ID: 1161063558

View in Genome Browser
Species Human (GRCh38)
Location 19:2226968-2226990
Sequence GCCAACCTCGGCTCCGTGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 66}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161063545_1161063558 20 Left 1161063545 19:2226925-2226947 CCCGCCGGGACCGCAGTTCGCGC 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1161063558 19:2226968-2226990 GCCAACCTCGGCTCCGTGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1161063547_1161063558 16 Left 1161063547 19:2226929-2226951 CCGGGACCGCAGTTCGCGCTCGG 0: 1
1: 0
2: 0
3: 4
4: 25
Right 1161063558 19:2226968-2226990 GCCAACCTCGGCTCCGTGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1161063542_1161063558 26 Left 1161063542 19:2226919-2226941 CCCCTTCCCGCCGGGACCGCAGT 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1161063558 19:2226968-2226990 GCCAACCTCGGCTCCGTGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1161063543_1161063558 25 Left 1161063543 19:2226920-2226942 CCCTTCCCGCCGGGACCGCAGTT 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1161063558 19:2226968-2226990 GCCAACCTCGGCTCCGTGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1161063549_1161063558 10 Left 1161063549 19:2226935-2226957 CCGCAGTTCGCGCTCGGCCCCAT 0: 1
1: 0
2: 0
3: 4
4: 31
Right 1161063558 19:2226968-2226990 GCCAACCTCGGCTCCGTGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1161063553_1161063558 -9 Left 1161063553 19:2226954-2226976 CCATGTCCCTGCAGGCCAACCTC 0: 1
1: 0
2: 2
3: 32
4: 281
Right 1161063558 19:2226968-2226990 GCCAACCTCGGCTCCGTGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1161063544_1161063558 24 Left 1161063544 19:2226921-2226943 CCTTCCCGCCGGGACCGCAGTTC 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1161063558 19:2226968-2226990 GCCAACCTCGGCTCCGTGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1161063546_1161063558 19 Left 1161063546 19:2226926-2226948 CCGCCGGGACCGCAGTTCGCGCT 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1161063558 19:2226968-2226990 GCCAACCTCGGCTCCGTGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1161063552_1161063558 -8 Left 1161063552 19:2226953-2226975 CCCATGTCCCTGCAGGCCAACCT 0: 1
1: 0
2: 1
3: 19
4: 171
Right 1161063558 19:2226968-2226990 GCCAACCTCGGCTCCGTGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1161063551_1161063558 -7 Left 1161063551 19:2226952-2226974 CCCCATGTCCCTGCAGGCCAACC 0: 1
1: 0
2: 1
3: 27
4: 230
Right 1161063558 19:2226968-2226990 GCCAACCTCGGCTCCGTGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161063558 Original CRISPR GCCAACCTCGGCTCCGTGGC CGG Exonic
900932339 1:5745186-5745208 GCCACCTCCGGCTCCGCGGCAGG + Intergenic
901230847 1:7640992-7641014 GCCTGCCTCGGCTCCCAGGCTGG + Intronic
903211783 1:21822921-21822943 GCCAACCTCGGCTTGTGGGCTGG - Exonic
913256647 1:116960334-116960356 TCCAACATCAGCTCCTTGGCAGG + Intronic
919824362 1:201493102-201493124 GGAAAGCTCAGCTCCGTGGCTGG - Intronic
920260827 1:204686542-204686564 CACAAACTCGGCTCCATGGCAGG + Intergenic
922706818 1:227794618-227794640 ACCCACCTCGGCTCCCTGACTGG - Intergenic
1070642739 10:78181041-78181063 GCCATCCGCTGCTCCTTGGCTGG + Intergenic
1073138211 10:101231047-101231069 GCTAAGCTGGGCTCCGGGGCGGG + Intergenic
1075713844 10:124544675-124544697 ACAAGCCTCGGCTCTGTGGCCGG + Intronic
1077163118 11:1122571-1122593 GCCAACCACGGCTGCATGGCTGG + Intergenic
1077439762 11:2562392-2562414 GCCAGCCTCGGCTCCGGGGAGGG - Intronic
1079122969 11:17698316-17698338 GCCAACTTCTGCTCTGTGCCAGG - Intergenic
1080944800 11:36958766-36958788 GCCAGGCTGGGCTCTGTGGCAGG + Intergenic
1081811229 11:45915187-45915209 GCCAACCTCGACTCTGAGCCTGG - Intronic
1083344319 11:61978941-61978963 GCCAGCCTCAGCTCTCTGGCGGG + Intergenic
1084952420 11:72674047-72674069 GCCAACCCCAGCTCCTTGGAGGG + Intronic
1085638607 11:78177215-78177237 GCCATGCTCGACTCTGTGGCAGG + Intronic
1088462039 11:110092834-110092856 GCCAACCTCGGCTCCAGAGGCGG + Intergenic
1089667779 11:120031321-120031343 GCAAAGCTCGGCTGCGTCGCGGG - Intergenic
1101824091 12:108207291-108207313 GCCAACCTCAGCTGCATGCCTGG + Intronic
1107467869 13:40666043-40666065 GCCAACCCCGACGCCGCGGCGGG - Exonic
1113782041 13:112982440-112982462 GCGAGCCCAGGCTCCGTGGCAGG + Intronic
1118324761 14:64773502-64773524 GCCAACCACAGCCCCCTGGCAGG + Intronic
1121315902 14:92960854-92960876 GCCTACCTGGGCTCTGTGCCTGG - Intronic
1122865268 14:104601067-104601089 GCCCGTCTCAGCTCCGTGGCTGG + Intronic
1124338732 15:28876349-28876371 ACCACCCTAGGCTCCGAGGCAGG - Intergenic
1133784391 16:8963499-8963521 CCCAATCTCGGCGCCGAGGCGGG + Intronic
1138375628 16:56562114-56562136 ACCAACCTAAGCTCAGTGGCAGG + Intergenic
1139440490 16:66964220-66964242 GCCAACCACGGCTCCCAGACAGG + Intronic
1139519169 16:67470449-67470471 GCCAAACTGGGCTCCATGCCAGG + Intronic
1141427379 16:83953031-83953053 GCCACCCTAGGCCCCCTGGCAGG + Intronic
1144653594 17:17021713-17021735 GCCTAGCTCTGCTCCGGGGCAGG - Intergenic
1152206518 17:78977300-78977322 CCCAACCTGGGCTGTGTGGCAGG + Intronic
1152282789 17:79395348-79395370 GCCAACCACCGCTCAGTGCCGGG + Intronic
1157593172 18:48848291-48848313 GCCAACCTCAGCTCCCAGGCTGG + Intronic
1160144438 18:76352075-76352097 GCCAAGCTCAGCTCAGTGGGAGG + Intergenic
1161063558 19:2226968-2226990 GCCAACCTCGGCTCCGTGGCCGG + Exonic
1163781538 19:19251973-19251995 CCCCACCTCGGCTCCATGGTGGG + Exonic
1164823879 19:31269928-31269950 GACAGACTTGGCTCCGTGGCTGG - Intergenic
926800895 2:16659638-16659660 GCCAGCCTCATCACCGTGGCTGG + Intronic
932562798 2:72887634-72887656 GCCGACCTGGGCGCCGAGGCCGG + Exonic
946231140 2:218292005-218292027 GGCAACCTGGGGTCCGTGCCAGG + Intronic
1175492480 20:59388597-59388619 GCCAACCTCGCTTCCAGGGCAGG - Intergenic
1176139682 20:63539538-63539560 GCCAACCTGGGCTCCCAGGAGGG + Intergenic
1181639545 22:24189432-24189454 TGCAGCCTCGGCTCCTTGGCTGG + Intergenic
1185137155 22:49079611-49079633 GCCCACCTCAGCTCAGGGGCGGG - Intergenic
950729769 3:14947543-14947565 GCCAGCCTCGCCGCCGCGGCGGG - Intergenic
953432202 3:42849385-42849407 TCCTACCTCGGCCCGGTGGCTGG - Intronic
969321954 4:6417754-6417776 GGGAACCTCGGCTGCGTGGGGGG + Intronic
976590531 4:86845138-86845160 GCCAAACTCGGCCCAGAGGCAGG + Intronic
978630268 4:110735875-110735897 GTCAACCTGGGCTCTGTGCCAGG - Intergenic
979438013 4:120717709-120717731 GTCAACCTCGGATCCCTGGATGG + Intronic
985774192 5:1832110-1832132 GCCATCATCAGCTCTGTGGCAGG + Intergenic
991221908 5:64227081-64227103 GTCAACCACGGCTCCCTCGCTGG + Intronic
1000622988 5:163505887-163505909 GCCCCCCTCGGATCCGGGGCTGG - Intronic
1019559126 7:1647256-1647278 CCCAGCCTGCGCTCCGTGGCGGG - Intergenic
1019990805 7:4689308-4689330 GCCAGCATCGGATACGTGGCTGG + Intronic
1020066279 7:5190566-5190588 GCCAAGCTCGGCGGCGTCGCAGG + Intronic
1034442567 7:151093912-151093934 GCCAGGCTTGGCTCCCTGGCCGG + Intronic
1038326515 8:26576931-26576953 GCCCACCTCGGCTCCCTGAGGGG - Intronic
1047254613 8:123206268-123206290 GACAGCCTCGGCCCCGTGTCTGG + Intronic
1049283727 8:141763385-141763407 GCCCACCTCGGCTCTGGGGCGGG - Intergenic
1049598968 8:143498467-143498489 CCCTTCCTCGCCTCCGTGGCAGG - Intronic
1053387716 9:37707812-37707834 CCCACCCTTGGCTCCCTGGCTGG + Intronic
1059191637 9:112333164-112333186 GCGGACCTCGGCACCGCGGCCGG + Intronic
1062482260 9:136757983-136758005 GGCAGCCTGGCCTCCGTGGCGGG + Exonic
1062527982 9:136985886-136985908 CCGAGCCTCGGCTCCGTGGCAGG + Intronic
1189491511 X:41474540-41474562 GCCTCCCCGGGCTCCGTGGCCGG + Exonic
1190060002 X:47204675-47204697 TCCAAGGTCGGCTCCTTGGCTGG - Intronic
1200169181 X:154059878-154059900 GCCCACCTCAGCTCCCAGGCAGG - Intronic
1201300351 Y:12499588-12499610 CCCAGCCTCAGCACCGTGGCTGG + Intergenic