ID: 1161063550

View in Genome Browser
Species Human (GRCh38)
Location 19:2226946-2226968
Sequence GCTCGGCCCCATGTCCCTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 201}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161063534_1161063550 28 Left 1161063534 19:2226895-2226917 CCAGACGCACCGGTCCTTCCTGG 0: 1
1: 0
2: 1
3: 4
4: 94
Right 1161063550 19:2226946-2226968 GCTCGGCCCCATGTCCCTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 201
1161063546_1161063550 -3 Left 1161063546 19:2226926-2226948 CCGCCGGGACCGCAGTTCGCGCT 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1161063550 19:2226946-2226968 GCTCGGCCCCATGTCCCTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 201
1161063538_1161063550 14 Left 1161063538 19:2226909-2226931 CCTTCCTGGGCCCCTTCCCGCCG 0: 1
1: 2
2: 1
3: 39
4: 342
Right 1161063550 19:2226946-2226968 GCTCGGCCCCATGTCCCTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 201
1161063542_1161063550 4 Left 1161063542 19:2226919-2226941 CCCCTTCCCGCCGGGACCGCAGT 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1161063550 19:2226946-2226968 GCTCGGCCCCATGTCCCTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 201
1161063541_1161063550 10 Left 1161063541 19:2226913-2226935 CCTGGGCCCCTTCCCGCCGGGAC 0: 1
1: 1
2: 1
3: 26
4: 272
Right 1161063550 19:2226946-2226968 GCTCGGCCCCATGTCCCTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 201
1161063547_1161063550 -6 Left 1161063547 19:2226929-2226951 CCGGGACCGCAGTTCGCGCTCGG 0: 1
1: 0
2: 0
3: 4
4: 25
Right 1161063550 19:2226946-2226968 GCTCGGCCCCATGTCCCTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 201
1161063543_1161063550 3 Left 1161063543 19:2226920-2226942 CCCTTCCCGCCGGGACCGCAGTT 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1161063550 19:2226946-2226968 GCTCGGCCCCATGTCCCTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 201
1161063537_1161063550 19 Left 1161063537 19:2226904-2226926 CCGGTCCTTCCTGGGCCCCTTCC 0: 1
1: 1
2: 7
3: 67
4: 625
Right 1161063550 19:2226946-2226968 GCTCGGCCCCATGTCCCTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 201
1161063533_1161063550 29 Left 1161063533 19:2226894-2226916 CCCAGACGCACCGGTCCTTCCTG 0: 1
1: 0
2: 1
3: 6
4: 88
Right 1161063550 19:2226946-2226968 GCTCGGCCCCATGTCCCTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 201
1161063544_1161063550 2 Left 1161063544 19:2226921-2226943 CCTTCCCGCCGGGACCGCAGTTC 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1161063550 19:2226946-2226968 GCTCGGCCCCATGTCCCTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 201
1161063545_1161063550 -2 Left 1161063545 19:2226925-2226947 CCCGCCGGGACCGCAGTTCGCGC 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1161063550 19:2226946-2226968 GCTCGGCCCCATGTCCCTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161063550 Original CRISPR GCTCGGCCCCATGTCCCTGC AGG Exonic