ID: 1161063558

View in Genome Browser
Species Human (GRCh38)
Location 19:2226968-2226990
Sequence GCCAACCTCGGCTCCGTGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 66}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161063551_1161063558 -7 Left 1161063551 19:2226952-2226974 CCCCATGTCCCTGCAGGCCAACC 0: 1
1: 0
2: 1
3: 27
4: 230
Right 1161063558 19:2226968-2226990 GCCAACCTCGGCTCCGTGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1161063543_1161063558 25 Left 1161063543 19:2226920-2226942 CCCTTCCCGCCGGGACCGCAGTT 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1161063558 19:2226968-2226990 GCCAACCTCGGCTCCGTGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1161063542_1161063558 26 Left 1161063542 19:2226919-2226941 CCCCTTCCCGCCGGGACCGCAGT 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1161063558 19:2226968-2226990 GCCAACCTCGGCTCCGTGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1161063546_1161063558 19 Left 1161063546 19:2226926-2226948 CCGCCGGGACCGCAGTTCGCGCT 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1161063558 19:2226968-2226990 GCCAACCTCGGCTCCGTGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1161063547_1161063558 16 Left 1161063547 19:2226929-2226951 CCGGGACCGCAGTTCGCGCTCGG 0: 1
1: 0
2: 0
3: 4
4: 25
Right 1161063558 19:2226968-2226990 GCCAACCTCGGCTCCGTGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1161063549_1161063558 10 Left 1161063549 19:2226935-2226957 CCGCAGTTCGCGCTCGGCCCCAT 0: 1
1: 0
2: 0
3: 4
4: 31
Right 1161063558 19:2226968-2226990 GCCAACCTCGGCTCCGTGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1161063545_1161063558 20 Left 1161063545 19:2226925-2226947 CCCGCCGGGACCGCAGTTCGCGC 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1161063558 19:2226968-2226990 GCCAACCTCGGCTCCGTGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1161063544_1161063558 24 Left 1161063544 19:2226921-2226943 CCTTCCCGCCGGGACCGCAGTTC 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1161063558 19:2226968-2226990 GCCAACCTCGGCTCCGTGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1161063552_1161063558 -8 Left 1161063552 19:2226953-2226975 CCCATGTCCCTGCAGGCCAACCT 0: 1
1: 0
2: 1
3: 19
4: 171
Right 1161063558 19:2226968-2226990 GCCAACCTCGGCTCCGTGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1161063553_1161063558 -9 Left 1161063553 19:2226954-2226976 CCATGTCCCTGCAGGCCAACCTC 0: 1
1: 0
2: 2
3: 32
4: 281
Right 1161063558 19:2226968-2226990 GCCAACCTCGGCTCCGTGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161063558 Original CRISPR GCCAACCTCGGCTCCGTGGC CGG Exonic