ID: 1161064103

View in Genome Browser
Species Human (GRCh38)
Location 19:2229123-2229145
Sequence CTTTGAGACCAGAAGGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 409}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161064097_1161064103 11 Left 1161064097 19:2229089-2229111 CCAAGCTGGGCAGGTTAGTGTAG 0: 1
1: 0
2: 0
3: 10
4: 170
Right 1161064103 19:2229123-2229145 CTTTGAGACCAGAAGGAAGTTGG 0: 1
1: 0
2: 4
3: 57
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161064103 Original CRISPR CTTTGAGACCAGAAGGAAGT TGG Intronic
900366120 1:2312640-2312662 CTTCCTGGCCAGAAGGAAGTGGG - Intergenic
900835094 1:4997075-4997097 GTTGGGGACCGGAAGGAAGTGGG + Intergenic
901412959 1:9097804-9097826 CTTGGAGGTCAGAAGGAAGATGG - Intergenic
902840870 1:19073062-19073084 CTCGGAGACCAGCAGAAAGTGGG + Intergenic
903539212 1:24087328-24087350 ATTTGAGACAAGACGGAAGGGGG - Intronic
904252236 1:29233339-29233361 CCTTGAGAGAAGAAGGAAGAAGG - Intergenic
904568890 1:31445733-31445755 CATTGAGACCAGAGGGAAAGAGG - Intergenic
905277813 1:36830283-36830305 CTTTGAGATCACAATGAACTGGG - Intronic
905349230 1:37333135-37333157 CTTAGACATCAGAAGGAAGCTGG - Intergenic
908074383 1:60498082-60498104 CTTGCAGTCCAGAAGGGAGTGGG + Intergenic
908176618 1:61562076-61562098 ATTGAAGACCTGAAGGAAGTAGG + Intergenic
908617044 1:65933273-65933295 CTTGCAGGCCAGAAGGGAGTGGG + Intronic
908618525 1:65949912-65949934 CTTAGAGCCCTGAAGGGAGTGGG - Intronic
909175923 1:72358507-72358529 CTTGCAGACCAGAAGGGAGTGGG + Intergenic
910166214 1:84329957-84329979 CTATGAGAGCAGGAGGCAGTGGG + Intronic
910857867 1:91714074-91714096 CTTTTAGACCAGAAGTGAGTAGG + Intronic
911118542 1:94271902-94271924 CTTTGTGTCCAGAGGCAAGTAGG + Intronic
911185780 1:94903423-94903445 CTTTAAGCCCAGCTGGAAGTTGG + Exonic
912379914 1:109241756-109241778 CTCTGAGACAAGATGGAAGGAGG - Intergenic
912460985 1:109831365-109831387 CTTTGAGGCTAGAAGCAAGATGG - Intergenic
912636898 1:111304059-111304081 TTTAGAGGCCAGAAGGCAGTTGG - Intronic
912890850 1:113528577-113528599 CTTTGAGATTAGCAGGAAATTGG + Intronic
913042699 1:115042754-115042776 CTTACAGGCCAAAAGGAAGTGGG + Intergenic
913189474 1:116401219-116401241 CTGTAAGACCAGGAGGAATTCGG + Exonic
913548042 1:119889085-119889107 CTTGCAGACTAGAAGGAATTGGG + Intergenic
914933336 1:151954886-151954908 GTTTGAGCCCAGAAGGTAGAGGG - Intergenic
915050241 1:153062558-153062580 CTTGGAGATCAGGAGGCAGTAGG - Intergenic
915051360 1:153077169-153077191 CTTGGAGATCAGGAGGTAGTGGG + Intergenic
915054867 1:153118534-153118556 CTTGGAGATCAGGAGGCAGTGGG + Intergenic
915804984 1:158838403-158838425 TTTGTAGACCAGAAGGTAGTGGG - Intronic
916895892 1:169161625-169161647 CTGTGAGGCCAGAAGCAAGATGG - Intronic
917251371 1:173065369-173065391 CTTTCAGGCCAGAAGACAGTAGG + Intergenic
917722965 1:177803516-177803538 CTGTGAGGCCAGAAGCAAGGTGG - Intergenic
918623784 1:186635123-186635145 CTTTGTGACCAATAGAAAGTAGG + Intergenic
919241203 1:194918740-194918762 ATATGAGACCTGAAGGTAGTTGG - Intergenic
919560170 1:199108314-199108336 CTTATAGACCAGAAGGGAGTGGG - Intergenic
921333308 1:214062149-214062171 ATCAGAGACCAGAAGGAAGTAGG - Intergenic
922814834 1:228441206-228441228 CTTTGAAACCAGGAGGGAGAAGG + Intergenic
922870760 1:228900161-228900183 CTTTGAAAGCAGAAAGAAGATGG - Intergenic
924105513 1:240645291-240645313 CTGTGAGACTAGAAGCAAGGTGG + Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1062815197 10:494210-494232 CTTTGACAGCAGAAAGAAGTGGG + Intronic
1063306475 10:4907159-4907181 CTTGGAGGCCAGAAGGCAGTAGG - Intergenic
1064720485 10:18224354-18224376 CTTTGAGACTACAAAGAAATTGG - Intronic
1064885214 10:20103981-20104003 CTTTCAGAGCAGAAGGACATGGG + Intronic
1065082879 10:22144548-22144570 CTTTGCTAACAGAAGAAAGTAGG + Intergenic
1066668746 10:37814707-37814729 CTTGGAGGCCAGAAGGCAGTGGG - Intronic
1066671403 10:37844166-37844188 CATAGAGACCAGAAGGCAGTGGG + Intronic
1067038714 10:42936971-42936993 CTGGGAGACCATAGGGAAGTGGG + Intergenic
1067663411 10:48253435-48253457 CATGGAGACCAAAAGGCAGTTGG + Intronic
1067841671 10:49685661-49685683 CATGGAGGCCAGAAGGCAGTGGG - Intronic
1068262816 10:54605461-54605483 TTTGGAGGCCAGAAGGGAGTTGG - Intronic
1068493331 10:57752367-57752389 CATAGAGACCAGAAGGCAGTGGG - Intergenic
1068671628 10:59729234-59729256 CTCTGATACCAGAAGCAAGGTGG + Intronic
1068771407 10:60825766-60825788 CTTTGAGGCGAGAAGCAAGATGG - Intergenic
1069177300 10:65308776-65308798 CTTTCAGACTAAAAGGAAGGAGG - Intergenic
1070016730 10:72541106-72541128 CTATGAGACTAGAAGCAAGATGG - Intronic
1070284538 10:75073427-75073449 CTTTCACACTAGAAGGAGGTCGG + Intergenic
1070610647 10:77930013-77930035 TTCTAAGACCAGAAGAAAGTAGG - Intergenic
1070816491 10:79327835-79327857 CTTTGGGACTAGGAGGAATTAGG - Intergenic
1070939530 10:80331460-80331482 CTTGGAGGACAGAAGGCAGTGGG + Intergenic
1071788943 10:88933913-88933935 CTTTCAGGCCAAATGGAAGTTGG + Intronic
1072418293 10:95267965-95267987 CTTTGAGACAAGTAGCATGTTGG + Intronic
1072705153 10:97675693-97675715 CTCTGTGATCAGAAGGAAATTGG + Exonic
1073761582 10:106634589-106634611 CTTTCAGACCAAGAGGAAGGTGG + Intronic
1074105647 10:110388028-110388050 CATTGAGAACAGAAGGTAGAAGG + Intergenic
1074484520 10:113861476-113861498 TTTGGAGGCCAGAAGGCAGTGGG + Intronic
1075026257 10:118985730-118985752 TTTGGAGGCCAGAAGGCAGTGGG + Intergenic
1075030560 10:119021915-119021937 CTTAGTGACCAGAAGGCAGGTGG - Intergenic
1076130472 10:128010489-128010511 AGTTGAGAGGAGAAGGAAGTAGG - Intronic
1076168510 10:128301482-128301504 GTTTGTGACAAGAGGGAAGTAGG - Intergenic
1076624116 10:131811127-131811149 CTCTGAGACCAGCAGGGACTCGG + Intergenic
1077694530 11:4382350-4382372 CTGTGAGGCTAGAAGCAAGTCGG + Intergenic
1078433576 11:11306315-11306337 CTTGGTGATCAGAAGGATGTAGG + Intronic
1079483242 11:20906104-20906126 CATGGAGACCAGAAGGCAATGGG + Intronic
1079729765 11:23925370-23925392 CTTTGAGAACAGAGGGAGTTTGG - Intergenic
1080217153 11:29857106-29857128 TTTGGAAGCCAGAAGGAAGTGGG + Intergenic
1080235355 11:30062320-30062342 CATGGAGGCCAGAAGGAAGTGGG + Intergenic
1080868246 11:36214083-36214105 CTTTTAAACCAGAAGGCTGTGGG + Intronic
1081174220 11:39906893-39906915 CATAGATACCAGAGGGAAGTTGG + Intergenic
1081258627 11:40930128-40930150 CTTCTAGTCCAGAAGGTAGTAGG + Intronic
1081817390 11:45955988-45956010 GTTGCAGACCAGAAGGAAATGGG + Intronic
1083030678 11:59589080-59589102 CATAGAGGCCAGAAGGCAGTGGG + Intronic
1083080124 11:60083652-60083674 TTTGCAGACCAGAAGTAAGTGGG - Intergenic
1083484618 11:62975515-62975537 TTTTCAGCCCAGAAGGAAGGAGG + Intronic
1083536775 11:63476532-63476554 AATGGAGACCAGAAGGCAGTGGG - Intronic
1084461433 11:69298705-69298727 CGTGGAGACCAGGAGGAAGCTGG + Intronic
1084839436 11:71832745-71832767 CTTTCAGACCAGGAGAAAGTGGG + Intergenic
1084925959 11:72511401-72511423 CTTTGAGAATGGATGGAAGTAGG - Intergenic
1085225442 11:74915994-74916016 TTTTAAGGCCAGAAGGCAGTGGG - Intronic
1085473901 11:76776625-76776647 TTTGGAGGCCAGAAGGCAGTGGG - Intergenic
1085621637 11:78042125-78042147 CTGTGACACCAGAAGCAAGATGG - Intronic
1085852282 11:80136146-80136168 CTTTCAGACCATAATGGAGTGGG - Intergenic
1087208994 11:95427073-95427095 CTATGAGACCCGAAGGGAGAGGG - Intergenic
1088424799 11:109691765-109691787 CTTTGAGAGGTGAAGAAAGTGGG + Intergenic
1090651737 11:128812797-128812819 GTCTGAGACCTGAAGGAAGCAGG - Exonic
1090925599 11:131247363-131247385 CTTTGTCAACAGAAGGAAGAAGG - Intergenic
1091249653 11:134132245-134132267 CTTGGAGGCCAGAAGGAAGTGGG + Intronic
1091707459 12:2706259-2706281 TTTTGAGGCCAGAAGGCAGCAGG + Intergenic
1092399565 12:8162852-8162874 GTTTCAGACCAGGAGCAAGTGGG - Intronic
1093342886 12:17999763-17999785 CTTACAGACCAGGAGAAAGTAGG + Intergenic
1094459120 12:30674508-30674530 CTTTGAGATCATAATGAAGTGGG - Intronic
1094787363 12:33864018-33864040 CTTCCAGGCCAGGAGGAAGTGGG - Intergenic
1097427403 12:59463846-59463868 CATGGAGACTAGAAGGCAGTAGG + Intergenic
1098175737 12:67788855-67788877 CTTTGAGGCTAGAAGGAAAAAGG + Intergenic
1098289606 12:68945335-68945357 CTGTGAGACTAGAAGCAAGATGG + Intronic
1098372283 12:69773115-69773137 CTTGCAGATCAGGAGGAAGTAGG - Intronic
1098580435 12:72093148-72093170 CTTCCAGACCAGGAGGAAGTGGG - Intronic
1099892416 12:88606137-88606159 CCTAGAGGCCAGAAGAAAGTTGG + Intergenic
1099916632 12:88903208-88903230 CATTGAGATTAGAAGGAAGGTGG + Intergenic
1100162710 12:91879219-91879241 CTTTGAAATCAGATGGAACTGGG + Intergenic
1102493812 12:113305511-113305533 CTTTGAAACCAGATGGTTGTGGG - Intronic
1104923365 12:132302853-132302875 CTTTGAGCCTTGTAGGAAGTGGG + Intronic
1105289338 13:19038627-19038649 CTTTGAGATCAGAATAAAGAGGG + Intergenic
1105867688 13:24475047-24475069 CATACAGACCTGAAGGAAGTGGG - Intronic
1105917424 13:24929448-24929470 CATGGAGGCCAGAAGGCAGTGGG - Intergenic
1106204253 13:27574876-27574898 CATGGAGACTAGAAGGCAGTGGG + Intronic
1106371376 13:29137176-29137198 ATTGGAGGCCAGAAGGCAGTGGG - Intronic
1106612967 13:31301031-31301053 CTGTGAGACTAGAAGCAAGATGG + Intronic
1108717148 13:53092204-53092226 CCTTGAGAAGAGTAGGAAGTGGG + Intergenic
1109177465 13:59173990-59174012 CTTTGTTACCAGAAAGAAGCAGG - Intergenic
1109485806 13:63017216-63017238 CATGGAGAGCAGAAGGAATTAGG + Intergenic
1109814185 13:67557858-67557880 CATGGAGGCCAGAAGGTAGTTGG + Intergenic
1109851401 13:68069838-68069860 TTGGGAGACCAGAAGGTAGTGGG - Intergenic
1110172414 13:72517558-72517580 TTTTGAGATGAGAATGAAGTAGG + Intergenic
1110653545 13:77971167-77971189 CTCTGATACCAGAAGCAAGGTGG + Intergenic
1110888051 13:80663580-80663602 CTTACAGGCCAGAAGGAAGTGGG - Intergenic
1111430145 13:88138619-88138641 CTTTGACTCCAGGAAGAAGTGGG + Intergenic
1111442815 13:88303363-88303385 CGCTCAGAGCAGAAGGAAGTGGG - Intergenic
1112772920 13:102811400-102811422 TTTGGAAGCCAGAAGGAAGTGGG - Intronic
1114237735 14:20836873-20836895 CTTTGAGACAAGAAAGAGGTTGG + Intergenic
1115856392 14:37633735-37633757 CATTGACACCAGAGGGAAGAGGG - Intronic
1115884873 14:37959917-37959939 AATTGAGTGCAGAAGGAAGTGGG + Intronic
1116180908 14:41533334-41533356 TTTGGAGACCACAAGGCAGTGGG - Intergenic
1117003489 14:51395092-51395114 CTTTGGGAACAGTAGGAGGTGGG - Intergenic
1117667332 14:58070288-58070310 CTTTGAGTCAAAAAGGAAGGTGG + Intronic
1117940405 14:60958338-60958360 CTTGCAGACCAGGAGTAAGTGGG - Intronic
1118461467 14:65990985-65991007 GTTTGAGACCAATAGGAGGTAGG - Intronic
1119228498 14:72961979-72962001 CTGTTAGAACAGAGGGAAGTGGG - Intergenic
1120929538 14:89834931-89834953 CATTGTGACCAGAATGAAGCGGG + Intronic
1122185842 14:99994971-99994993 CTTGCAGGCCAGAAGGGAGTGGG - Intronic
1122258680 14:100499682-100499704 TCTTGAGACAGGAAGGAAGTGGG + Intronic
1122304238 14:100751609-100751631 CTCGGAGAACAGAAGGCAGTGGG - Intergenic
1124166095 15:27327364-27327386 ATCTGAGACCACAAGGAAGAGGG + Intronic
1124245204 15:28064117-28064139 CATGGAGGCCAGAAGGCAGTGGG - Intronic
1124449016 15:29767810-29767832 CTTTGAGACCAGAAGGAAAGAGG - Intronic
1124810708 15:32935289-32935311 CTTGCAGACCAGAAGGATATAGG - Intronic
1127892691 15:63269262-63269284 CTGTGAGACCAAGAGGAAGGAGG - Intergenic
1128655952 15:69462244-69462266 CTCCGTGTCCAGAAGGAAGTGGG - Intergenic
1129294505 15:74592498-74592520 CTTGGGGACCAGAAGGAAACTGG + Intronic
1129303889 15:74644256-74644278 TCTTGAGGCCAGAAGGAACTTGG - Intronic
1129679562 15:77650591-77650613 CTTGCAGAACAGGAGGAAGTGGG - Intronic
1129685290 15:77682676-77682698 CTTTGTGCCCAGAAGGGGGTGGG - Intronic
1129913930 15:79251279-79251301 CTTTGAAATCAGAACAAAGTAGG + Intergenic
1130305956 15:82712148-82712170 CTTTGAGATGAGAAGACAGTTGG - Intergenic
1134432568 16:14224653-14224675 CTTGAAGACCAGAAGGCAGTGGG + Intronic
1134741022 16:16545334-16545356 GCTTGAGACCAGAAGGATTTTGG - Intergenic
1134926476 16:18166789-18166811 GCTTGAGACCAGAAGGATTTTGG + Intergenic
1135709358 16:24701826-24701848 CCATAAGACCAGAAGGAAGGAGG - Intergenic
1135985518 16:27181013-27181035 GATTGAGACCAGAGGGCAGTGGG + Intergenic
1136749866 16:32624995-32625017 CTTGGAGGCCAGAAGGCAGTAGG - Intergenic
1137362844 16:47835423-47835445 CTTACAGACCAGAAGGCAGTGGG + Intergenic
1137462788 16:48680529-48680551 CATTGGGAGCAGAAGGAAGGTGG - Intergenic
1137745826 16:50819327-50819349 CTGTGAGGCCAGAAAAAAGTGGG - Intergenic
1138488967 16:57365043-57365065 CTTTGGGAGCACAAGGAAGGTGG - Exonic
1138567056 16:57841289-57841311 ATCTGAGACCTGAAGGAGGTAGG + Intronic
1138819490 16:60241907-60241929 CTTGGAAGCCAGAAGGCAGTGGG - Intergenic
1139011394 16:62638941-62638963 CTTTGAGACCAGCAAGAAAGAGG + Intergenic
1139323760 16:66135613-66135635 CTCTGAGCCCAGAAGGAGTTTGG + Intergenic
1140001507 16:71029874-71029896 CTGTGAGCCCAGAAGGCAGGGGG + Intronic
1140177114 16:72673404-72673426 TATGGAGGCCAGAAGGAAGTGGG + Intergenic
1140557962 16:75943365-75943387 CTTGGTGAAAAGAAGGAAGTGGG + Intergenic
1140766563 16:78164943-78164965 ATCTGAGACCTGAATGAAGTAGG + Intronic
1141076947 16:81015336-81015358 CTGTGAGCCCTGGAGGAAGTTGG + Intronic
1203052000 16_KI270728v1_random:884193-884215 CTTGGAGGCCAGAAGGCAGTAGG - Intergenic
1143022746 17:3925221-3925243 CTCCCAGGCCAGAAGGAAGTGGG + Intronic
1143396097 17:6598503-6598525 GTTTCAGAGCAGAAGGAAATTGG - Intronic
1143993215 17:10984756-10984778 CTCTGAGACTAGAAGGATTTGGG - Intergenic
1144765111 17:17728341-17728363 CTTGGAGACCAGAGGGAAGACGG - Intronic
1145073090 17:19828082-19828104 TCTTGAGGCCAGAAGGCAGTGGG + Intronic
1145079015 17:19879294-19879316 CTTTGGGAGGAGAAGGCAGTAGG - Intergenic
1146127277 17:30239172-30239194 CTTTGAGACTTCCAGGAAGTGGG - Intergenic
1146596416 17:34173000-34173022 CTGTGAGGCTAGAAGGAAGATGG + Intronic
1147205587 17:38835186-38835208 CTGTTAGAACAGAGGGAAGTGGG + Exonic
1150921228 17:69485675-69485697 CTTTAAGACAAGAAGGAAAAGGG - Intronic
1151207046 17:72515489-72515511 CTTGGAAACCAGATGGAAATAGG - Intergenic
1151324163 17:73368594-73368616 CTGTGGGAACAGAAGGATGTGGG + Intronic
1151572450 17:74933646-74933668 CTCTGGGACCAGAAGGAAATGGG - Exonic
1152387902 17:79986164-79986186 CTTTGGGACCACGAGGAAATTGG - Intronic
1157420546 18:47544317-47544339 CTTTGAGAGCAGGAGGCAATTGG - Intergenic
1158233090 18:55280554-55280576 CTTTGAGAGCAAAAGAAAATGGG - Intronic
1159150924 18:64522863-64522885 CTTTGATTCCAGATGAAAGTGGG + Intergenic
1161064103 19:2229123-2229145 CTTTGAGACCAGAAGGAAGTTGG + Intronic
1164929993 19:32168101-32168123 CTTTGGGCTCAGAAGGAAGCAGG - Intergenic
1165275794 19:34750346-34750368 CTTGGAAGCTAGAAGGAAGTGGG + Intergenic
1165344338 19:35234770-35234792 ATTTGAAACCAGAAGGATGGAGG - Intergenic
1165542260 19:36501679-36501701 CTTGCAGGCCAGAAGGGAGTGGG - Intergenic
1165798833 19:38535331-38535353 CTTAAGGACAAGAAGGAAGTTGG + Exonic
1167396552 19:49233172-49233194 CTTTGACAGCAGGAGGAACTGGG + Intergenic
925937019 2:8773931-8773953 CTAAGAGACCTGAATGAAGTGGG - Intronic
926007532 2:9384308-9384330 CTGTGAGGCCAGAAGCAAGATGG + Intronic
926237569 2:11057370-11057392 TGCAGAGACCAGAAGGAAGTTGG - Intergenic
926395528 2:12438562-12438584 CTTTGAAGCCAGAAGTAACTGGG + Intergenic
926909088 2:17833140-17833162 CTTTTAAACCAAAAGAAAGTAGG + Intergenic
927204280 2:20597196-20597218 CTCTGAGCCCAGCAGGAAGCAGG + Intronic
927522101 2:23705184-23705206 CTCTGAGACTAGAAGTAAATGGG + Intronic
927946577 2:27138332-27138354 CCTTGAATCCAGAAGGAACTGGG + Exonic
927955812 2:27206648-27206670 ATTTGAGAGGAGAAGGAAGAGGG - Intronic
928931194 2:36626103-36626125 CTGTGAGACTAGAAGCAAGATGG + Intronic
929065193 2:37965935-37965957 CTTGCAAACCAGAAGGCAGTGGG - Intronic
929177637 2:38997635-38997657 CATGGAGGCCAGAAGGCAGTGGG + Intronic
929440079 2:41958688-41958710 CTTTGGGACCAGAATGGGGTAGG + Intergenic
929766072 2:44844953-44844975 ATTGGAGACCAGAAGCCAGTTGG + Intergenic
930911845 2:56638316-56638338 CATTGAGACCAGGAGGAAGAAGG + Intergenic
930990933 2:57653617-57653639 CATAGAGACCAGAAGGTAGTGGG - Intergenic
931441111 2:62291259-62291281 CTGTGAGGCCAGAAGCAAGATGG - Intergenic
931533536 2:63245455-63245477 CTTGGAGAGCAGAAGGGTGTTGG + Intronic
932967416 2:76492826-76492848 TTTTGTTACCAAAAGGAAGTAGG + Intergenic
933051244 2:77605324-77605346 CTTGGAGATCAGAAGCAAGATGG - Intergenic
933138936 2:78769669-78769691 CTTTGAGGCTAGAAGCAAGATGG - Intergenic
933577943 2:84091443-84091465 CATGGAGACCAGAAGACAGTAGG + Intergenic
934521452 2:95022645-95022667 CTCTGGGAACACAAGGAAGTGGG - Intergenic
934982540 2:98856282-98856304 ATTGGAGACCAGAAAGCAGTAGG + Intronic
935254025 2:101292399-101292421 CTTTGAGAACACAAGTAAATTGG - Intronic
937610329 2:123853390-123853412 CTTTGTGGTCAGAAGGCAGTGGG + Intergenic
937722255 2:125115112-125115134 CCTAGAGACCAGAAGGCAGTTGG + Intergenic
937738806 2:125323734-125323756 CTTGCAGACCAGAAGGTGGTTGG + Intergenic
938844021 2:135189749-135189771 CTTGGAGGCCAGAAGGCAGTAGG + Intronic
938987665 2:136595020-136595042 CTTGAAGGCCAGAAGGTAGTGGG - Intergenic
941619904 2:167765400-167765422 TTGTGAGTCCAGGAGGAAGTGGG + Intergenic
941729890 2:168905825-168905847 CTTTGAAAGAAGAAGTAAGTGGG - Intronic
941960116 2:171245222-171245244 CTGTGAGACTAGAAGCAAGATGG - Intergenic
942057009 2:172193447-172193469 CATGGAGGCCAGAAGGCAGTGGG - Intergenic
942612654 2:177757915-177757937 CATTGAGACTAAAAGGAATTAGG - Intronic
943101073 2:183487189-183487211 CTTTGAGACCACCAGCAAGAAGG - Intergenic
944083065 2:195811855-195811877 CTGTGAGGCCAGAAGCAAGATGG - Intronic
944162971 2:196685952-196685974 AGTTGAGGCCAGAAGGCAGTGGG - Intronic
945437317 2:209833976-209833998 TTTGGAGGCAAGAAGGAAGTTGG - Intronic
945822465 2:214681327-214681349 CATAGAGAACAGAAGGAAATTGG + Intergenic
946527273 2:220534510-220534532 CTTGGAGATCAGAAGCAAGATGG - Intergenic
947208208 2:227681921-227681943 CTTTGAGAGGTGAAGGCAGTAGG - Intergenic
948467563 2:238159463-238159485 CTTTTGGGACAGAAGGAAGTTGG + Intronic
948570940 2:238916761-238916783 CTCTGGGACTAGAAGGAAGGTGG + Intergenic
948733446 2:239982020-239982042 CTATTAGAGCAGAAGGTAGTTGG - Intronic
1170803453 20:19609826-19609848 CTTTGAGACCACAAAGAGTTTGG + Intronic
1170901134 20:20464532-20464554 CTTGCAGACAAGAAGGAAGTGGG - Intronic
1170981183 20:21214466-21214488 CTTTGAGACCAAGAGGAATGTGG + Intronic
1171207831 20:23294822-23294844 ATTTGAGAGCTGGAGGAAGTGGG - Intergenic
1171289010 20:23969493-23969515 CATTGAGGCCAGAGGGAAGATGG + Intergenic
1171441587 20:25167738-25167760 CTTACAAACCAGAAGAAAGTGGG + Intergenic
1171500937 20:25592833-25592855 CTTAGAGGCCAGAGAGAAGTGGG + Intergenic
1173162558 20:40663544-40663566 CTTTGAAAACAGTATGAAGTAGG - Intergenic
1173657725 20:44711894-44711916 CTCTGAGGCAAGAAGGAAGACGG - Intergenic
1174230357 20:49041095-49041117 CTTTGAGACCACACTGCAGTTGG - Intergenic
1174946233 20:54988661-54988683 ATTTGAGAACACAAGGAAATTGG - Intergenic
1175512542 20:59541851-59541873 CATATAGACCAGGAGGAAGTAGG - Intergenic
1176933231 21:14838909-14838931 CTGTAAGACCAGAAGGAAGGTGG + Intergenic
1178094732 21:29202100-29202122 CATTGAGATCAGAAGGAAATGGG - Intronic
1179085977 21:38218144-38218166 CTTTGAGAGGACAAGGAAGGAGG + Intronic
1179410943 21:41162774-41162796 CTTTGGGACCAGAGGGAAGTAGG - Intergenic
1182620417 22:31615594-31615616 ATTTGAGAAGAGTAGGAAGTCGG + Intronic
1183601321 22:38842301-38842323 CTTCCAGACCACAAGGAAGGGGG - Intronic
1183617401 22:38954023-38954045 CTTTGCCACCAGAAGGAGTTGGG - Intronic
1183717727 22:39543666-39543688 CTTTGAGCCCAGCAGGAAGATGG - Intergenic
1183874189 22:40764929-40764951 CTTTGAGAGCATGAGGAAGTGGG - Intergenic
1184635618 22:45826605-45826627 TTTGGAGGCCAGAAGGCAGTGGG + Intronic
1184892102 22:47386349-47386371 CGTGGGGACCAGAAGGAAGGGGG + Intergenic
1184892332 22:47387607-47387629 CGTGGGGACCAGAAGGAAGGGGG + Intergenic
949452204 3:4198311-4198333 GTGTGACACCAGAAGGAAATGGG + Intronic
950706827 3:14788064-14788086 CTTGGAAAGCAGAAGGAACTAGG - Intergenic
951358713 3:21700250-21700272 TATAGGGACCAGAAGGAAGTGGG + Intronic
952255104 3:31688205-31688227 GTGTGAGACCAGAGGGAGGTGGG - Intronic
953719148 3:45340162-45340184 CATTGAAAATAGAAGGAAGTTGG - Intergenic
953727015 3:45408383-45408405 CTTTGAGATCAGAGAGGAGTGGG - Intronic
955676343 3:61452863-61452885 CTCTGAGGCCAGAAGGAATTTGG - Intergenic
957477310 3:80741146-80741168 CTTTGACATCAAAAGGAAGAGGG + Intergenic
958018661 3:87971160-87971182 ATTTGAGGCCAGAAAGAAGAAGG - Intergenic
959196052 3:103184037-103184059 TTTAGAGATCAGAAGGGAGTGGG - Intergenic
959346584 3:105202646-105202668 ATTGGAGGCCAGAAGGAAGTGGG - Intergenic
959749473 3:109816092-109816114 TTTGGAGACCAGAAGGCAATGGG + Intergenic
959916580 3:111823138-111823160 CTAAGGGACCAGGAGGAAGTGGG + Intronic
960014861 3:112875711-112875733 CTTAGAGCCCAGAAGGTAGTGGG - Intergenic
960063915 3:113350712-113350734 CTTTGCTAGCAGAAGAAAGTGGG + Intronic
960713151 3:120551193-120551215 CTTTGAGATCAGAGTGAAGGTGG + Intergenic
960842598 3:121975406-121975428 CTTGGAGATCAGAAGCAAGATGG + Intergenic
961796920 3:129415717-129415739 CATTGAGACTGGTAGGAAGTGGG - Intronic
962368060 3:134798616-134798638 CTTTGTGTCCAGAAGGCAGGAGG - Intronic
962628685 3:137253276-137253298 CTTTGCAGCCAGGAGGAAGTGGG + Intergenic
962789860 3:138801485-138801507 CTTTGAGACACTAAGGAAGGAGG + Intronic
964521081 3:157568095-157568117 CTTGCAGGCCAGAAGGAAGTGGG - Intronic
965122858 3:164585511-164585533 TTTGGAGGCCAGAAGGTAGTGGG + Intergenic
965682601 3:171266838-171266860 TTTGGAGAACAGAAGGAAGCCGG - Intronic
965738436 3:171847487-171847509 CTTTGACACCATCAGGCAGTTGG - Intronic
966058874 3:175731720-175731742 CTTTGTTGCCAGAAGGTAGTTGG + Intronic
966509810 3:180749322-180749344 CTTTAAGAGCAGAAGGAGGGTGG + Intronic
966535233 3:181025373-181025395 CTTGGAGGCCAGAAGGGAGTGGG - Intergenic
967596656 3:191332783-191332805 CTTGGAGAGCAAAAGGAAGTAGG - Intronic
969060281 4:4428610-4428632 CTTTGAGACTAGAGGGTAGAAGG - Intronic
969354468 4:6617357-6617379 CTTTGGGGACAGAAGGAAGGTGG - Intronic
969780521 4:9398751-9398773 CTTTCAGACCAGGAGCAAGTGGG + Intergenic
970889869 4:21031072-21031094 CTTGGAGACCAGATGGAAGATGG - Intronic
972682142 4:41316312-41316334 CTTGGAGATCAGAAGCAAGATGG + Intergenic
972920442 4:43933910-43933932 CTTTTAGACAAGAATGAAGAAGG - Intergenic
973301573 4:48591049-48591071 CTTAGAGACAATAAGGAAGCTGG - Intronic
975581630 4:75912004-75912026 CTGTGAGGCTAGAAGGAAGATGG + Intergenic
978074678 4:104513861-104513883 CTAAGAGAACAGAAGGAAATAGG - Intergenic
978230762 4:106395754-106395776 TTTGGAGGCCAGAAGGCAGTGGG - Intergenic
979949274 4:126872646-126872668 CATCAAGACCAGAAGGAAATGGG + Intergenic
980613386 4:135186123-135186145 CTTTGAGAGCCGAAGGGAGGAGG - Intergenic
981570156 4:146143063-146143085 CTCTGAGTCCAGAAGTAGGTGGG - Intergenic
981643856 4:146975676-146975698 CTCTGAGACCAGATGGCAGATGG + Intergenic
982424511 4:155242553-155242575 CCTTGAGACCTGTAGAAAGTGGG - Intergenic
982564777 4:156972329-156972351 GTTTCAGAACAGAAGGAAGAAGG + Intergenic
982837520 4:160140111-160140133 CATACAGACAAGAAGGAAGTTGG + Intergenic
984369564 4:178845215-178845237 CATGGAGGCCAGAAGGCAGTGGG + Intergenic
985162795 4:187061863-187061885 CATGGAGAACTGAAGGAAGTGGG - Intergenic
989582426 5:43045330-43045352 CTGTAAGACCAGAAGGCAATTGG - Intergenic
990305079 5:54486470-54486492 CTTTGATATCAGAATGATGTTGG + Intergenic
990325545 5:54671880-54671902 CTGTGAGACTAGAAGCAAGATGG - Intergenic
990444093 5:55877666-55877688 CTTAGAGCCCAGAAGGCAGTGGG - Intronic
991402548 5:66268835-66268857 CATGGAGGCCAGAAGGCAGTGGG - Intergenic
992094334 5:73347240-73347262 CATGGAGGCCAGAAGGCAGTAGG + Intergenic
993188595 5:84652362-84652384 CATTGAGCCCTGAAGGAAATTGG - Intergenic
993189182 5:84659324-84659346 CATTGAGCCCTGAAGGAAATTGG - Intergenic
993329421 5:86579457-86579479 CTAGGAGACCAGTAGGAAGGGGG - Intergenic
995105466 5:108372591-108372613 CATGGAGACCAGAAGGCAGTGGG + Intronic
995564869 5:113423822-113423844 CCCTGAGTCCAGAAGCAAGTGGG - Intronic
996452869 5:123646804-123646826 CATTGAGAATAGAAGTAAGTGGG - Intergenic
996492301 5:124111943-124111965 CTTTGTTCCCAGAAGGAAGAAGG - Intergenic
997764706 5:136489448-136489470 CATGGAGACCAGAAGGCAGTGGG - Intergenic
998949729 5:147381225-147381247 TTTGGAGGCCAGAAGGCAGTGGG - Intronic
999023575 5:148198775-148198797 CTTTGAGTCCAGATAGATGTGGG - Intergenic
999579191 5:153015635-153015657 TTTGCAGACCAGAAGGAAGTGGG + Intergenic
1000111792 5:158115117-158115139 CTTTGAATCCAGGAGGAAGGTGG + Intergenic
1001408184 5:171491364-171491386 CTCTGAGACCAGAAGTGATTGGG - Intergenic
1001418637 5:171569230-171569252 TTTGGAGGCCAGAAGGCAGTGGG - Intergenic
1001432462 5:171673768-171673790 CTTTGAGGCCAGAATGAAATTGG - Intergenic
1002572312 5:180149032-180149054 CTTAGAGGCCAGAAGGCAATCGG - Intronic
1004198090 6:13523870-13523892 CTCTCAGAACAGAAGGCAGTTGG - Intergenic
1004970605 6:20905754-20905776 CTTGGAGCCCAGAAGCCAGTGGG + Intronic
1005526708 6:26658579-26658601 TTTTGAAACCAAAAGGAAGATGG - Exonic
1007805616 6:44443180-44443202 CTTTCAGGCCAGAAGGGAGTGGG - Intronic
1008043665 6:46829691-46829713 CTCTGAGAAGAGAAGAAAGTGGG - Intronic
1008499252 6:52164380-52164402 CTTTGTGACAAGGAGGAAGAGGG + Intergenic
1009311729 6:62162401-62162423 TATAGAGACCAGAAGGCAGTGGG - Intronic
1009769564 6:68127493-68127515 CATGGAGGACAGAAGGAAGTAGG - Intergenic
1009910995 6:69926938-69926960 CATGGAGACCAGAAGGCAGTGGG + Intronic
1009975888 6:70670162-70670184 TTTTGAGAAGTGAAGGAAGTGGG + Intronic
1010666298 6:78633775-78633797 CTTAGAGACCAGAAATAAGTGGG - Intergenic
1012660035 6:101876763-101876785 ATTTGAGAACAGAAGGATGCTGG - Intronic
1012945992 6:105466323-105466345 CTTTGGGACCAGATAGAAGCTGG - Intergenic
1013431880 6:110063082-110063104 CTCTGAGAACAGAAGTAACTTGG + Intergenic
1013680709 6:112522411-112522433 CTGTGAGGCTAGAAGGAAGATGG - Intergenic
1013978165 6:116100620-116100642 CTAGGAGCCCAGAAGGCAGTAGG - Intergenic
1014664240 6:124216504-124216526 GTTTGAGAGCAGAAAGAAGAAGG - Intronic
1017536722 6:155354775-155354797 CTTGTAGGCCAGGAGGAAGTGGG + Intergenic
1017883360 6:158577753-158577775 TTTGGAGACCAGAAGTCAGTGGG + Intronic
1017898834 6:158703599-158703621 ATTTGAGAACTCAAGGAAGTTGG - Intronic
1017975677 6:159355200-159355222 CTTGGAGATCAGAAGCAAGATGG - Intergenic
1018227345 6:161641040-161641062 CTTGGAGATGAGAAGGAAGATGG - Intronic
1018922353 6:168184116-168184138 CTCTGGGACCAGAAGGAGGAAGG + Intergenic
1020727963 7:11840771-11840793 CTTATAGGCCAGGAGGAAGTGGG - Intergenic
1020762695 7:12288192-12288214 CTTTAAGACTATAAGGCAGTGGG + Intergenic
1021420963 7:20444251-20444273 CTGTGAGACTAGAAGCAAGAAGG - Intergenic
1021909295 7:25368402-25368424 CTTCGAGAACAGAAGGTAGGAGG - Intergenic
1022270020 7:28797809-28797831 CTTTGATACCTAGAGGAAGTTGG + Intronic
1022599931 7:31748145-31748167 CTTGGAGATCAGAAGCAAGAGGG + Intergenic
1022966211 7:35475124-35475146 CTTGGAGGCCTGAAGGCAGTGGG + Intergenic
1023487271 7:40700470-40700492 CTTGGAAACCAGAAAGAAATAGG + Intronic
1024037238 7:45517898-45517920 CATGGAGACCAGAAATAAGTTGG + Intergenic
1024050077 7:45613835-45613857 CTTGCAGGCCAGAAGGGAGTGGG + Intronic
1024407168 7:48995102-48995124 CTTTGAAGCCAGAAGCAAGAGGG + Intergenic
1025846180 7:65200295-65200317 CCTAGAGCCCAGAAGGAAGCTGG + Intergenic
1026023827 7:66729972-66729994 CTTTGAGATCTGAAGTAAGGGGG - Intronic
1026065638 7:67070053-67070075 CATGGAGGCCAGAAGGCAGTGGG - Intronic
1026351928 7:69524681-69524703 CATGGAGCCCAGAAGGCAGTGGG - Intergenic
1026541957 7:71287450-71287472 CTATGAGACGAGAGGGAGGTGGG - Intronic
1026634803 7:72072331-72072353 TTTAGAGGCCAGAAGGCAGTGGG + Intronic
1026660544 7:72298324-72298346 CTTTGAGATGAGATGGAAGATGG - Intronic
1026711237 7:72741807-72741829 CATGGAGGCCAGAAGGCAGTGGG + Intronic
1027547517 7:79546914-79546936 ATATGAAACCAGAAGGCAGTGGG - Intergenic
1027637673 7:80695187-80695209 CTTGCAGACCAGGAGAAAGTTGG + Intergenic
1028706965 7:93860355-93860377 CATGGAGGCCAGAAGAAAGTAGG + Intronic
1028825305 7:95265636-95265658 CATTTACACCAGAAGGAAGCTGG - Intronic
1029526463 7:101097607-101097629 CTTAGGGACCAGATGGAAGAGGG + Intergenic
1030011079 7:105168444-105168466 CTTTGAGACCAGAAGTGTTTTGG - Intronic
1031325728 7:120394733-120394755 CTGTGAGACTAGAAGTAAGATGG + Intronic
1032003615 7:128282737-128282759 GTTTGAGACCAGAAGGCAGGGGG + Intergenic
1032183679 7:129704561-129704583 GTTTGGGACCAGAAGTACGTTGG + Intronic
1032503388 7:132417120-132417142 CTTTGAGGCCAGGGGGAAGCGGG - Intronic
1032582528 7:133116562-133116584 CTTAGAGACAAGAAGGGTGTGGG - Intergenic
1032638901 7:133742919-133742941 CTTTGCCACCAGAGGGCAGTTGG - Intronic
1032642362 7:133783983-133784005 CTTTAAGAGCAGAAGGATGGGGG - Intronic
1032782472 7:135175035-135175057 CTCTGATACCAGGAGGAAGGTGG - Intergenic
1033074949 7:138240118-138240140 CTGTGCGGCCAGAAGGAAGATGG + Intergenic
1033337736 7:140467643-140467665 GTTTGAGACCAGAGGAAATTAGG - Intronic
1033341829 7:140498106-140498128 CTTGGAGATTAGAAGCAAGTTGG + Intergenic
1034044978 7:147918078-147918100 CTTTGAGACCCTCAGGAAGCAGG - Intronic
1036159857 8:6377268-6377290 CTTGGAGGCCAGAAGGCAGTGGG + Intergenic
1036277953 8:7372691-7372713 GTTTCAGACCAGGAGCAAGTGGG + Intronic
1036343570 8:7939201-7939223 GTTTCAGACCAGGAGCAAGTGGG - Intronic
1036519874 8:9481398-9481420 CTTGCAGGCCAGAAGGCAGTGGG + Intergenic
1036582993 8:10093931-10093953 CATGGAGACCAGAAAGCAGTGGG - Intronic
1036838914 8:12099970-12099992 GTTTCAGACCAGGAGCAAGTGGG - Intergenic
1036860703 8:12346213-12346235 GTTTCAGACCAGGAGCAAGTGGG - Intergenic
1037161783 8:15781546-15781568 CTTGCAGGCCAGAAGGAAGTGGG + Intergenic
1037528970 8:19756310-19756332 CTTTGAAACCAGAAGAAAAGTGG + Intronic
1037953247 8:23033032-23033054 CATAGAGCCCAGAAGGGAGTGGG + Intronic
1038744373 8:30244329-30244351 CATGGAGACCAGAAGGCACTGGG + Intergenic
1039207283 8:35171436-35171458 CTTCCAAACCAGAAGGAATTGGG + Intergenic
1039541954 8:38380613-38380635 GTTTGCAACCAGAAGGAAGAGGG + Intronic
1041306011 8:56461735-56461757 CTGTGAAAGTAGAAGGAAGTGGG - Intergenic
1044233103 8:89801464-89801486 CTGTGAGACTAGAAGCAAGAGGG - Intergenic
1046287573 8:112114888-112114910 CTTGGAGATCAGAAGCAAGATGG - Intergenic
1047251237 8:123183167-123183189 CTCTGAGGCCACAGGGAAGTAGG - Exonic
1047629260 8:126689001-126689023 ACCTGAGATCAGAAGGAAGTAGG - Intergenic
1047828497 8:128605442-128605464 CCTTGAGACAGGAAGGAACTTGG + Intergenic
1048204169 8:132402230-132402252 CATTAAGCCAAGAAGGAAGTTGG - Intronic
1048334052 8:133490094-133490116 CTTTGGGCAGAGAAGGAAGTTGG + Intronic
1049341431 8:142114646-142114668 CTTTGAGAGAAGAAGGAAGAAGG + Intergenic
1049648691 8:143752293-143752315 CTTGGAGGCCAGAAGGCAGAGGG - Intergenic
1049950013 9:634741-634763 CTGTGAGGCCAGAAGCAAGATGG + Intronic
1050402622 9:5271964-5271986 CCTAGAGACCTGAAGGAGGTAGG - Intergenic
1050980933 9:12014693-12014715 CTTGGAGGCCAAAAGGAAGTGGG + Intergenic
1052471468 9:28901136-28901158 CTTATAGACCAGGAGAAAGTAGG + Intergenic
1052887084 9:33660159-33660181 CTCTGGGACCACATGGAAGTAGG - Intergenic
1053172185 9:35896042-35896064 CTTTGGGGCCAGAAGGAACCAGG + Intergenic
1053368122 9:37538152-37538174 CTTTGAGATTAGAAGGATGGAGG - Intronic
1053593273 9:39534193-39534215 CCCTGAGATCAGAAGAAAGTGGG + Intergenic
1053851006 9:42288901-42288923 CCCTGAGATCAGAAGAAAGTGGG + Intergenic
1054573033 9:66831084-66831106 CCCTGAGATCAGAAGAAAGTGGG - Intergenic
1054764300 9:69030356-69030378 CTATGAGACTAGAAGCAAGATGG + Intergenic
1056582260 9:87898365-87898387 CTTAGAAACCAGAAGTCAGTAGG + Intergenic
1056669552 9:88614599-88614621 CTTCTAGGCCAGGAGGAAGTTGG - Intergenic
1057239385 9:93394912-93394934 TTTGGAGGCCAGAAGGAAGTGGG - Intergenic
1057682242 9:97199778-97199800 TTTTGAAACCAAAAGGAAGATGG - Intergenic
1057760343 9:97868645-97868667 CTTAAAGGCCAGAAGAAAGTGGG - Intergenic
1058987224 9:110219543-110219565 CTTTGAGAACAGAACAAAGTAGG - Intergenic
1059582842 9:115570268-115570290 CTTGCAGACCAGTAGGTAGTTGG + Intergenic
1060673861 9:125494695-125494717 CTTTGAGATGAGAAGGAGCTTGG - Intronic
1061750885 9:132776312-132776334 CTTTGAGGTCAGAAGGGAGGCGG - Intronic
1062072064 9:134561408-134561430 CTTTGGAACAAGAAAGAAGTGGG + Intergenic
1188043042 X:25392715-25392737 CTTTGAGAAGAAAAGGATGTGGG + Intergenic
1188331826 X:28882254-28882276 CTTGCAGACCGGAAGGGAGTGGG + Intronic
1188393211 X:29646780-29646802 CTTACAGACCAGAAGAGAGTGGG + Intronic
1189189300 X:39084118-39084140 CTTGGAGGCCAGAAGGAAGTGGG + Intergenic
1189448791 X:41107357-41107379 CTTGAAGGCCAGAAGGCAGTGGG - Intronic
1189453142 X:41158398-41158420 CATTGAGGCCAGAAGGCAGTAGG + Intronic
1190990559 X:55545389-55545411 CATGGAGGCCAGAAGGCAGTGGG - Intergenic
1191634029 X:63356457-63356479 CTTTCAGGCCAGGAGGGAGTGGG + Intergenic
1192640169 X:72854573-72854595 TTTGCAGACCAGAAGCAAGTAGG + Intergenic
1192641542 X:72866232-72866254 TTTGCAGACCAGAAGCAAGTAGG - Intergenic
1193160279 X:78220452-78220474 CTTGGAGGCCAGAAGACAGTGGG + Intergenic
1193519829 X:82515080-82515102 CTTGGAGGCCAGAAAGTAGTGGG - Intergenic
1193970220 X:88041244-88041266 CTTACAGACCAGAAGCAAATGGG + Intergenic
1196260932 X:113580511-113580533 CTTGTAGTCCAGAAGGAAGAGGG - Intergenic
1196649050 X:118150202-118150224 CTTGGAGGCCAGAAGCAAGATGG - Intergenic
1197398534 X:125959204-125959226 CTTGGAGGCCATAAGGCAGTAGG + Intergenic
1197494124 X:127155850-127155872 TTTGAAGACCAGAAGGAAGTGGG - Intergenic
1197577362 X:128231947-128231969 TTTTGAGTCCAAAAGGCAGTGGG + Intergenic
1198444518 X:136698576-136698598 CTTGGAGGCCAGAAGGCAGTGGG + Intronic
1198581497 X:138069993-138070015 CATGGAGACCAGAAGACAGTGGG - Intergenic
1199688303 X:150284355-150284377 CATGGAGGCCAGAAGGTAGTGGG + Intergenic
1199717333 X:150515934-150515956 CTTTATGACCAGGAGGAATTTGG - Intergenic
1200315639 X:155129954-155129976 CATAGAGGCCAGAAGGCAGTGGG + Intronic
1200650118 Y:5831031-5831053 CTTAGAGACAAGAAGCAAGATGG + Intergenic
1201349649 Y:13025562-13025584 CTTGGAGGCAAGAAGGAAATAGG - Intergenic
1202174150 Y:22082105-22082127 TCTTGAGGCCAGAAGGAAGAAGG - Exonic
1202217210 Y:22504277-22504299 TCTTGAGGCCAGAAGGAAGAAGG + Exonic
1202325976 Y:23691782-23691804 TCTTGAGGCCAGAAGGAAGAAGG - Intergenic
1202544795 Y:25978272-25978294 TCTTGAGGCCAGAAGGAAGAAGG + Intergenic