ID: 1161066503

View in Genome Browser
Species Human (GRCh38)
Location 19:2241093-2241115
Sequence GGTCCAGGAGAGGCCACGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161066495_1161066503 19 Left 1161066495 19:2241051-2241073 CCAGTGATGGCTCTGCAGAGCTT 0: 1
1: 0
2: 0
3: 23
4: 153
Right 1161066503 19:2241093-2241115 GGTCCAGGAGAGGCCACGACAGG 0: 1
1: 0
2: 0
3: 12
4: 181
1161066500_1161066503 -6 Left 1161066500 19:2241076-2241098 CCTCAGAGTAGGGGCGTGGTCCA 0: 1
1: 0
2: 1
3: 3
4: 84
Right 1161066503 19:2241093-2241115 GGTCCAGGAGAGGCCACGACAGG 0: 1
1: 0
2: 0
3: 12
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161066503 Original CRISPR GGTCCAGGAGAGGCCACGAC AGG Intronic
900620997 1:3587913-3587935 GGGGCAGGAGAGGCCAGGAGGGG + Intronic
900621028 1:3587983-3588005 GGGGCAGGAGAGGCCAGGAGGGG + Intronic
900621216 1:3588433-3588455 GGGGCAGGAGAGGCCAGGAGGGG + Intronic
901023549 1:6267303-6267325 GGACCAGGAGGGGCCAAGAGAGG + Intronic
901262767 1:7885844-7885866 GGCCCAGGAGAGGCAAGGAGGGG + Intergenic
901416341 1:9119472-9119494 GGTCCAGGTGAGGGCAGGACTGG - Intronic
901642273 1:10698777-10698799 GAGCCAGGAGAGCCCACGAGAGG - Intronic
902398653 1:16145633-16145655 GGTCCTGGAGAGGGCACTGCTGG - Intronic
902489334 1:16769620-16769642 GGGCCATGAGAGGCCATGAAGGG - Intronic
903138759 1:21326233-21326255 GGTACAGGAGGGGCCACAAATGG + Intronic
903280764 1:22248669-22248691 GGGCCAGCAGTGGCCATGACGGG + Intergenic
903563991 1:24250645-24250667 GGTCTCGGAGAGGCCACGCAGGG + Intergenic
904364104 1:29999632-29999654 GGTCAAGGAGGGGCCAAGGCTGG - Intergenic
905202190 1:36322745-36322767 GGTCACGGAGAGGCCCGGACGGG + Intronic
907246940 1:53114678-53114700 GGTCCCCCAGAGGCCAGGACGGG - Intronic
908806518 1:67938192-67938214 GGTCAAGGATAGGCCACGGTAGG - Intergenic
909973884 1:82022784-82022806 GGTCTAGGAGAGTCCCAGACTGG + Intergenic
911522979 1:98950793-98950815 GCTACATGAGAGGCCAAGACGGG - Intronic
915705242 1:157837539-157837561 GCACCAGGAGAGGCCACGTTTGG + Intronic
915828688 1:159105220-159105242 GCTCCATGTGAGGCTACGACTGG + Intronic
917289191 1:173454696-173454718 GCTCCAGGAGAGGCAATTACAGG + Intergenic
917498285 1:175562687-175562709 GGCTCAGTAGAGGCCACTACTGG + Intronic
920273923 1:204789884-204789906 AATCCAGGAGAGGCAAGGACTGG - Intergenic
921440579 1:215181851-215181873 AGGCCAGGGGAGGCCACGATAGG + Intronic
921925396 1:220706633-220706655 TGGCCAGGAGAGGCCACTCCCGG + Intergenic
922200224 1:223394528-223394550 GGACCAGGAGAGCCCGCGCCAGG + Exonic
922595517 1:226809999-226810021 GGACCAGTGGAGGCCACGGCAGG - Intergenic
923531104 1:234812905-234812927 GGGCCATGAGAGGCCATGAAGGG + Intergenic
1062886362 10:1019561-1019583 CATCCAGGTGAGGCCACCACCGG + Exonic
1066461228 10:35614030-35614052 GGTCCAAGAGAGGCCTCTGCTGG - Intergenic
1066602599 10:37124834-37124856 GGTCGAGGAGGGGCCACGGGCGG + Intergenic
1067217119 10:44312378-44312400 AGACCAGGAGAGGCAATGACAGG - Intergenic
1067507166 10:46865208-46865230 GGTCCATGAGAGGCCATGGATGG + Intergenic
1067705508 10:48604162-48604184 GGGTCAGGAGAGTCCAGGACTGG - Intronic
1069590437 10:69638472-69638494 GGTACAGGTGAGCCCAAGACAGG - Intergenic
1070658617 10:78288981-78289003 TGTCCAGGAGAGGCCATGCGTGG - Intergenic
1070859342 10:79638255-79638277 GGTCCATGAGAGGCCATGGGTGG + Intergenic
1072943136 10:99785352-99785374 GGCCCAGGAGGGGCCAGGAGGGG + Intronic
1075132082 10:119748727-119748749 GGTCCATGGGAGGCCACGGACGG + Intronic
1076513000 10:131025524-131025546 GGGCCAGGGGAGGACACGACAGG + Intergenic
1077028746 11:453727-453749 GGCCAAGGAAAGGCCACGCCTGG - Intronic
1077359522 11:2134460-2134482 GGCACAGGAGAGGCCAGGGCGGG + Intronic
1077425276 11:2473164-2473186 GGCTGAGGAGAGGCCAGGACGGG + Intronic
1081814670 11:45931889-45931911 TCTCAAGGAGAGGCCACAACCGG + Intronic
1082260332 11:50072939-50072961 GGGCCTGGAGAGGCCACGAGAGG + Intergenic
1084148280 11:67276326-67276348 GGGCCAGGAGAGGGCAGGAGGGG + Intronic
1085488327 11:76888030-76888052 AGTCCAGGAGCTGCCAAGACCGG - Intronic
1086061885 11:82708332-82708354 GGTGCAGAAGAGGCCAAGAAAGG - Intergenic
1087026217 11:93652542-93652564 GGGTCAGGAGAGGCCATGAGAGG + Intergenic
1090924410 11:131236839-131236861 GGTCCCTGAGGGGCCTCGACTGG + Intergenic
1092291336 12:7161035-7161057 ACTACAGGAGAGGCCACTACAGG - Intergenic
1092751485 12:11723692-11723714 GGTCAAGGAGAGGCCAGGATAGG - Intronic
1093893403 12:24550349-24550371 GATCCAGCAGAAGCCAGGACAGG - Intergenic
1097011019 12:55953560-55953582 GTTCCTAGAGAGGCCACGATAGG - Intronic
1102218841 12:111180673-111180695 GGTCCAGGAGAGGAGAGGACTGG - Intronic
1104018768 12:124977643-124977665 GGTCCAGGAGAGACAGAGACAGG + Intronic
1104926351 12:132315993-132316015 GGTCCTGGAGAGGGCACGGCAGG + Intronic
1105210081 13:18252539-18252561 GGGCCAGGTGAGGCCAGGTCGGG - Intergenic
1106401689 13:29437121-29437143 CGTCCAGCAGGGGCCATGACAGG + Intronic
1106511776 13:30419338-30419360 GATCCAGCAGAGGCCAGGAAAGG + Intergenic
1107147062 13:37070417-37070439 GGTCTATGAGAGGCCATGGCGGG - Intergenic
1109994544 13:70107287-70107309 GGTCCAGGAAAGTCCATGCCTGG + Exonic
1112043934 13:95576229-95576251 GGTCCAGGAGAAGGCAAGACAGG - Intronic
1113721703 13:112562397-112562419 GGTCCAGGAGGGCCCAACACAGG + Intronic
1113776698 13:112951689-112951711 TGTCCAGGAGGGGCCACAAGAGG + Intronic
1114130682 14:19788347-19788369 GGTCCAGGAGAGAGCACGTGAGG - Intronic
1114163034 14:20190329-20190351 GGCCCAGGAGAGGCCAGAGCAGG - Intergenic
1121433416 14:93903225-93903247 GGTCCAGGAGTGCTCAGGACTGG + Intergenic
1124869926 15:33530535-33530557 GCTCCCGGAGAAGCCACAACGGG + Intronic
1124982803 15:34581107-34581129 TGTCCAGGGGAGGACAGGACTGG - Intronic
1127771107 15:62231542-62231564 GTACCAGGAGAGGCCATGCCTGG - Intergenic
1128254957 15:66189595-66189617 GGCGCAGGAGAGGGCACCACTGG + Intronic
1129604641 15:77018922-77018944 GGTCCAGGAGGGGACACACCTGG + Intronic
1138457868 16:57131713-57131735 GGGCCAGGAGGGGCCAGGCCTGG - Intronic
1139614964 16:68083418-68083440 GGTCAAGGAGAGGGAACAACTGG - Intergenic
1139823924 16:69742242-69742264 GGTCCTGGAGACGACACGGCTGG + Exonic
1140220495 16:73040271-73040293 GGGACAGGCGAGGCCAAGACAGG + Intronic
1142250696 16:88990475-88990497 GGCCGGGCAGAGGCCACGACAGG - Intergenic
1142604487 17:1073965-1073987 GAGCCAGGTGAGGCCAGGACAGG - Intronic
1143649675 17:8255718-8255740 GGTCCAGGATAGGCCAGTAGGGG + Intronic
1143684068 17:8499843-8499865 GGTGCAGGGGTGGCCACAACAGG + Intronic
1145785265 17:27589344-27589366 GGTCCAGCAGAGGCCAAAAAAGG - Intronic
1145909627 17:28534949-28534971 GGTCCAGGAGGGGCCAGGCCTGG - Exonic
1146377651 17:32305376-32305398 CCTCCAGAAGAGCCCACGACTGG - Exonic
1146742090 17:35295463-35295485 GGTCTTGGAGAGGCCAAGAGAGG + Intergenic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1148785907 17:50146105-50146127 GGTACAGGAGATGCCAAGGCAGG - Intronic
1151396500 17:73826628-73826650 GGTCCAGGAGAGGACAGTCCTGG - Intergenic
1152018974 17:77770643-77770665 AGACCAGGAGAGGCCACCATGGG - Intergenic
1152280058 17:79379922-79379944 GGTGCGGGAGAGGCCGCGGCAGG - Intronic
1152295648 17:79465700-79465722 GGTCCAGGGCAGGCCCCGACGGG - Intronic
1153736279 18:8071713-8071735 CGGCCAGGAGAGGCCCCGACTGG - Intronic
1155433044 18:25781959-25781981 GATCAAGGATAGGCCAGGACAGG + Intergenic
1157006410 18:43589603-43589625 GGTCCATGGGCGGCCACGGCGGG + Intergenic
1158557053 18:58483919-58483941 AGTCCAGGAGAGTCTATGACAGG - Intronic
1160433546 18:78829175-78829197 GGACCAGCAAAGGCCACGGCGGG - Intergenic
1161066503 19:2241093-2241115 GGTCCAGGAGAGGCCACGACAGG + Intronic
1161602579 19:5193517-5193539 GTTTCAGGAGAGGCCAGGGCAGG - Intronic
1165023957 19:32945844-32945866 GGGCCAGGAGAAGCCACCATGGG - Intronic
1166100366 19:40567998-40568020 GGAGCAGGTGCGGCCACGACCGG + Exonic
1166825657 19:45607418-45607440 GGTCCAAGACTGGCCACGAGGGG + Intronic
1167291852 19:48629096-48629118 GAGCCAGGAGAGGCCAGGGCAGG - Exonic
1168246822 19:55116783-55116805 GGTTCAGGAGAGGGCAGGGCAGG + Intronic
927811096 2:26180527-26180549 GATCCTGGAGAGGCCAAGAAAGG - Intronic
927931858 2:27050512-27050534 GGTCCAGGAGAAACCACCGCGGG + Intronic
928060483 2:28107647-28107669 GATGCAAGAGAGGGCACGACTGG - Intronic
931043120 2:58319609-58319631 GGCCCAGGAATGGCCATGACTGG + Intergenic
932750986 2:74371565-74371587 GCTCCAGGAGAGGTGAGGACCGG + Exonic
934564924 2:95333464-95333486 GGCCCTGGTGAGGCCACCACAGG - Intronic
935816349 2:106849608-106849630 GGTCCAGGAAAGGCCTAGAAGGG - Intronic
944132623 2:196363126-196363148 TGTCCAGAAGAGGCCTGGACAGG - Intronic
947502705 2:230683187-230683209 GGTCCAGCTGAGGGCAGGACTGG + Intergenic
1169011670 20:2256288-2256310 GGTGGAGGAGAGGGCAGGACAGG - Intergenic
1169146971 20:3259150-3259172 GGTCTAGAGGAGGCCATGACTGG + Intronic
1169368346 20:5009384-5009406 GTTCCAGGAGAGGCCAAGGTGGG - Intronic
1170386038 20:15818071-15818093 GGACCAGGAAAAGCCACCACAGG - Intronic
1171291227 20:23984229-23984251 GGGCCAGGTGAGGCCAGGTCGGG - Intergenic
1172061998 20:32193029-32193051 GTTCCAGGAGAGGCCAGGGTGGG + Exonic
1174199559 20:48797833-48797855 GGCCCAGGAGAGTCGATGACAGG + Intronic
1174841552 20:53905930-53905952 TTTCCAGGAGAGGCAACGGCAGG + Intergenic
1176866851 21:14058727-14058749 GGTCCAGGCTGGGCCAGGACAGG + Intergenic
1178314481 21:31557816-31557838 AGACCAGGAGACGCGACGACTGG + Intronic
1178486418 21:33022604-33022626 GGTCCAGGACAGTTCACGCCGGG - Intergenic
1179779654 21:43691243-43691265 GGTCCTGGTGAAGCCCCGACAGG + Intronic
1180043589 21:45292776-45292798 GGGACAGGAGAGGCTCCGACAGG - Intergenic
1180143822 21:45908931-45908953 TGTCGGGGACAGGCCACGACTGG - Intronic
1180766176 22:18346865-18346887 GGGCCAGGTGAGGCCAGGTCGGG + Intergenic
1180780137 22:18515513-18515535 GGGCCAGGTGAGGCCAGGTCGGG - Intergenic
1180812853 22:18772834-18772856 GGGCCAGGTGAGGCCAGGTCGGG - Intergenic
1181199011 22:21207082-21207104 GGGCCAGGTGAGGCCAGGTCGGG - Intergenic
1181400733 22:22648706-22648728 GGGCCAGGTGAGGCCAGGTCGGG + Intergenic
1181648658 22:24247172-24247194 GGCCCAGGTGAGGCCAGGTCGGG - Intergenic
1181702713 22:24629804-24629826 GGGCCAGGTGAGGCCAGGTCGGG + Intergenic
1183983610 22:41557194-41557216 GGTCCAGGCCTGGCCACCACAGG + Intergenic
1184805551 22:46792931-46792953 GGGCCAGGACAGGCCAGGGCCGG - Intronic
1203227794 22_KI270731v1_random:87756-87778 GGGCCAGGTGAGGCCAGGTCGGG + Intergenic
950419599 3:12890937-12890959 TGACCAGGACAGGCCTCGACCGG + Intergenic
951091217 3:18576231-18576253 GGTCCAGGATAGGCCAGATCTGG - Intergenic
963043259 3:141084328-141084350 GGGCAAGGAGAGGCCAGGAGAGG - Intronic
968035415 3:195543909-195543931 GGGCCCGCAGAGGCCGCGACAGG + Intergenic
968584469 4:1409698-1409720 GGTCCAGGTGGGGTCACGATGGG + Intergenic
969418206 4:7074759-7074781 GGGCCAGGGAAGGCCAGGACGGG + Intergenic
981160670 4:141495024-141495046 ACTTCAGGAGAGGCCACTACAGG - Intergenic
982091488 4:151883615-151883637 GTTCCAGCAGAGGCCAGGCCTGG - Intergenic
985629127 5:1005641-1005663 GGCCCAGGAGAGGACACGCCGGG + Intergenic
986682506 5:10246807-10246829 GGTCCAGGAGAGGCAGACACAGG + Intronic
987004161 5:13692347-13692369 GGGCCAGCAGAGGCCACCAGAGG - Intronic
995077598 5:108005277-108005299 GTCCCAGGTGAGGCCAGGACTGG + Intronic
998568300 5:143235435-143235457 GGGCCAGGAAAAGCCATGACTGG + Intergenic
1003970112 6:11291085-11291107 TGTCCAGGAGAGTCCCTGACTGG + Intronic
1007172703 6:39875352-39875374 GGTCCAGGAGCTGCCACTGCTGG - Exonic
1007594545 6:43043450-43043472 GGCCGAGGAGTGGCCACCACAGG + Exonic
1011751877 6:90461951-90461973 GGGGAAGGAGAGGCCACGGCTGG - Intergenic
1012866323 6:104622608-104622630 GGTGCAGGAGAGGCCAATCCAGG + Intergenic
1017241644 6:152176407-152176429 GGTCCAGGAGATGCTGCCACCGG + Exonic
1018655100 6:166026830-166026852 GGAGCAGGAGAGGCCAGGAGGGG + Intergenic
1018808259 6:167277944-167277966 GGTCCAGGACAGCACAGGACAGG - Intronic
1019168771 6:170117001-170117023 GGCCCAGGAGAGGCCAGTCCTGG + Intergenic
1019337068 7:490550-490572 GGTCCAGAGGAGCCCAGGACAGG + Intergenic
1019696830 7:2450920-2450942 GGTCCAGGAGATGCCAGGCCAGG - Intergenic
1019713202 7:2526721-2526743 GGTCCAAGGGAGGCCAGGGCAGG + Intronic
1023820760 7:43979385-43979407 GGTCAAGGGGGGGCCAGGACTGG + Intergenic
1025175924 7:56802433-56802455 GGCCCTGGAGAGGCCAGGAGAGG + Intergenic
1025176117 7:56803304-56803326 GGGCCTGCAGAGGCCACGAGAGG + Intergenic
1025695321 7:63771658-63771680 GGACCTGGAGAGGCCACCAGAGG + Intergenic
1025695677 7:63773118-63773140 GGGCCTGCAGAGGCCACGAGAGG - Intergenic
1025695869 7:63773989-63774011 GGCCCTGGAGAGGCCAGGAGAGG - Intergenic
1026267766 7:68810315-68810337 ATTCCAGGAGAGGTCATGACTGG + Intergenic
1029640009 7:101815131-101815153 GTTCCAGTTTAGGCCACGACAGG - Intergenic
1030060690 7:105618635-105618657 GGTCCAGTAGAGGCAAGGAAGGG - Intronic
1031547537 7:123068567-123068589 GCCCCAGGAGAGGCCACTAGTGG + Intergenic
1035393859 7:158523136-158523158 GGTCCAGGAGGGGACATCACAGG + Intronic
1035646202 8:1222894-1222916 GGACCAGGAGAGAGCACGGCTGG - Intergenic
1036653590 8:10661508-10661530 CCTCCAGGAGAGGCCTTGACCGG + Intronic
1037920682 8:22803316-22803338 CTCCCAGGAGAGGCCAAGACAGG - Intronic
1039424918 8:37477726-37477748 GGTGCAGGAGAGGCCAGTGCTGG - Intergenic
1039502912 8:38031073-38031095 GATCCAGGAGAGGCCTGGCCTGG + Intronic
1043695195 8:83208498-83208520 GGTCCATGAGTGGCCATGAGTGG - Intergenic
1044618957 8:94170397-94170419 GGTCCAGGAGAATGAACGACTGG - Exonic
1049280807 8:141743249-141743271 GGAGCAGGAGAGGCCTGGACAGG + Intergenic
1049280855 8:141743447-141743469 GGAGCAGGAGAGGCCTGGACAGG + Intergenic
1052580614 9:30349762-30349784 GGTCCATGAGTGGCCACGTGCGG + Intergenic
1053426760 9:38015217-38015239 GAACCAGGAGAAGCCACAACAGG + Intronic
1056270280 9:84940616-84940638 GGTACAGAAGAGGCCACCTCTGG + Intronic
1056381978 9:86064039-86064061 GGTCCAGGACATCCCATGACAGG + Intronic
1056753092 9:89365486-89365508 GGTCAAGCAGAGGCCATGGCCGG - Intronic
1059402748 9:114080917-114080939 TGTCCAAGAGAGGCTAGGACTGG - Intergenic
1060104689 9:120866231-120866253 GGTCAAGGACAGGGCAGGACAGG + Intronic
1060180094 9:121527818-121527840 GGTCCATGAGCGGCCATGAGTGG + Intergenic
1060618804 9:125044275-125044297 GGTCCATGGGAGGCCACGGATGG - Intronic
1061074467 9:128332709-128332731 GGCCCAGCACAGGCCAGGACTGG + Intronic
1188207882 X:27381535-27381557 GCTCCAGTTGAGGCCACGGCTGG - Intergenic
1189395512 X:40619159-40619181 GGTGAAGGAGAGGCCAGGAGAGG + Intergenic
1200244348 X:154515202-154515224 GTTTCAAGAGAGGCCACGGCTGG - Intronic