ID: 1161063755

View in Genome Browser
Species Human (GRCh38)
Location 19:2227790-2227812
Sequence GTCGGCCGCGGGGCTGCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 113}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161063742_1161063755 20 Left 1161063742 19:2227747-2227769 CCACGCGGTGCCCTCCGCCTCTG 0: 1
1: 0
2: 1
3: 18
4: 212
Right 1161063755 19:2227790-2227812 GTCGGCCGCGGGGCTGCATGTGG 0: 1
1: 0
2: 0
3: 12
4: 113
1161063744_1161063755 9 Left 1161063744 19:2227758-2227780 CCTCCGCCTCTGCTCATCCGTTT 0: 1
1: 0
2: 1
3: 15
4: 125
Right 1161063755 19:2227790-2227812 GTCGGCCGCGGGGCTGCATGTGG 0: 1
1: 0
2: 0
3: 12
4: 113
1161063749_1161063755 -8 Left 1161063749 19:2227775-2227797 CCGTTTGGAGCCCGTGTCGGCCG 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1161063755 19:2227790-2227812 GTCGGCCGCGGGGCTGCATGTGG 0: 1
1: 0
2: 0
3: 12
4: 113
1161063746_1161063755 6 Left 1161063746 19:2227761-2227783 CCGCCTCTGCTCATCCGTTTGGA 0: 1
1: 0
2: 0
3: 7
4: 145
Right 1161063755 19:2227790-2227812 GTCGGCCGCGGGGCTGCATGTGG 0: 1
1: 0
2: 0
3: 12
4: 113
1161063743_1161063755 10 Left 1161063743 19:2227757-2227779 CCCTCCGCCTCTGCTCATCCGTT 0: 1
1: 0
2: 0
3: 9
4: 142
Right 1161063755 19:2227790-2227812 GTCGGCCGCGGGGCTGCATGTGG 0: 1
1: 0
2: 0
3: 12
4: 113
1161063747_1161063755 3 Left 1161063747 19:2227764-2227786 CCTCTGCTCATCCGTTTGGAGCC 0: 1
1: 0
2: 1
3: 5
4: 76
Right 1161063755 19:2227790-2227812 GTCGGCCGCGGGGCTGCATGTGG 0: 1
1: 0
2: 0
3: 12
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161063755 Original CRISPR GTCGGCCGCGGGGCTGCATG TGG Intronic