ID: 1161068753

View in Genome Browser
Species Human (GRCh38)
Location 19:2250354-2250376
Sequence GGCTCCTGGAACCTCAGCGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161068753_1161068758 -5 Left 1161068753 19:2250354-2250376 CCCTCGCTGAGGTTCCAGGAGCC 0: 1
1: 0
2: 0
3: 13
4: 184
Right 1161068758 19:2250372-2250394 GAGCCCCCGCCTGGAGGAGCTGG 0: 1
1: 0
2: 10
3: 31
4: 309
1161068753_1161068766 18 Left 1161068753 19:2250354-2250376 CCCTCGCTGAGGTTCCAGGAGCC 0: 1
1: 0
2: 0
3: 13
4: 184
Right 1161068766 19:2250395-2250417 CCCCCCAGAGCTGGCGCTGCTGG 0: 1
1: 1
2: 1
3: 30
4: 336
1161068753_1161068764 9 Left 1161068753 19:2250354-2250376 CCCTCGCTGAGGTTCCAGGAGCC 0: 1
1: 0
2: 0
3: 13
4: 184
Right 1161068764 19:2250386-2250408 AGGAGCTGGCCCCCCAGAGCTGG 0: 1
1: 0
2: 4
3: 29
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161068753 Original CRISPR GGCTCCTGGAACCTCAGCGA GGG (reversed) Exonic
900088963 1:911002-911024 GGCTCCTGGGACCTCGGCCCTGG + Intergenic
901967543 1:12880758-12880780 GGATCCTGCAACATCAGCTACGG + Intronic
901975342 1:12939889-12939911 GGATCCTGCAACATCAGCTACGG + Intronic
902009833 1:13261876-13261898 GGATCCTGCAACATCAGCTACGG - Intronic
902145499 1:14395481-14395503 GGCTCCTGGAATCACGGAGAGGG + Intergenic
902525365 1:17053923-17053945 GAGTCCTGGAGCCTCAGAGAGGG - Intronic
903760544 1:25695113-25695135 AGCTCCTGGAAACTCAGTGTTGG + Intronic
904921180 1:34009520-34009542 CTCTCCTGGGACCTCAGTGATGG + Intronic
907200964 1:52726574-52726596 GCCTCCTGGAGCCTCCGCGCCGG + Exonic
909901438 1:81141414-81141436 GCCTCCTGGCAGGTCAGCGATGG - Intergenic
914247532 1:145897167-145897189 GGGTCCTGGGACTTCAGGGAAGG - Intronic
915590678 1:156868510-156868532 GGCACCTGGACCTTCAGCGTGGG - Exonic
917602927 1:176595459-176595481 TACTCCTGGAACCGCAGGGATGG + Exonic
920097632 1:203496893-203496915 GACTCTGGGAACCTCAGTGATGG - Intronic
921693894 1:218184793-218184815 GCCTCTTGGAATCTCAGCTAGGG + Intergenic
921950790 1:220927683-220927705 GGCACCTGAAACCTCAGCCCAGG + Intergenic
922179337 1:223221683-223221705 GCCTCCTGCACCCTCAGCAAGGG - Exonic
1063377434 10:5562414-5562436 TGCTCCTGGAGCCCCAGTGAGGG + Intergenic
1066253914 10:33660586-33660608 GGCTCTTGGAACAGCAGCCAGGG - Intergenic
1067029823 10:42872570-42872592 GGCTCCAGGAAGCTCTGCGGGGG - Intergenic
1068523050 10:58098647-58098669 GGCTCCTGGAAAAACAGCCATGG + Intergenic
1069533037 10:69232926-69232948 GGCTCCTGTGACCGCAGGGAAGG + Intronic
1070604738 10:77890812-77890834 GACTCCTGGAAGCTCAGAGATGG - Intronic
1070834956 10:79442408-79442430 TGCCCCTGGAACCTCAGCTCTGG - Intronic
1071618020 10:87094369-87094391 GGCTCCTGGGAGGTCATCGAAGG - Exonic
1077169178 11:1158768-1158790 GGCTCCTGGAACAGCAGGGCAGG + Intronic
1077843230 11:5997430-5997452 AGCTTCTGGAACCTCAGAGGGGG - Intergenic
1083632044 11:64100815-64100837 GCCTCCTGGAACCCCAGTGCTGG - Intronic
1084216385 11:67648949-67648971 GGCACCTGGAGCCTCAGCAAAGG + Intronic
1089920076 11:122201298-122201320 GGCCTCTGGAACCCGAGCGAAGG + Intergenic
1091836994 12:3593000-3593022 TGCTCCTGGAACCACAGGGATGG - Intronic
1093895642 12:24571552-24571574 GGATCCTGCCACCTCAGCTAAGG - Intergenic
1094466723 12:30761565-30761587 GGCGCCTGTAATCTCAGCTATGG + Intergenic
1094488232 12:30941744-30941766 GCCTCCTGGAACCCCACCCATGG + Intronic
1096609050 12:52789230-52789252 GGCTGCTGGAAGCCCAGGGATGG - Intergenic
1096909956 12:54973393-54973415 AACTCCTGGAAACTCAGAGACGG - Intronic
1102560408 12:113758090-113758112 GGCGCCTGTAATCTCAGCTAAGG - Intergenic
1103201974 12:119095197-119095219 GGCTCCTGGGACCTCAGTCTGGG - Intronic
1104530147 12:129562497-129562519 GGATTCTGGAACCTCATAGAAGG + Intronic
1104964826 12:132504152-132504174 TGCTCCTGAAACCACAGCAAGGG - Intronic
1106197498 13:27506905-27506927 GGCTCTTCAAACCTCAGGGAGGG + Intergenic
1108313944 13:49220344-49220366 AGCCCCTGGAACGGCAGCGACGG + Exonic
1109024715 13:57142800-57142822 GGCTCCTGAAACCCCAGCTCAGG - Exonic
1109025702 13:57149370-57149392 GGCTCCTGAAACCCCAGCTCAGG - Exonic
1109026692 13:57155943-57155965 GGCTCCTGAAACCCCAGCTCAGG - Exonic
1109027684 13:57162514-57162536 GGCTCCTGAAACCCCAGCTCAGG - Exonic
1109028670 13:57169079-57169101 GGCTCCTGAAACCCCAGCTCAGG - Exonic
1109159476 13:58954634-58954656 GGATCCTAAAACCTCAGTGATGG + Intergenic
1112625028 13:101094108-101094130 GGCTCCTGGAAACACACCTACGG + Intronic
1113960484 13:114123113-114123135 TGCTCCTGGAGCCTCAGAGGAGG + Intronic
1114219527 14:20684254-20684276 GGTTCCTGGACGCTCAGCCAGGG + Exonic
1114270338 14:21097259-21097281 GGGACATGGAACCTCAGCCATGG + Intronic
1118784606 14:69035662-69035684 GGCTGCTGGACCCCCAGCTAAGG - Intergenic
1119524494 14:75311303-75311325 GGCTTTGGGAACCTCAGCGGTGG + Intergenic
1122192559 14:100057771-100057793 GACTCCTAGAACCTCAACTATGG - Intronic
1123183380 14:106490644-106490666 GGCTCCAGGAACTCCAGTGAGGG - Intergenic
1123425623 15:20168414-20168436 CGCTCCTGGAACCGCACCCATGG + Intergenic
1123534850 15:21174941-21174963 CGCTCCTGGAACCGCACCCATGG + Intergenic
1124068063 15:26364346-26364368 GGAACCTGGAGCCTCAGCGTGGG + Intergenic
1125134741 15:36328571-36328593 GGCGCTTGAAACCTCAGAGATGG + Intergenic
1128753304 15:70164121-70164143 GGCTCCTGGGACCACAGCAAAGG - Intergenic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1133568473 16:7018154-7018176 GGCTCGTGGAAATTCAGCAAGGG - Intronic
1135539751 16:23320833-23320855 GGCTGCTGCAGCCTCAGGGACGG + Intronic
1135779018 16:25282679-25282701 GGCTCCTGGAAGCTGAGAGGGGG - Intergenic
1137441997 16:48505835-48505857 GGGTCCTGGCAGCTCAGAGAGGG + Intergenic
1137760373 16:50935515-50935537 GTCCCCTGGAGCCTCAGCTAAGG + Intergenic
1138284384 16:55797724-55797746 AGCTCCTTGAGCCTCAGCGGGGG + Intergenic
1138284618 16:55799263-55799285 AGCTCCTTGAGCCTCAGCGGGGG - Intergenic
1139467655 16:67162755-67162777 GGCAGCTGGAACCCCAGCTAAGG + Intronic
1143117778 17:4590426-4590448 GGCTCCTGGAAGCCCAGCAGAGG - Intronic
1146553734 17:33805010-33805032 GGCGTCTGGAACCTTAGCTAGGG - Intronic
1146594638 17:34157732-34157754 TGCCCCTGGAGCCTCAGAGAAGG + Intronic
1146673310 17:34756690-34756712 GGCTCCTGGCCCCTCAGGGTTGG - Intergenic
1148050792 17:44769174-44769196 GGCCCCTGGAAACTGGGCGACGG - Intronic
1149222895 17:54436176-54436198 GCCTACTCAAACCTCAGCGATGG - Intergenic
1150220905 17:63495409-63495431 GGTTCCTGGAAGCCCAGCAAGGG + Intronic
1152402421 17:80075524-80075546 GGCTGCTGGCACCTCTGCAAGGG - Intronic
1152540523 17:80972154-80972176 GGCTCCTCCAAACCCAGCGATGG + Intergenic
1152692262 17:81724385-81724407 GGCACCTGTAACCCCAGCTAAGG + Intergenic
1156457235 18:37301617-37301639 GGCTCATGGAACCTGAGGAAGGG - Intronic
1160229379 18:77034795-77034817 GGCTCCTGGGACTTCAGCTTCGG + Intronic
1161068753 19:2250354-2250376 GGCTCCTGGAACCTCAGCGAGGG - Exonic
1161142234 19:2654584-2654606 GCCTCCTGGGACCTCAGCAAGGG - Intronic
1161470679 19:4455517-4455539 CCCTTCTGGAACCTCAGCCAGGG + Intronic
1161702633 19:5803961-5803983 GGCCCCAAGAACCTCAGCGGCGG + Intergenic
1162368533 19:10264542-10264564 GGCGCCTGTAATCTCAGCTATGG + Intergenic
1163118445 19:15201328-15201350 GGCTCATGGACCCACAGCCACGG + Intergenic
1163698262 19:18774791-18774813 GGCCCCTGGAACCTCCCAGACGG - Intronic
1165010865 19:32845365-32845387 GGCACCTGTAACCTCAGCTGAGG + Intronic
925749810 2:7077847-7077869 GGCTCCTGGAGCCAGAGAGATGG - Intergenic
927152824 2:20205560-20205582 GGCTCCAGGACCCTCAGCTCTGG + Intronic
931326450 2:61230396-61230418 GGCACCTGTAATCTCAGCTAAGG + Intronic
932868697 2:75374586-75374608 AGCTACTGGAGCCTCAGCAATGG + Intergenic
933777442 2:85779543-85779565 GACTCCTGGAGCCTAAGGGAAGG - Intronic
934994613 2:98945905-98945927 GGCTCCTGCACCCTCAGAGCCGG - Intergenic
937337765 2:121072322-121072344 GGCTCCTTGGAGCTCAGAGAAGG + Intergenic
942073685 2:172337510-172337532 GTATCCTGGAACCTCAGGGCAGG - Intergenic
942113385 2:172704219-172704241 GGCTCCTGGCACGACAGCGATGG + Intergenic
945259584 2:207831332-207831354 GGCTCCTGGCAGCCCAGCCAAGG + Intronic
945737761 2:213621995-213622017 GGCTCCAGCAACCTTAGAGAAGG - Intronic
947716895 2:232345441-232345463 GGCCCCTGCCACCTCAGCGATGG + Intergenic
948298593 2:236884899-236884921 TGCTGCTGGACCCTCAGGGAGGG + Intergenic
948648951 2:239426871-239426893 AGCTCCTGGAACCAGAGGGAGGG - Intergenic
948719718 2:239891393-239891415 GGGTCCTGGACCCTAAGCCAAGG - Intergenic
949075869 2:242057592-242057614 GGGTCCTGGAACCCCAGGCAGGG + Intergenic
1175795090 20:61766114-61766136 GGCTCCTGGACCCAGACCGAGGG - Intronic
1175846379 20:62061168-62061190 AGCTCCTGCAACCTCAGGGGTGG + Intronic
1176362166 21:6006696-6006718 GGCTCCTGGACCCTCCCTGAGGG + Intergenic
1178512368 21:33216233-33216255 GCCATCTGGAACCTCAGCCAGGG + Intergenic
1179176358 21:39010802-39010824 GGCTCCTGGGACACCAGCTAGGG - Intergenic
1179624845 21:42643102-42643124 GGCAGCTGCAACCTCAGAGAGGG + Intergenic
1179720604 21:43314158-43314180 GGCTCCTGCAACATCAGGGGTGG + Intergenic
1179761352 21:43531849-43531871 GGCTCCTGGACCCTCCCTGAGGG - Intronic
1179826521 21:43969075-43969097 GGCACCTGGCACTTCAGCGTCGG - Intronic
1180042548 21:45287698-45287720 CGGTCCTGGAACCCCAGCGTTGG + Intronic
1180874510 22:19168997-19169019 GGCTCCTGGCACCTCTGCAAGGG + Intergenic
1181103193 22:20555084-20555106 GCCTCCTGGGACCTCGGGGATGG + Exonic
1181178842 22:21053407-21053429 GGATCCTGGAGCCTCTGCGGTGG + Exonic
1182124610 22:27807434-27807456 GGCTCCTGGGGCCACAGTGAAGG - Intergenic
1184324959 22:43775845-43775867 GTTGCCTGGAACCTCAGCTAAGG - Intronic
1185004395 22:48267214-48267236 GGCTCCTTCAAGCTCATCGAGGG - Intergenic
1185088443 22:48753087-48753109 GGCACCGGGAACCTCAGCGCTGG + Intronic
1185098780 22:48826449-48826471 GGCTCCTGGGACTTCCGGGAAGG - Intronic
949130793 3:498267-498289 GTCTCCTGGAAACTCAGTCAGGG + Intergenic
950469409 3:13175149-13175171 AGCTCCTGGAAGCTCAGCAGTGG - Intergenic
950707589 3:14792697-14792719 GGCTGCTGGAACCTCTGAGATGG + Intergenic
953436424 3:42881089-42881111 GGCCCCCGAAGCCTCAGCGAGGG + Intronic
954223975 3:49171220-49171242 GGCTCCTGGGAGCTCCGCGGAGG + Intergenic
954358659 3:50105093-50105115 GCCTCCTGGAACCACAGAGTCGG + Exonic
958798841 3:98733267-98733289 GGATCCTGGAGCCCCAGTGAAGG + Intronic
958889328 3:99766081-99766103 GGATCCTGGAACCACAGTAATGG + Intronic
960131027 3:114056443-114056465 TGCTCCTGGCGCCTCAGGGAAGG - Exonic
961604177 3:128081593-128081615 GGCTCCTGGACCCTCTCTGATGG - Intronic
963168382 3:142227265-142227287 GGCTCCTGCAATCCCAGCTACGG + Intergenic
966300632 3:178475720-178475742 GGCTCCTGGAGCCACAGCAGTGG + Intronic
966805199 3:183802190-183802212 GGCTGCTGGCCCCTCAGCAAGGG - Intronic
968520203 4:1031656-1031678 GGCTCCTGCAGCCTGAGAGATGG + Intergenic
970320642 4:14872264-14872286 GGCTCCTGAACCCTCACTGAGGG + Intergenic
970441446 4:16083763-16083785 GGCTTCTGGGACCACCGCGACGG + Intronic
971976524 4:33696063-33696085 AGCTCCTGGATCCTCAGAGCTGG - Intergenic
975383467 4:73728779-73728801 GGCTCAAGGAACCTCAGCATAGG + Intergenic
982125165 4:152177997-152178019 AGCTCCTGGGGCCTCAGCAATGG + Intergenic
982650333 4:158080525-158080547 GTCTCCTGAAGCCTCAGGGAAGG - Intergenic
983923516 4:173371532-173371554 GGCTCCTGGGGCCCCACCGAGGG - Intronic
984886777 4:184456532-184456554 GTGTCCTCGCACCTCAGCGAGGG + Intronic
985641812 5:1066967-1066989 GGCTGCTGGAATCTCGGCAAAGG - Intronic
996434200 5:123416063-123416085 GGATCCTGTAACTTCAGCCAAGG - Exonic
999147568 5:149406327-149406349 GGCTCCTGGAATCTGGGTGATGG - Intergenic
999150057 5:149420899-149420921 GGCTCCTGGAACTTCAGAAAGGG + Intergenic
999317133 5:150591311-150591333 GGCTCTGGGGACCTCAGTGATGG + Intergenic
999729624 5:154466975-154466997 GGCTCCTTCATCTTCAGCGAAGG + Intergenic
1000073978 5:157767667-157767689 GGCAGCTGGAACCTCTGGGACGG + Intergenic
1001615858 5:173042977-173042999 GGCTCCTAGAATCTCAGAAATGG - Intergenic
1002638609 5:180620014-180620036 GGTACCTAGAACCTCAGCCAGGG - Intronic
1006225814 6:32535407-32535429 GCCTCCTGCCACCTCAGCCACGG + Intergenic
1006989143 6:38198523-38198545 GGATCCTGAATCCTCAGAGAAGG - Intronic
1007387453 6:41529364-41529386 GGCTCCTGGAAGCCCAGGAAAGG + Intergenic
1008505663 6:52227242-52227264 GGCTCCAGGAATGTCAGCTATGG - Intergenic
1008918625 6:56818347-56818369 GCCTCCTGGAGGCTCAGCAAAGG + Intronic
1017076525 6:150624027-150624049 AGCTTCTGGAACCATAGCGATGG + Intronic
1017713329 6:157189696-157189718 GTCACCTGGAACCTCTGCCATGG - Exonic
1017915993 6:158832008-158832030 CTCTCCTGGAGCCTCAGAGAAGG + Intergenic
1018967681 6:168501407-168501429 GGTTCCTGGCACCGCAGCAAGGG - Intronic
1019070485 6:169341079-169341101 GGATCCTGGCACCTCTGGGAAGG - Intergenic
1021471013 7:21002634-21002656 CACTCCTGCAACCTCAGCCATGG + Intergenic
1022487477 7:30790938-30790960 GCCTGCTGGAACCTCAGAGCAGG - Intronic
1024260901 7:47573202-47573224 GGCTCCTGGGTCCTCAACAAAGG - Intronic
1026073792 7:67147347-67147369 GGATCCAGGAACCTCATGGATGG - Intronic
1026703088 7:72664820-72664842 GGTTCCAGGAACCTCATGGACGG + Intronic
1028688008 7:93614321-93614343 GTCACCTGGAAACTCAGCTAGGG - Intronic
1029374262 7:100168453-100168475 GGTTCATGGAACCCCAGCGGGGG - Intronic
1029679351 7:102097261-102097283 GGCTCCTGGGACATCAGCTCCGG - Intronic
1031974586 7:128085639-128085661 GGCTCCCAGAGCCTCAGCAATGG - Intronic
1032239181 7:130148050-130148072 CGCTCTTGGAAGCGCAGCGAGGG - Intergenic
1035171444 7:157019485-157019507 AGCTACTGGAACCTCAGCCCAGG - Intergenic
1040576324 8:48654541-48654563 AACTCCAGGAACCTCAGAGAAGG + Intergenic
1048418904 8:134257598-134257620 AGCTCTTGGAGCCTCAGCCACGG - Intergenic
1048976222 8:139674486-139674508 GTCTCCTGCAACCTCTGTGAGGG + Intronic
1049062197 8:140285429-140285451 GGATCCTGGATCCTGAGGGATGG + Intronic
1049310360 8:141930915-141930937 GGCTCCAGGAACCTCTGCTGAGG - Intergenic
1049743675 8:144253527-144253549 GCCTCCTGGCGCCTCAGCGACGG + Intronic
1052357187 9:27517203-27517225 GCCTCCAGGAACCTCTGCAAGGG + Intronic
1053138161 9:35664765-35664787 GGCTCCTGGGAGCTCATCTACGG - Exonic
1053417977 9:37958760-37958782 GGCTACTGGAAGGCCAGCGAGGG - Intronic
1060223095 9:121774670-121774692 GACTCCTGGGACCTCTGGGAAGG + Intronic
1060230494 9:121821940-121821962 GACTCCTGGAGCCTCAGAGCTGG - Exonic
1187031517 X:15493201-15493223 GGCACCTGGAGCCTTAGCGGCGG + Exonic
1191219998 X:57977885-57977907 GGCTCCTGGCACGACAGCGATGG + Intergenic
1195064988 X:101232476-101232498 GTCTCCTGGAGCCTCACAGATGG + Intronic
1196269796 X:113697723-113697745 GCCTACTGGAGCCTCAGCAATGG + Intergenic
1196965279 X:121048063-121048085 GGCTCCTGGGAGGTCATCGAAGG + Exonic
1197724901 X:129769650-129769672 GGCTCCTAGAAGCTCAGTGGGGG + Intergenic
1199812132 X:151360332-151360354 GGCTCCAGGAACCTGGGCAATGG - Intergenic
1200134697 X:153869233-153869255 CTCTCCTGGAACTTCAGGGAAGG - Intronic
1201177335 Y:11316798-11316820 GGCTCCTTGCACATCAGCCAGGG - Intergenic
1202370395 Y:24192135-24192157 GGCTCCAGGAACCTCCAAGAAGG - Intergenic
1202500389 Y:25477982-25478004 GGCTCCAGGAACCTCCAAGAAGG + Intergenic