ID: 1161063557

View in Genome Browser
Species Human (GRCh38)
Location 19:2226964-2226986
Sequence GCAGGCCAACCTCGGCTCCG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 75}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161063545_1161063557 16 Left 1161063545 19:2226925-2226947 CCCGCCGGGACCGCAGTTCGCGC 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1161063557 19:2226964-2226986 GCAGGCCAACCTCGGCTCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 75
1161063547_1161063557 12 Left 1161063547 19:2226929-2226951 CCGGGACCGCAGTTCGCGCTCGG 0: 1
1: 0
2: 0
3: 4
4: 25
Right 1161063557 19:2226964-2226986 GCAGGCCAACCTCGGCTCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 75
1161063542_1161063557 22 Left 1161063542 19:2226919-2226941 CCCCTTCCCGCCGGGACCGCAGT 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1161063557 19:2226964-2226986 GCAGGCCAACCTCGGCTCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 75
1161063546_1161063557 15 Left 1161063546 19:2226926-2226948 CCGCCGGGACCGCAGTTCGCGCT 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1161063557 19:2226964-2226986 GCAGGCCAACCTCGGCTCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 75
1161063549_1161063557 6 Left 1161063549 19:2226935-2226957 CCGCAGTTCGCGCTCGGCCCCAT 0: 1
1: 0
2: 0
3: 4
4: 31
Right 1161063557 19:2226964-2226986 GCAGGCCAACCTCGGCTCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 75
1161063543_1161063557 21 Left 1161063543 19:2226920-2226942 CCCTTCCCGCCGGGACCGCAGTT 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1161063557 19:2226964-2226986 GCAGGCCAACCTCGGCTCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 75
1161063541_1161063557 28 Left 1161063541 19:2226913-2226935 CCTGGGCCCCTTCCCGCCGGGAC 0: 1
1: 1
2: 1
3: 26
4: 272
Right 1161063557 19:2226964-2226986 GCAGGCCAACCTCGGCTCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 75
1161063544_1161063557 20 Left 1161063544 19:2226921-2226943 CCTTCCCGCCGGGACCGCAGTTC 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1161063557 19:2226964-2226986 GCAGGCCAACCTCGGCTCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161063557 Original CRISPR GCAGGCCAACCTCGGCTCCG TGG Exonic
900951852 1:5862562-5862584 GCAGCCCACCCTCCGCTCAGGGG + Intergenic
901435047 1:9242495-9242517 GGAGGCCAACCTCAGAACCGGGG + Intronic
908042302 1:60127693-60127715 GCAGGCCAATCTGGAATCCGTGG + Intergenic
908186052 1:61654324-61654346 GCAAGCCAGCCTCGGCGCCCAGG - Intergenic
914915316 1:151815881-151815903 ACAGCCCAACCCGGGCTCCGCGG + Intronic
915934851 1:160084453-160084475 GCAGGCCATCCTGGGCTCCATGG + Exonic
922783304 1:228269930-228269952 GCCGGGAAACCTCGGCTCCCGGG + Intronic
1073102716 10:101015185-101015207 GCATGCCACCCTCTGCTCCTAGG - Intronic
1076344180 10:129769100-129769122 GCAGGCCCACCTGTGCTCCCAGG - Intergenic
1076810020 10:132881630-132881652 GCAGGCTAACCCCGGCTCGCAGG - Intronic
1076810031 10:132881670-132881692 GCAGGCTAACCCCGGCTCGCAGG - Intronic
1077163117 11:1122567-1122589 GCATGCCAACCACGGCTGCATGG + Intergenic
1077266579 11:1653726-1653748 CCAGGCCCATCTGGGCTCCGTGG - Intergenic
1077439764 11:2562396-2562418 GAGAGCCAGCCTCGGCTCCGGGG - Intronic
1084425191 11:69080560-69080582 GCATGCCAGCCTCGGCCCTGTGG + Intronic
1085342676 11:75743678-75743700 TCAGACCAACCTCTGCTCTGAGG - Intergenic
1090384329 11:126347896-126347918 GGAGGCCTCCCTCTGCTCCGTGG - Intergenic
1096180506 12:49548052-49548074 GCAATCCAGCCTCTGCTCCGTGG + Intronic
1102646903 12:114409491-114409513 TCCGGCCCACCTCGGCTCAGAGG - Intergenic
1107359368 13:39602794-39602816 GCAGCCCAACTCCGGCTCCGGGG + Intronic
1116895482 14:50311865-50311887 GCACTCCAACCTCGGATCCCAGG - Intronic
1122770580 14:104095913-104095935 CCAGGCCCACCTCGGCCCTGGGG + Intronic
1124221232 15:27851430-27851452 GCAGGCCAACCTCAGGGTCGTGG + Exonic
1132143835 15:99415212-99415234 GCAGGGCCACCCCAGCTCCGGGG + Intergenic
1132665567 16:1079999-1080021 GCAGTGCAACCTCCGCTCCTGGG - Exonic
1139197054 16:64931711-64931733 GCAGGCCAACCTTTCCTCCACGG + Intergenic
1156472140 18:37384029-37384051 GCAGGACAAGCTCAGCACCGTGG - Intronic
1157593170 18:48848287-48848309 GCCAGCCAACCTCAGCTCCCAGG + Intronic
1161063557 19:2226964-2226986 GCAGGCCAACCTCGGCTCCGTGG + Exonic
1161581574 19:5083586-5083608 GCAGGCCAGGCTCGGCCACGTGG + Intronic
1163138513 19:15331534-15331556 GCGGGCCAAGCTCGCCTCCAGGG + Intronic
1167503948 19:49861740-49861762 GCAGGCCACCTACGGCCCCGCGG + Intronic
926059398 2:9795727-9795749 ACAGGCCAGCCTAGGCTCGGAGG + Intergenic
935076313 2:99748034-99748056 GCTGGCAAACCTCGGGTCCTGGG + Intronic
941096671 2:161245115-161245137 GCCGGGAAACCTCGGCTCCCGGG + Intergenic
945556296 2:211280549-211280571 GCCGGCCAAACTCGTCTCTGGGG - Intergenic
1173812347 20:45963768-45963790 GAAGGTCGACCTCGGCGCCGGGG + Exonic
1174092346 20:48059166-48059188 GGAGGCCACCCCCGGCTCCACGG + Intergenic
1174393769 20:50233773-50233795 GCAGGCCTGCCTCGGCCCCGGGG - Intergenic
1176550406 21:8218610-8218632 CGAGGCCAACCGAGGCTCCGCGG - Intergenic
1176569334 21:8401648-8401670 CGAGGCCAACCGAGGCTCCGCGG - Intergenic
1176577248 21:8445880-8445902 CGAGGCCAACCGAGGCTCCGCGG - Intergenic
1179905993 21:44423698-44423720 GGAGGCCAACCTCTGCTCCATGG - Exonic
1180786226 22:18549309-18549331 GCAGGCTCGCCTCGGCTCCATGG - Intergenic
1181131508 22:20735036-20735058 GCAGGCTCGCCTCGGCTCCATGG - Intronic
1181243148 22:21488863-21488885 GCAGGCTCGCCTCGGCTCCATGG - Intergenic
1184498515 22:44857942-44857964 GCAGGTCACCCTCAGCTCTGTGG - Intronic
1203255301 22_KI270733v1_random:134948-134970 CGAGGCCAACCGAGGCTCCGCGG - Intergenic
956487358 3:69737190-69737212 TCAGGACAACCTCAGCTCAGAGG + Intergenic
961629810 3:128288237-128288259 GCAGACAAAACTCGGCTCTGAGG + Intronic
964344664 3:155744235-155744257 GGAGGCAAACCCCGGCCCCGCGG - Intronic
968342036 3:197964471-197964493 GCAGAGCAACCTCGGCTTCCTGG + Intronic
968629809 4:1644517-1644539 CCAGGCCAGCATCGGCCCCGTGG - Intronic
969630533 4:8333240-8333262 GCAGGCCCAGCTCGGCTTTGAGG + Intergenic
969652340 4:8475143-8475165 GCAGGGCAGCCTCTGCTCCTTGG - Intronic
980103630 4:128566303-128566325 CAAAGCCAACCTCGGCTCCCAGG - Intergenic
982070771 4:151692613-151692635 ACAGGCCATACTGGGCTCCGGGG + Intronic
985782156 5:1876916-1876938 GCCGGCGAGCCGCGGCTCCGCGG - Intergenic
993565307 5:89467538-89467560 GCAGTCCAACCTCGGCAACAGGG + Intergenic
1015882196 6:137880784-137880806 GCAGGCCAACTTAGGCTTGGCGG + Intronic
1019453750 7:1113876-1113898 GGAGGCCACGCTCTGCTCCGGGG + Intronic
1021688522 7:23210820-23210842 GCTGGCCAACCTGTGCTCCTGGG + Intergenic
1023843625 7:44109521-44109543 GCAGGCCAGCCTGGGGTCCAGGG - Intronic
1029517388 7:101034154-101034176 GCATGCCAACCTCAACTCCTGGG + Exonic
1029517729 7:101037160-101037182 GCATGCCAACCTCAACTCCTAGG + Exonic
1033531661 7:142270285-142270307 GCAGACTAACCTCTGCTCTGTGG - Intergenic
1036781489 8:11651019-11651041 TCAGCCCAACCTCACCTCCGGGG + Intergenic
1039527831 8:38231948-38231970 GCGGGGGAACCTCGGCTCCCGGG + Intronic
1040387450 8:46923041-46923063 GCAGGCCAAACACCGCTCCCAGG - Intergenic
1049222765 8:141435420-141435442 GCAGACCAGCCTGGGCTCCGGGG - Intergenic
1049508963 8:143018381-143018403 CCAGGCCTACCCCGGCTCCTTGG - Intronic
1053372661 9:37576018-37576040 TCAGGCCGCCCGCGGCTCCGCGG - Intronic
1055466490 9:76571745-76571767 CGAGGCCAACCGAGGCTCCGCGG - Intergenic
1055829385 9:80360456-80360478 GCAGGACAACCCCGGGTCCCCGG - Intergenic
1061262684 9:129488693-129488715 GCAGGCCAGCGTCGGGGCCGGGG - Intergenic
1061542052 9:131282854-131282876 GCAGCCCAACGCCGGCACCGCGG + Intergenic
1203471699 Un_GL000220v1:118085-118107 CGAGGCCAACCGAGGCTCCGCGG - Intergenic
1188488862 X:30714487-30714509 GGAGGCCACCCTCAGCTCCTAGG + Intronic
1189308721 X:40005861-40005883 CAAGGCCGACCTCGGCTGCGCGG - Intergenic
1189534391 X:41922703-41922725 GGTGGCCAACCTCGGCTCGGTGG + Intronic
1195798239 X:108677568-108677590 CCAGGCCAACCTGGGCTACCTGG + Exonic
1198111056 X:133502968-133502990 GCAGGGGAACCTCTCCTCCGTGG - Intergenic