ID: 1161063588

View in Genome Browser
Species Human (GRCh38)
Location 19:2227110-2227132
Sequence CAGGCGGCACAGTTGGAGGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 225}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161063573_1161063588 25 Left 1161063573 19:2227062-2227084 CCACCAGACTGACCAACTCGCAC 0: 1
1: 0
2: 0
3: 2
4: 72
Right 1161063588 19:2227110-2227132 CAGGCGGCACAGTTGGAGGTAGG 0: 1
1: 0
2: 0
3: 29
4: 225
1161063577_1161063588 13 Left 1161063577 19:2227074-2227096 CCAACTCGCACGCCATGGGCAGC 0: 1
1: 0
2: 1
3: 4
4: 79
Right 1161063588 19:2227110-2227132 CAGGCGGCACAGTTGGAGGTAGG 0: 1
1: 0
2: 0
3: 29
4: 225
1161063574_1161063588 22 Left 1161063574 19:2227065-2227087 CCAGACTGACCAACTCGCACGCC 0: 1
1: 0
2: 0
3: 3
4: 38
Right 1161063588 19:2227110-2227132 CAGGCGGCACAGTTGGAGGTAGG 0: 1
1: 0
2: 0
3: 29
4: 225
1161063581_1161063588 1 Left 1161063581 19:2227086-2227108 CCATGGGCAGCTTTTCCGGGGTG 0: 1
1: 0
2: 0
3: 23
4: 183
Right 1161063588 19:2227110-2227132 CAGGCGGCACAGTTGGAGGTAGG 0: 1
1: 0
2: 0
3: 29
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161063588 Original CRISPR CAGGCGGCACAGTTGGAGGT AGG Exonic
900565807 1:3331299-3331321 CCCCCGGCACACTTGGAGGTGGG + Intronic
901183753 1:7358996-7359018 CATGTGGCACACTGGGAGGTAGG + Intronic
903701972 1:25255933-25255955 CAGGCCGCACAGCAGGAGGCAGG - Intronic
904463324 1:30693242-30693264 CAGGCTGCTCACTTGGAGGTGGG - Intergenic
905018465 1:34793035-34793057 CGGGCGGCCCAGGTGGAGGTGGG - Exonic
907126697 1:52056537-52056559 CCGGCGGCGCAGCTGGGGGTCGG + Intronic
907237699 1:53062967-53062989 CAGCCGGGACAGCTGGAGGGAGG + Intronic
907926053 1:58956145-58956167 CAGGCCACACAGCAGGAGGTAGG + Intergenic
911164396 1:94712096-94712118 CAGGCCACACAGCGGGAGGTGGG + Intergenic
912567372 1:110597940-110597962 CAGCAGGGACAGATGGAGGTAGG - Intronic
913220294 1:116654580-116654602 CAGGAGGCAAAGTATGAGGTGGG + Intronic
914947529 1:152080018-152080040 CAGGGAGCACTGTTGGAAGTGGG + Intergenic
915253013 1:154603827-154603849 GAGGCTGCACAGGTAGAGGTGGG + Intronic
915695690 1:157739482-157739504 CATGCTCCACAGTGGGAGGTGGG + Intergenic
917322530 1:173798350-173798372 CAGGCAGCAAAGTTGGAAGAAGG + Intergenic
920098280 1:203500349-203500371 GAGGTGGCAGAGGTGGAGGTGGG - Intronic
923077325 1:230621627-230621649 CATGAGGCTCAGTTGGATGTTGG - Intergenic
923255675 1:232219452-232219474 CAAGCAGCACAGTAGAAGGTGGG + Intergenic
924329118 1:242924799-242924821 CAGGAGGCGGAGGTGGAGGTTGG - Intergenic
1063195233 10:3735429-3735451 CAGCCGGCACAGTTGCTGGATGG - Intergenic
1064492170 10:15870564-15870586 CAGGAGGCAAAGGTGGAGGGTGG + Intergenic
1065897916 10:30180943-30180965 CAGGCGGCCCATTTGCAGTTTGG - Intergenic
1066026373 10:31363260-31363282 CAGGGAGCACTGTTGGAAGTGGG + Intronic
1067235622 10:44446177-44446199 CAGGCTGCACGGCAGGAGGTGGG - Intergenic
1069773865 10:70915649-70915671 TAGGAGGCAGAGTGGGAGGTCGG - Intergenic
1070162182 10:73873469-73873491 CAGCAGGAACAGTTGAAGGTCGG + Intronic
1070813147 10:79308336-79308358 CAGGAAGAACAGTTGGAGTTTGG + Intronic
1073443168 10:103564767-103564789 CAGAGGGGACAGCTGGAGGTGGG - Intronic
1077335161 11:2000196-2000218 CAGGGTGCACTGTTGAAGGTTGG - Intergenic
1077335339 11:2001009-2001031 CAGGGTGCACTGTTGAAGGTTGG - Intergenic
1077518835 11:3019134-3019156 GAGCTGGCACAGTCGGAGGTAGG - Exonic
1077544958 11:3165211-3165233 CTCGCGGCACGGTAGGAGGTAGG - Exonic
1077888311 11:6402077-6402099 CGGGCGGGACAGTGGAAGGTGGG - Exonic
1079124362 11:17708314-17708336 CAGGGTGCACAGTAGGAGCTTGG - Intergenic
1079165277 11:18035090-18035112 CAGGCTGCACAGCAGCAGGTGGG - Intronic
1081610604 11:44560930-44560952 CAGGTGGTTCAATTGGAGGTTGG - Intergenic
1081657673 11:44868174-44868196 CAGGGGACGCAGTTGGAGGCTGG + Intronic
1081989667 11:47331131-47331153 CAGGAGGTAGAGTTTGAGGTGGG - Intergenic
1082004888 11:47414022-47414044 CAGGGGGAACAGTGTGAGGTGGG - Intronic
1082056278 11:47819941-47819963 CAGGCTGCAGAGTTGGAGCAGGG - Intronic
1083035189 11:59630363-59630385 CAGGAGGCTGAGATGGAGGTTGG + Intergenic
1083224142 11:61274023-61274045 CAGGCGGCAAGGCTGCAGGTAGG - Intronic
1083639506 11:64137796-64137818 CAGGCCGCAGAGTTCCAGGTGGG + Intronic
1084942429 11:72620169-72620191 CAGGCTGCACACCTGAAGGTGGG - Intronic
1086997251 11:93372295-93372317 CAGGCTGAATATTTGGAGGTGGG - Intronic
1088068948 11:105757298-105757320 AATGCGGGACAGTGGGAGGTAGG - Intronic
1088599579 11:111462693-111462715 CAGGAGGCACAGGTGGTGCTAGG + Intergenic
1088875863 11:113935797-113935819 CAGGCTGCCCAGCGGGAGGTTGG + Intronic
1089425538 11:118370978-118371000 CATGTGGCACTGTTGGAGGTGGG - Intronic
1090094536 11:123730081-123730103 CAGGTGGGACAGGTGGAGATGGG - Intronic
1091208369 11:133835841-133835863 CTGGGGGCACAGTTGGGGGATGG - Intergenic
1202818144 11_KI270721v1_random:55378-55400 CAGGGTGCACTGTTGAAGGTTGG - Intergenic
1202818322 11_KI270721v1_random:56191-56213 CAGGGTGCACTGTTGAAGGTTGG - Intergenic
1091450446 12:569411-569433 CAGGGGGCACAGTTGAACCTGGG - Intronic
1092077114 12:5683145-5683167 TAGGGGGCAGAGCTGGAGGTAGG - Intronic
1092725933 12:11485655-11485677 CAGGCTGCATAGCGGGAGGTGGG - Intronic
1095958278 12:47818972-47818994 CAGGCGGCAAATTTGGCGGATGG - Intronic
1096127138 12:49128221-49128243 CAGGCACCACAGTGGGAGGCTGG + Exonic
1096134090 12:49185273-49185295 CAGGCACCACAGTGGGAGGCTGG + Exonic
1096145049 12:49272948-49272970 CAGGCACCACAGTGGGAGGCTGG - Exonic
1102114991 12:110396141-110396163 CAGGCTGCACAGCAGGAGGTGGG - Intronic
1104770212 12:131356794-131356816 CAGGCGTCTCATTTGGAGATGGG + Intergenic
1105669833 13:22600806-22600828 CAGGCCGCACAGCAGGAGGTGGG - Intergenic
1108369985 13:49759785-49759807 TGGGCTGCACAGTAGGAGGTAGG - Intronic
1109873794 13:68371250-68371272 CAGGAGGCAGAGGTTGAGGTGGG - Intergenic
1111919417 13:94394831-94394853 CAGTAGGCACAGTTAGAGGCTGG + Intronic
1113911551 13:113843697-113843719 CAGGCGGCACAGTGGACGGAGGG - Intronic
1116534208 14:46010594-46010616 AGGGCGTCACAGTTGGATGTAGG + Intergenic
1117119641 14:52553338-52553360 CAGCCGCCACAGCTGCAGGTAGG - Exonic
1117388801 14:55243515-55243537 CAGGGGGCACATTTGAAGGAAGG - Intergenic
1118717889 14:68573278-68573300 GAGGGGGCACAGCAGGAGGTGGG - Intronic
1119712025 14:76829250-76829272 CAGGCAGCAGAGATGGAGGAAGG + Intronic
1122660027 14:103288932-103288954 CAGGCTGCACAGCAAGAGGTGGG + Intergenic
1123087629 14:105724140-105724162 CAGGCCCCAGTGTTGGAGGTGGG + Intergenic
1126661851 15:51040023-51040045 CAGGCCGCACAGCAGGAGGTGGG + Intergenic
1128155439 15:65388938-65388960 CAGGGGGCTCAGTCGCAGGTCGG + Exonic
1128318689 15:66677879-66677901 CAGGGGACACATTTGGAGGTTGG + Intronic
1129175915 15:73839614-73839636 AAGGCTGCACAGGTGGAGGTGGG + Intergenic
1130744452 15:86635919-86635941 GAGTCAGCACAGTTGGAGATAGG + Intronic
1131629507 15:94161487-94161509 CAGGTGCCTCAGTGGGAGGTGGG - Intergenic
1132722034 16:1321219-1321241 CAGGCGGAGCAGTGGGGGGTCGG - Intronic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1133625117 16:7563883-7563905 CAGTGGGCAGGGTTGGAGGTTGG - Intronic
1134689236 16:16180191-16180213 CAGGCAGCACAGCAGGAGGTGGG - Intronic
1138189044 16:54999358-54999380 CACGCTGCACAGATGGAGGCTGG + Intergenic
1138829383 16:60358916-60358938 CAGGGAGCACTGTTGGAAGTGGG + Exonic
1139392551 16:66614178-66614200 CAGGCTGCACAGCAGGAGGTGGG - Intergenic
1141462157 16:84184027-84184049 GAGCCAGCACAGGTGGAGGTCGG - Intronic
1141742799 16:85905211-85905233 CTGAAGGCACAGTTGCAGGTTGG + Intronic
1141802302 16:86318333-86318355 CAGGAGACACAGTTGGAGATAGG - Intergenic
1141921570 16:87139096-87139118 CAGGGGTCAGAGTTAGAGGTCGG - Intronic
1142129274 16:88425379-88425401 CAGGCTGCAGGGTTGGGGGTAGG - Intergenic
1143100699 17:4503209-4503231 CAGGAGCCCCAGGTGGAGGTAGG + Intronic
1143464055 17:7123834-7123856 CACGGGGCACAGATGGAGGCCGG - Intergenic
1144580221 17:16454615-16454637 CAGGAGGCAGAGGTTGAGGTGGG + Intronic
1144673339 17:17145431-17145453 TGGGCGGCACAGGTGGAGGAAGG + Intronic
1144742205 17:17590313-17590335 CAGGAGGCACAGGAGGAGATGGG - Intronic
1144783952 17:17821684-17821706 CAGGCTGCACAGTTGGTCCTTGG - Intronic
1146421969 17:32695348-32695370 CAGGCCGCACAGCAGCAGGTGGG - Intronic
1147262615 17:39217426-39217448 TAAGAGGCACAGTTGGGGGTGGG + Intronic
1149993521 17:61395702-61395724 GAGGCGGCACAGCTGGAGCCCGG + Intergenic
1150216835 17:63476018-63476040 CCGGCGGCGCAGTGGGAGGTGGG - Intergenic
1151699506 17:75735843-75735865 CAGGCTGCAGAGTGGAAGGTAGG + Intronic
1151968663 17:77445687-77445709 CAGTTGGCTGAGTTGGAGGTGGG + Intronic
1153498938 18:5728826-5728848 CAGGAGGTACAGAAGGAGGTCGG - Intergenic
1153732559 18:8029311-8029333 CAGGCAGGACAGGTGGAGGAGGG - Intronic
1154310877 18:13265417-13265439 CAGGCAGCACAGTGGGAAGGGGG - Intronic
1155864678 18:30950623-30950645 CATGACACACAGTTGGAGGTAGG - Intergenic
1156305265 18:35873345-35873367 CTGATGGCACAGTTGGAGGAGGG - Intergenic
1157303439 18:46497906-46497928 CAGGATGCACAGTGGGAGTTAGG + Intronic
1157502680 18:48202428-48202450 CAGGAGGCACAGTCGCAGGGCGG + Intronic
1157904606 18:51558352-51558374 CAGGCCGCACAGCAGTAGGTGGG + Intergenic
1161063588 19:2227110-2227132 CAGGCGGCACAGTTGGAGGTAGG + Exonic
1164779480 19:30880862-30880884 CAGGGGGCACAGGGAGAGGTGGG + Intergenic
1165093798 19:33399967-33399989 CAGGCGGCAGAGCTGGGGCTGGG + Intronic
1165323190 19:35098945-35098967 CAGGGCGCAGAGTTGGACGTAGG - Intergenic
1165548763 19:36565208-36565230 CAGGGGGTACATTTGCAGGTTGG - Intronic
1166827909 19:45620983-45621005 GAGGCAGCACAGTTGGAGCAGGG + Intronic
1168424423 19:56227419-56227441 CAGGAGGCAGAGGCGGAGGTGGG + Intronic
925180377 2:1813512-1813534 CGGGCCGTACAGGTGGAGGTGGG + Intronic
927241502 2:20923379-20923401 CAGGTGGGACATTTTGAGGTGGG + Intergenic
927523447 2:23716837-23716859 GTGAGGGCACAGTTGGAGGTGGG - Intergenic
930372118 2:50515028-50515050 CATGCCGCACAGCAGGAGGTGGG + Intronic
932063289 2:68528675-68528697 CAGGGAGCACTGTTGGAAGTGGG + Intronic
932916607 2:75865900-75865922 GAGGAGGCAAAGGTGGAGGTGGG - Intergenic
933616991 2:84492247-84492269 CAGTAGGCACATTTGAAGGTGGG - Intergenic
937201982 2:120209748-120209770 CAGGCTGCAGAGTGGGAGATGGG + Intergenic
938015856 2:127866680-127866702 CTGGGGGCACAGTTGGAGCAGGG - Intronic
938343796 2:130552358-130552380 CAGGAGGCCCAGGTGGAGGAGGG - Intergenic
938346037 2:130568364-130568386 CAGGAGGCCCAGGTGGAGGAGGG + Intergenic
944612529 2:201426123-201426145 CAGGCTGCATAGCAGGAGGTGGG + Intronic
945460289 2:210100068-210100090 CAGGCTGCACAGCAGGAGGTGGG + Intronic
946366202 2:219250606-219250628 CAGGCACCACAGTGGGAGGCTGG + Exonic
946369465 2:219271860-219271882 CAGGCACCACAGTGGGAGGCTGG - Intronic
947940612 2:234051710-234051732 CATGGGGCTCATTTGGAGGTAGG + Intronic
948718427 2:239881132-239881154 AGGGCGGCCCAGATGGAGGTGGG - Intergenic
1169518564 20:6345605-6345627 CAGTCCCCAAAGTTGGAGGTGGG - Intergenic
1170375876 20:15699709-15699731 CAGACGTCACAGGTGGAGGAGGG - Intronic
1173131724 20:40400217-40400239 AAGCCAGCACAGTGGGAGGTGGG - Intergenic
1174062984 20:47845597-47845619 CGGTCTGCACAGTGGGAGGTTGG + Intergenic
1174393292 20:50231398-50231420 CAGGCAGAACAGTGGGAGGAAGG + Intergenic
1175857926 20:62132766-62132788 CTGGGTGCACAGTTGGATGTGGG + Intronic
1176257268 20:64158869-64158891 CAGGTGGGGCAGGTGGAGGTAGG - Intronic
1178314845 21:31559157-31559179 CAGGCGGCCCAATCGGAGCTCGG - Intronic
1178355191 21:31905546-31905568 CAGGGAGCTCAGTGGGAGGTGGG - Intronic
1179388604 21:40966747-40966769 CATGGGCCACTGTTGGAGGTGGG - Intergenic
1180821595 22:18832599-18832621 CAGGAGGCAGAGTATGAGGTGGG + Intergenic
1181191383 22:21143446-21143468 CAGGAGGCAGAGTATGAGGTGGG - Intergenic
1181207816 22:21267064-21267086 CAGGAGGCAGAGTATGAGGTGGG + Intergenic
1182159170 22:28104627-28104649 AAGGCTGCACAGTTGGACCTTGG - Intronic
1182763987 22:32745343-32745365 CAGGCCGCACATCTGGAGGGTGG + Intronic
1183327752 22:37203653-37203675 CAGGGTGCACAGTAGGTGGTCGG - Intergenic
1183765204 22:39866974-39866996 CAGGAGGCAGAGCTGGCGGTGGG - Intronic
1184335660 22:43851680-43851702 CAGGCTGCACACTTGGAGGGTGG - Intronic
1203219105 22_KI270731v1_random:28352-28374 CAGGAGGCAGAGTATGAGGTGGG - Intergenic
1203271720 22_KI270734v1_random:58475-58497 CAGGAGGCAGAGTATGAGGTGGG + Intergenic
952489683 3:33855958-33855980 TGGGCTGCACAGTAGGAGGTGGG + Intronic
953242235 3:41159857-41159879 AAGGAGGCAGAGTTGGAAGTGGG + Intergenic
954213687 3:49112359-49112381 CAGGCTGCACACTTGGAGATGGG + Exonic
954752192 3:52819920-52819942 CAGGTGACAAAGTAGGAGGTGGG - Exonic
955884964 3:63588332-63588354 CAGGAGACACAGTGGAAGGTTGG - Intronic
958254726 3:91312400-91312422 CAGGAGGGCCAGTTGGAGATTGG - Intergenic
960842075 3:121969597-121969619 CAGGTGGCAGTGTTGCAGGTGGG + Intergenic
963445835 3:145406558-145406580 CAGGCGGAACACTTGAAGTTGGG - Intergenic
964067339 3:152595726-152595748 CAGGAGGCTGAGGTGGAGGTGGG + Intergenic
965962449 3:174444270-174444292 GTGGGGGCACAGATGGAGGTGGG + Intronic
967713579 3:192737734-192737756 TGGGCAGCACAGATGGAGGTGGG + Intronic
967873166 3:194249052-194249074 CAGGCGGAAGGGTTGGAGCTTGG + Intergenic
968315629 3:197722167-197722189 CAGGAGGCAAAGGTGGAGCTGGG + Intronic
968943962 4:3653991-3654013 CAGGCTTCTCAGTTGCAGGTGGG + Intergenic
968949332 4:3682430-3682452 CAGGCGTCACAGATGAAGGGTGG + Intergenic
969629085 4:8324943-8324965 CAGGATGCACAGCTGGAGGGTGG + Intergenic
973903227 4:55499619-55499641 CAGGCCGCACAGCAGGAGGTAGG - Intronic
981784497 4:148462162-148462184 CAGGCCACACAGCAGGAGGTAGG + Intergenic
983998429 4:174213511-174213533 CAGGGGGCTCAGTTGGAAGGTGG + Intergenic
984823390 4:183904230-183904252 CAGGCAGCACAGCAGGAGGTGGG - Intronic
990247119 5:53874201-53874223 CAGGCCTCACAGCAGGAGGTGGG - Intergenic
992022588 5:72639003-72639025 CAGGCCGCACAGCAGGCGGTGGG - Intergenic
993156228 5:84228007-84228029 CAGGGGGCACATGTGCAGGTTGG - Intronic
994581494 5:101648438-101648460 CAGGCTGCACAATAGGAGGTGGG - Intergenic
994841733 5:104932632-104932654 CAGGCCGCACAGCAGGAGGTGGG - Intergenic
995740178 5:115347809-115347831 CAGGAGGAACAGTTGGATTTGGG + Intergenic
996119295 5:119652777-119652799 TAGGCACCACAGTGGGAGGTTGG + Intergenic
996291287 5:121854852-121854874 CAGGAGGGATAATTGGAGGTGGG + Intergenic
996713732 5:126569049-126569071 CAGGCTGCACAGCAGGAGGTAGG + Intronic
996954179 5:129163896-129163918 GAGGCAGCACAGCTGGGGGTGGG + Intergenic
997223151 5:132187066-132187088 CAGTAGGCACCGTTGGAGCTGGG - Intergenic
998487102 5:142512447-142512469 CAGGCAGCCCATTTGGAGGCCGG - Intergenic
999269798 5:150290079-150290101 AGGGCCCCACAGTTGGAGGTGGG - Intronic
1000527149 5:162371452-162371474 GAGTTGGCACAGTTGGAGGTAGG + Intergenic
1000783995 5:165520826-165520848 CAGGAGGCAGAGTTTGCGGTGGG - Intergenic
1001350917 5:170963734-170963756 CAGGCTGCACAGCAGGAGGTGGG - Intronic
1001989626 5:176105556-176105578 CAGGTGGCACAGGTTGTGGTGGG + Intronic
1002227244 5:177732582-177732604 CAGGTGGCACAGGTTGTGGTGGG - Intronic
1002266898 5:178041188-178041210 CAGGTGGCACAGGTTGTGGTGGG + Intronic
1003141755 6:3477698-3477720 CAGGCCACACAGCAGGAGGTGGG - Intergenic
1003641672 6:7880412-7880434 ACGGAAGCACAGTTGGAGGTGGG + Exonic
1005074378 6:21892110-21892132 CAGGCGGCACACTTGAAGCCAGG - Intergenic
1006078592 6:31550761-31550783 CAGGAGGCAGAGGTTGAGGTGGG - Intronic
1007654779 6:43445522-43445544 CAGGCAGCACTGGGGGAGGTGGG - Intronic
1009000631 6:57708677-57708699 CAGGAGGGCCAGTTGGAGATTGG + Intergenic
1009189094 6:60608104-60608126 CAGGAGGGCCAGTTGGAGATTGG + Intergenic
1012815687 6:104019073-104019095 GAGGTGGAACAGTTAGAGGTGGG + Intergenic
1013437718 6:110128767-110128789 CAGGCTGTACAGCAGGAGGTGGG + Intronic
1013508249 6:110820462-110820484 CAGGCAGCTCACCTGGAGGTCGG - Intronic
1017179836 6:151540857-151540879 CAGGGGGCACAGTCAGAGGCAGG - Intronic
1020066877 7:5195089-5195111 CACCAGGCACAGTTGAAGGTGGG + Intronic
1020100302 7:5390573-5390595 CAGGTGGTTCAGGTGGAGGTAGG + Exonic
1021742081 7:23696970-23696992 CAGGGGGCAGAGCTGGAGGTGGG + Intronic
1023713942 7:43023567-43023589 AAAGCGGCAAAGCTGGAGGTTGG + Intergenic
1028770319 7:94612776-94612798 AAGGAGGAACAGGTGGAGGTGGG - Intronic
1029708979 7:102289335-102289357 CAGGGGGCAAGGGTGGAGGTGGG + Intronic
1031007827 7:116494817-116494839 GTGGGGGGACAGTTGGAGGTGGG + Intronic
1031572439 7:123375921-123375943 CAGGGGGCACATGTGCAGGTTGG - Intergenic
1035754501 8:2021736-2021758 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1035754507 8:2021776-2021798 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1035754513 8:2021816-2021838 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1036749047 8:11431734-11431756 CAGCCTGGACAGTTGGAGGGTGG + Intronic
1036966287 8:13301711-13301733 CAGGCTGCACAGCAGGAGATGGG + Intronic
1037742490 8:21618574-21618596 CAGGCTGCACAGCAGGAGGTGGG + Intergenic
1037953992 8:23039231-23039253 CAGGCCACACAGCAGGAGGTGGG - Intronic
1038055491 8:23853843-23853865 CAGGCAGCAGGGTTGGGGGTGGG + Intronic
1038273222 8:26094349-26094371 CAGGGGGCACCGTGGGAGGTGGG - Intergenic
1038372968 8:27011582-27011604 CAGGGAGCACTGTTGGAAGTGGG + Intergenic
1040600471 8:48878829-48878851 CAGGCAGCCCTGCTGGAGGTGGG - Intergenic
1041106896 8:54453549-54453571 CCGGGGCCACAGTTGGAGGTGGG + Intergenic
1044416460 8:91945581-91945603 CAGGCTGCAAAGCAGGAGGTAGG - Intergenic
1044934210 8:97277678-97277700 CAGGCGGCACAGGTGCAGGCTGG - Exonic
1047301613 8:123618319-123618341 TGGGCGGCACAGCAGGAGGTGGG + Intergenic
1047431425 8:124796566-124796588 GAGGCTGCACAGTCAGAGGTGGG + Intergenic
1049104560 8:140603803-140603825 GAGGCCGCACAGTTGCAGGGTGG - Intronic
1049676371 8:143891085-143891107 CTGGCTGCACAGCTGGGGGTCGG - Intergenic
1050593152 9:7180581-7180603 CAGGAGGCACGGTGTGAGGTAGG + Intergenic
1051339028 9:16094063-16094085 CAGGAGGCATAGTAAGAGGTTGG + Intergenic
1051689578 9:19696012-19696034 CAGGCTGCACAGCAGGAGGTGGG + Intronic
1051900439 9:22032958-22032980 CAGGCTGCACAGCAGAAGGTGGG + Exonic
1052413373 9:28148753-28148775 CAGGGAGCACTGTTGGAAGTGGG - Intronic
1053067342 9:35078029-35078051 CAGGCGGCTGGGTTGGTGGTCGG - Intronic
1053262776 9:36684746-36684768 CAGGGGGCAGGGTGGGAGGTAGG - Intergenic
1053414432 9:37938141-37938163 GAGGCTGCACAGATGCAGGTAGG - Intronic
1056020233 9:82432343-82432365 CAGGGAGCACCGTTGGAAGTGGG + Intergenic
1056201621 9:84282522-84282544 TAGGATGCCCAGTTGGAGGTAGG + Intronic
1057071663 9:92104968-92104990 CAGGGAGCACTGTTGGAAGTGGG - Intronic
1058292945 9:103265747-103265769 AAGGCGGGACAGCTGGAGGCTGG + Intergenic
1061404257 9:130384892-130384914 CAGGAGGCACAGGGGGAGGCTGG + Intronic
1186203785 X:7180487-7180509 CTGGCTGCACAGCAGGAGGTGGG - Intergenic
1187193052 X:17054913-17054935 CTGGCTGCAGAGTTGGAGGGAGG - Exonic
1190055717 X:47180044-47180066 AGGGCGGCACAGTTGGGGGCCGG + Intronic
1190512390 X:51186202-51186224 CAGTCAGCACATTTGGAAGTAGG + Intergenic
1190911527 X:54776060-54776082 CTGGGGGCAGAGTTGGAGGGTGG - Intronic
1192698903 X:73447339-73447361 CAGGCGGCACAGGGGGCGGTGGG + Exonic
1193526204 X:82592540-82592562 CAGGTGGAAGAGTTGGAGTTAGG - Intergenic
1194014726 X:88605112-88605134 CAGCCTGCACACTTGGAGGAAGG + Intergenic
1201226494 Y:11823910-11823932 CAGGAGGCGGAGGTGGAGGTTGG - Intergenic
1201902414 Y:19057164-19057186 CAGGAGGCAGAGTTTGCGGTGGG + Intergenic