ID: 1161063557

View in Genome Browser
Species Human (GRCh38)
Location 19:2226964-2226986
Sequence GCAGGCCAACCTCGGCTCCG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 75}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161063545_1161063557 16 Left 1161063545 19:2226925-2226947 CCCGCCGGGACCGCAGTTCGCGC 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1161063557 19:2226964-2226986 GCAGGCCAACCTCGGCTCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 75
1161063546_1161063557 15 Left 1161063546 19:2226926-2226948 CCGCCGGGACCGCAGTTCGCGCT 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1161063557 19:2226964-2226986 GCAGGCCAACCTCGGCTCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 75
1161063541_1161063557 28 Left 1161063541 19:2226913-2226935 CCTGGGCCCCTTCCCGCCGGGAC 0: 1
1: 1
2: 1
3: 26
4: 272
Right 1161063557 19:2226964-2226986 GCAGGCCAACCTCGGCTCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 75
1161063542_1161063557 22 Left 1161063542 19:2226919-2226941 CCCCTTCCCGCCGGGACCGCAGT 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1161063557 19:2226964-2226986 GCAGGCCAACCTCGGCTCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 75
1161063547_1161063557 12 Left 1161063547 19:2226929-2226951 CCGGGACCGCAGTTCGCGCTCGG 0: 1
1: 0
2: 0
3: 4
4: 25
Right 1161063557 19:2226964-2226986 GCAGGCCAACCTCGGCTCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 75
1161063544_1161063557 20 Left 1161063544 19:2226921-2226943 CCTTCCCGCCGGGACCGCAGTTC 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1161063557 19:2226964-2226986 GCAGGCCAACCTCGGCTCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 75
1161063549_1161063557 6 Left 1161063549 19:2226935-2226957 CCGCAGTTCGCGCTCGGCCCCAT 0: 1
1: 0
2: 0
3: 4
4: 31
Right 1161063557 19:2226964-2226986 GCAGGCCAACCTCGGCTCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 75
1161063543_1161063557 21 Left 1161063543 19:2226920-2226942 CCCTTCCCGCCGGGACCGCAGTT 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1161063557 19:2226964-2226986 GCAGGCCAACCTCGGCTCCGTGG 0: 1
1: 0
2: 0
3: 6
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161063557 Original CRISPR GCAGGCCAACCTCGGCTCCG TGG Exonic