Intergenic
1145380987 17:22386607-22386629 GCTCGGCCCCTTGTGACTCCTGG - Intergenic
1145381469 17:22388982-22389004 GCTCGGCCCCTTGTGACTCCTGG - Intergenic
1145382675 17:22395121-22395143 GCTCGGCCCCTTGTGACTCCTGG - Intergenic
1145382957 17:22396484-22396506 GCTCGGCCCCTTGTGACTCCTGG - Intergenic
1145383051 17:22396954-22396976 GCTCGGCCCCTTGTGACTCCTGG - Intergenic
1145383529 17:22399307-22399329 GCTCGGCCCCTTGTGACTCCTGG - Intergenic
1145384044 17:22401775-22401797 GCTCGGCCCCTTGTGACTCCTGG - Intergenic
1146793139 17:35764278-35764300 GCTCGGCCCCTTAGCGCTGCTGG + Exonic
1148493300 17:48037236-48037258 GCTCGGCCCGCTGTCCCCCCCGG - Intronic
1148794367 17:50190026-50190048 GCTGGTCCCCCTGGCCCTGCCGG - Exonic
1150131323 17:62670737-62670759 GATCGGCCCCATCCCCCAGCTGG - Intronic
1152820672 17:82436143-82436165 CCTCGGCCCCCAGTCCCAGCAGG - Intronic
1155256148 18:23999784-23999806 GCTCAGCCCCATCTGCCTGCTGG - Intronic
1157304466 18:46507175-46507197 GCTCGGACCCATGTGCTTGGTGG - Intronic
1159015656 18:63100024-63100046 GCTCTGCACCATGGGCCTGCAGG + Intergenic
1159754534 18:72348115-72348137 GCTCTGCCCCCTGTCCTTCCAGG - Intergenic
1160758298 19:769846-769868 GCTCTGCCACATGCCCCTGAGGG + Intergenic
1160825348 19:1077736-1077758 GCAAGGCCCCATGGCCCAGCTGG - Intronic
1161063550 19:2226946-2226968 GCTCGGCCCCATGTCCCTGCAGG + Exonic
1161106510 19:2446255-2446277 GCCCCTCCCCATGTCCTTGCTGG - Intronic
1164609741 19:29623982-29624004 CCTCAGCGCCATGCCCCTGCAGG - Intergenic
1165733168 19:38159274-38159296 TCTTGGGCCCATGTTCCTGCTGG - Intronic
1167756735 19:51417506-51417528 GCTCCGCCCCAGGTCCTTTCCGG + Intronic
925342069 2:3144836-3144858 GCCTGGCTCCATGTTCCTGCAGG - Intergenic
926090777 2:10047837-10047859 GCTAGTCCCCTTGGCCCTGCAGG - Exonic
926166097 2:10522789-10522811 GCTCAGCCCCATCTCACTCCTGG + Intergenic
928115938 2:28545287-28545309 CCTGCCCCCCATGTCCCTGCTGG - Intronic
928420163 2:31132102-31132124 TCTCTCCCCCAGGTCCCTGCAGG - Intronic
929920644 2:46168952-46168974 GCTCTGACCCCTGTCCCTCCTGG - Intronic
935744520 2:106178972-106178994 GCTCAGCACCAGGTCCCTGTGGG + Intronic
937099077 2:119254764-119254786 CCTCGGCACGTTGTCCCTGCTGG + Exonic
945235844 2:207630625-207630647 GCTCAGCCCCAAGTTTCTGCTGG - Intergenic
947151614 2:227122155-227122177 GCCCTGCCCCATCTCCCTTCTGG + Intronic
947829265 2:233127145-233127167 GCTCGGCTTCACGCCCCTGCTGG - Intronic
947913670 2:233818602-233818624 GCTGGGCCTTTTGTCCCTGCTGG + Intronic
948387652 2:237591544-237591566 GCTCTGCCCCTCATCCCTGCAGG + Intronic
948672156 2:239575447-239575469 GATCGGCCCCAGGTCATTGCTGG - Intergenic
1168935948 20:1665329-1665351 CCTGGGCCCCAGGGCCCTGCTGG - Intergenic
1171346586 20:24470144-24470166 GCGCGCCCTCATGGCCCTGCTGG - Intronic
1171414014 20:24965425-24965447 GCTCAGCCCCATGCTCCTGATGG - Intronic
1171457215 20:25278844-25278866 GCTGTGCCCGATGTGCCTGCTGG - Intronic
1173201028 20:40955257-40955279 GCTCTCCTCCTTGTCCCTGCAGG - Intergenic
1173802347 20:45902334-45902356 CCTCCTCCCCATGTTCCTGCAGG - Exonic
1174109841 20:48191384-48191406 GTTCCCTCCCATGTCCCTGCTGG + Intergenic
1176008538 20:62879874-62879896 GCCGGGCCCCAGGCCCCTGCTGG - Exonic
1176019897 20:62957227-62957249 GCAAGGCCCCAGGGCCCTGCAGG + Intronic
1176180748 20:63748249-63748271 GTGCTGCCCCATCTCCCTGCCGG - Intronic
1176643128 21:9325079-9325101 GCTTGGTTCTATGTCCCTGCGGG + Intergenic
1179779011 21:43687688-43687710 GCTCGGCCACACGTGCCTTCAGG - Exonic
1179976772 21:44873031-44873053 CCGCGGCCCCATCACCCTGCAGG + Intronic
1180369808 22:11974137-11974159 GCTTGGTTCTATGTCCCTGCGGG - Intergenic
1180376429 22:12097968-12097990 GCTTGGTTCTATGTCCCTGCGGG + Intergenic
1181462856 22:23095557-23095579 GCTCGGCCTCACCCCCCTGCTGG + Exonic
1183598814 22:38828296-38828318 GCTCAGCCACACGACCCTGCAGG + Exonic
1184881142 22:47304776-47304798 CCTGGGCCCAATGTCGCTGCCGG + Intergenic
1185402912 22:50627767-50627789 CCTCGGTCCCATGTCCATGGGGG - Exonic
950105733 3:10387238-10387260 GCTCAGCCCCATTGTCCTGCTGG + Intronic
953470793 3:43164202-43164224 CCTGGGCCCCCTGTTCCTGCAGG + Intergenic
954318371 3:49813565-49813587 CCTCGGCCCCCAGGCCCTGCAGG + Exonic
954363072 3:50132716-50132738 GCTGGGCCCCTTCTCCCTGGTGG - Intergenic
955241584 3:57182966-57182988 GCTCCCCCGCAAGTCCCTGCAGG - Intergenic
957096956 3:75785505-75785527 GCTTGGTTCTATGTCCCTGCGGG - Intronic
957505975 3:81121618-81121640 GCTTGACCCCAAGTCCATGCAGG - Intergenic
960963597 3:123089626-123089648 GCTCGGCCCCATGCCTGTGCAGG - Intronic
967820360 3:193834154-193834176 GCTCTGCCTCATGTCCCTGCAGG + Intergenic
1202743756 3_GL000221v1_random:79950-79972 GCTTGGTTCTATGTCCCTGCGGG - Intergenic
968451202 4:676829-676851 AGTCGGCCCCAGGTCCCTCCTGG + Intronic
968724899 4:2242260-2242282 GCTCGGCCCCCGGCCGCTGCGGG + Intergenic
969924002 4:10568650-10568672 TGTGGTCCCCATGTCCCTGCTGG - Intronic
974651478 4:64759206-64759228 GCTTGGCCCCATCTCCCTCTTGG - Intergenic
976766728 4:88605874-88605896 GCTCAGCCACAATTCCCTGCAGG - Exonic
977666724 4:99652339-99652361 GCTCGGCCCCTGGGCCCGGCAGG - Exonic
1202758029 4_GL000008v2_random:83401-83423 GCTTGGTTCTATGTCCCTGCGGG + Intergenic
985960737 5:3301504-3301526 GCTCGGCCCCCTGCCCCCGTAGG + Intergenic
986735795 5:10666361-10666383 TCTCGGCCCCTTCACCCTGCAGG + Intergenic
993390923 5:87319132-87319154 GCTCTGCCCCATGGCTCTGCAGG + Intronic
994443146 5:99836136-99836158 TCTCTGCCCCATGGCTCTGCAGG - Intergenic
997690194 5:135823071-135823093 GCTCTCCCCCAACTCCCTGCAGG - Intergenic
1001571853 5:172735362-172735384 GCCTGGCCTCAAGTCCCTGCTGG - Intergenic
1002163652 5:177331914-177331936 GCTCTGCCACCTGTCCCTGCTGG + Exonic
1003308934 6:4952138-4952160 GATGTGCCCCATTTCCCTGCGGG + Intronic
1013195685 6:107843608-107843630 GCTCTGCCCACTGGCCCTGCCGG + Intergenic
1013371882 6:109477891-109477913 GCTGTGCCCCATGTCCTTACTGG - Intronic
1014048638 6:116925611-116925633 GCTCTGCACCAGTTCCCTGCTGG + Exonic
1016564785 6:145440818-145440840 GCTCTGCCCTATGGCCTTGCAGG + Intergenic
1019573350 7:1724409-1724431 GTGCGGCCCCACCTCCCTGCTGG + Intronic
1019729972 7:2624187-2624209 GCTCTGCCCCATGTCCCCTTGGG - Intergenic
1020116275 7:5478202-5478224 GCTCAGGCCCATGTCCTGGCAGG + Intronic
1021561473 7:21972322-21972344 GATGGACCCCCTGTCCCTGCAGG - Intergenic
1021616252 7:22505943-22505965 GCTTTGCCCCATGTCCTTCCTGG + Intronic
1022236514 7:28467004-28467026 CCTTGGCCCCCTGTCCCTCCAGG - Intronic
1022926041 7:35057158-35057180 GCTTTGCCCCATGTCCTTCCTGG + Intergenic
1025258965 7:57404594-57404616 GCGCCGCCCCATGTTCATGCTGG - Intergenic
1025710098 7:63900651-63900673 GCGCCGCCCCATGTTCATGCTGG - Intergenic
1028376216 7:90148395-90148417 GCTTTGCCCCATGTCCTTCCTGG - Intergenic
1030196563 7:106858974-106858996 GTCCCGCCCCAGGTCCCTGCAGG + Intergenic
1030723593 7:112898578-112898600 GATGGACCCCAAGTCCCTGCAGG + Intronic
1033566194 7:142580466-142580488 GCTTTGCCCCATATCCCTCCTGG - Intergenic
1034455621 7:151168158-151168180 GCCCCGCCGCCTGTCCCTGCTGG - Intronic
1036644216 8:10601927-10601949 GCTGGGCCCCAAATCACTGCTGG - Intergenic
1039370136 8:36975946-36975968 CCTATTCCCCATGTCCCTGCTGG + Intergenic
1046004066 8:108458173-108458195 GCTCCGCCCCATGGCTTTGCAGG + Intronic
1046170433 8:110498225-110498247 GCTCTGCCCCATGGTCCTGCAGG - Intergenic
1049224038 8:141441242-141441264 GTTCTGCACCATGGCCCTGCAGG + Intergenic
1049443980 8:142621721-142621743 GCTCGTCCCCAGGTCCGTGATGG - Intergenic
1049519195 8:143079668-143079690 GCTCGGCCCCATGTAGGTCCTGG - Intergenic
1049742831 8:144249212-144249234 GCTCTGCCCCCTCTCCCTACAGG + Intronic
1049799420 8:144510882-144510904 GCTGGCCCCCAGGGCCCTGCAGG + Exonic
1053619701 9:39802727-39802749 GCTCTGCCCCATGGCTCTGCAGG - Intergenic
1053877876 9:42562043-42562065 GCTCTGCCCCATGGCTCTGCAGG - Intergenic
1053894779 9:42732323-42732345 GCTCCGCCCCATGGCTCTGCGGG + Intergenic
1054233819 9:62539651-62539673 GCTCTGCCCCATGGCTCTGCAGG + Intergenic
1054264457 9:62904716-62904738 GCTCTGCCCCATGGCTCTGCAGG + Intergenic
1056191886 9:84192934-84192956 CCTCTGACCCATTTCCCTGCAGG + Intergenic
1056691614 9:88813090-88813112 GCCCGCCCACATGTGCCTGCAGG - Intergenic
1061043778 9:128153677-128153699 GCTGGGCGCCATGTCACAGCAGG - Intergenic
1061220078 9:129245421-129245443 GGTCGTCACCATCTCCCTGCTGG + Intergenic
1061403654 9:130382162-130382184 CCTCTGTCCCGTGTCCCTGCAGG + Intronic
1061942043 9:133889072-133889094 GCTCAGCTCCAGATCCCTGCCGG - Intronic
1062117566 9:134817660-134817682 GCTCGTCCCTCTGCCCCTGCAGG + Intronic
1062279096 9:135744090-135744112 CCTCGGCCCCATGTGAGTGCAGG + Intronic
1062409943 9:136418533-136418555 GCTCTGCCCTCCGTCCCTGCAGG + Exonic
1203712390 Un_KI270742v1:109914-109936 GCTTGGTTCTATGTCCCTGCGGG - Intergenic
1203538818 Un_KI270743v1:68273-68295 GCTTGGTTCTATGTCCCTGCGGG + Intergenic
1186900196 X:14046323-14046345 TCTCGGCCCCATGCCCCGACAGG + Intergenic
1187181510 X:16947142-16947164 CCTCCGCCTCCTGTCCCTGCGGG + Intronic
1187388890 X:18873028-18873050 GCTTGTCCCCATGGCCCTGGGGG + Intergenic
1191889644 X:65926847-65926869 CCTTGGCTCCATGTCACTGCAGG + Intergenic
1201071409 Y:10150354-10150376 GCTTGTGCCCGTGTCCCTGCGGG + Intergenic