ID: 1161069262

View in Genome Browser
Species Human (GRCh38)
Location 19:2252305-2252327
Sequence CCTGGACTCCGGCGCGGGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161069249_1161069262 6 Left 1161069249 19:2252276-2252298 CCAGAGTCGCGGGGCGTCCAGAA 0: 1
1: 0
2: 1
3: 1
4: 52
Right 1161069262 19:2252305-2252327 CCTGGACTCCGGCGCGGGGCCGG 0: 1
1: 0
2: 1
3: 20
4: 241
1161069245_1161069262 28 Left 1161069245 19:2252254-2252276 CCGCAGCACTCGCTTTATTTCGC 0: 1
1: 0
2: 1
3: 5
4: 58
Right 1161069262 19:2252305-2252327 CCTGGACTCCGGCGCGGGGCCGG 0: 1
1: 0
2: 1
3: 20
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161069262 Original CRISPR CCTGGACTCCGGCGCGGGGC CGG Exonic
900096165 1:940997-941019 GCTGGTCTCGGGCACGGGGCAGG - Intronic
900116986 1:1033176-1033198 CCCCGACTCCCGCGCGGGGCGGG - Intronic
901001015 1:6148819-6148841 CGGGGCGTCCGGCGCGGGGCGGG + Intronic
901680918 1:10912386-10912408 CCTGGCCACTGGCACGGGGCAGG + Intergenic
903828503 1:26161412-26161434 CCAGGACTCCCACGCAGGGCTGG - Exonic
909450938 1:75797197-75797219 CCGGGAGTTTGGCGCGGGGCAGG - Exonic
910251211 1:85200960-85200982 CCCTGACTCGGGCGCGCGGCGGG - Exonic
911038287 1:93572373-93572395 CCTGGCCTCTGGAGTGGGGCTGG - Intronic
911659718 1:100487756-100487778 CCTGGACTTCAGTGCTGGGCTGG + Intronic
912532919 1:110339427-110339449 CTTGGACTCCGCCGCGGCACAGG - Exonic
912685182 1:111756294-111756316 CCTGAGCTGCGGCGCGGGCCTGG - Intronic
915326914 1:155085473-155085495 CCTAGGCTCCGGGGCGGGGCCGG + Intronic
915933845 1:160078432-160078454 CCTGGACTGAGGCGAGGGGCTGG + Intergenic
916588295 1:166166603-166166625 CCTCCTCTCCGGCGAGGGGCGGG - Exonic
919895951 1:202010073-202010095 CCAGGACTCTGGCCAGGGGCTGG - Exonic
923591810 1:235327258-235327280 CCCGGCGTCCGGCGCAGGGCCGG + Intronic
1063144916 10:3288286-3288308 CCTGGACGCCAGGGCGGCGCGGG - Intergenic
1069872758 10:71543170-71543192 CCTGTACTCCTGGGTGGGGCCGG - Intronic
1073452068 10:103616010-103616032 CCAGGGCTCCGGGGTGGGGCGGG + Intronic
1075393844 10:122113057-122113079 CCGGGACAACGGCGCAGGGCCGG - Intronic
1075501731 10:122980716-122980738 CCTGGGCCGCGGGGCGGGGCGGG + Intronic
1076475754 10:130750418-130750440 CCAGGACTCCGCCATGGGGCAGG - Intergenic
1076549348 10:131267849-131267871 CCTCGACTCTGGCACGGGCCTGG - Intronic
1076872647 10:133201299-133201321 CCTGAACTGCCGCACGGGGCCGG - Intronic
1077008449 11:369720-369742 CCGGGGATGCGGCGCGGGGCGGG + Intergenic
1077107766 11:849472-849494 CCCGGACTCTGGCCCCGGGCCGG - Intronic
1077360986 11:2139980-2140002 CCGGGGCTCCGGCGCGGCACCGG - Intronic
1077487485 11:2845750-2845772 CCTGGGCTCCTGCTCTGGGCAGG + Intronic
1080418490 11:32091031-32091053 CCTCTGCTCCGGCTCGGGGCGGG + Exonic
1080515528 11:33016083-33016105 GCTGGGTCCCGGCGCGGGGCGGG + Intronic
1083301068 11:61739841-61739863 CCTGGAGTCCTGCTCAGGGCTGG - Intronic
1083747136 11:64742864-64742886 CATGGCCGCCGGCGCGGGGTGGG + Exonic
1083886517 11:65576004-65576026 GCGGGGCTCCGGCGCGGGGCGGG - Intergenic
1084014748 11:66371779-66371801 CCTGGGCTCCGCCCCGAGGCGGG + Exonic
1084445402 11:69200677-69200699 CCCGGCCTCCGGCACGGGCCAGG + Intergenic
1084888104 11:72223781-72223803 CCGGGACCGAGGCGCGGGGCGGG + Intronic
1085322451 11:75583401-75583423 CCCGGAGCCCGGGGCGGGGCCGG + Intergenic
1090377854 11:126304016-126304038 GCTGGACTCGGGCTAGGGGCGGG + Exonic
1091225939 11:133956537-133956559 CTTGGGCTCCGACGCGGGCCAGG - Intronic
1091740767 12:2959261-2959283 CCGGGCCGCCGGGGCGGGGCGGG - Intergenic
1092250256 12:6891146-6891168 CCTGGGCGGCTGCGCGGGGCGGG - Intronic
1092296367 12:7202282-7202304 CCTGGAGTCCGGTGCAGGGTCGG + Exonic
1094375606 12:29784401-29784423 ACTGGACGCGAGCGCGGGGCGGG - Intronic
1096680614 12:53252871-53252893 CCTGGCCTCCTGCCTGGGGCTGG + Exonic
1101606068 12:106248188-106248210 CCGGGAAGCCGGCGCGGGGGTGG + Intronic
1103433011 12:120904059-120904081 CCTGGGCCCCGGGGCGGGGCGGG + Exonic
1103626815 12:122226216-122226238 CCGGAACTTCCGCGCGGGGCGGG + Exonic
1104021560 12:124995297-124995319 CCTGGAGTCTGGCGCGGGAAAGG + Intronic
1108340743 13:49496219-49496241 CCTAGACGCCGGGGCGGCGCTGG + Intronic
1112043368 13:95570616-95570638 CCAGGACTCTGGCCCGGGCCAGG - Intronic
1112574946 13:100627285-100627307 CCACGAGGCCGGCGCGGGGCGGG + Intronic
1115566465 14:34629635-34629657 CCTCCACTCCCACGCGGGGCGGG - Intronic
1117478346 14:56118874-56118896 CCCGGACGGCGGCGCGGGGGCGG + Intronic
1119266476 14:73265607-73265629 CCTGGAGTCCGGCTCAGGACTGG - Intronic
1119435552 14:74595596-74595618 CCTGGGCCTGGGCGCGGGGCTGG - Intronic
1120833384 14:89017879-89017901 CCAGGACTCAGGTACGGGGCTGG - Intergenic
1121042138 14:90758317-90758339 CCAGGACGGCGGGGCGGGGCGGG + Intronic
1122582169 14:102777697-102777719 GCGGGCCTCCGGCGCGCGGCCGG + Intronic
1122602456 14:102928497-102928519 CCTGGACTGTGGCGCGGGTGAGG + Exonic
1122624099 14:103075439-103075461 GCTCGGCTCCGGCGCGGAGCGGG - Intergenic
1122625750 14:103084566-103084588 ACTGGACCCTGGCGCCGGGCAGG + Intergenic
1122655751 14:103258353-103258375 CCTGGATTCCGGCCCTGAGCTGG - Intergenic
1122879199 14:104682456-104682478 CCTGCAGTGGGGCGCGGGGCAGG + Intergenic
1122978536 14:105181023-105181045 GCGGGGCTCCGGGGCGGGGCCGG + Intronic
1126163511 15:45634916-45634938 CCTGGGCTGCGGCGCCGGGCGGG + Exonic
1129463144 15:75709947-75709969 CCAGGCCTCCGGAGCAGGGCAGG - Intronic
1129701987 15:77773543-77773565 GCTGGACTCCGGGGCTGGGAGGG - Intronic
1129721740 15:77881454-77881476 CCAGGCCTCCGGAGCAGGGCAGG + Intergenic
1130517059 15:84633696-84633718 CCTAGGCTCCGGCGCAGCGCAGG - Intergenic
1131108181 15:89748447-89748469 CCAGTACTCCGGCCCGGGCCAGG - Intergenic
1132163617 15:99565288-99565310 CCCGGAGTCCGGGGCCGGGCGGG - Intergenic
1132512950 16:353054-353076 CGGGGCCTCCGGCGCGGGGCGGG + Intergenic
1132663699 16:1072504-1072526 CCTGGACTCCTGCTGGCGGCAGG + Intergenic
1132815835 16:1826255-1826277 CGGGGGCTCCGGCGCCGGGCGGG + Intronic
1132828993 16:1918440-1918462 CCTGGGAGCGGGCGCGGGGCGGG + Exonic
1132931161 16:2459935-2459957 CGGGGACTCCGGCTCGGAGCTGG - Intergenic
1136478375 16:30526744-30526766 TCTGGACCCCGGCCCCGGGCTGG + Intronic
1137065498 16:35837523-35837545 TCTGGACTCAGGGGAGGGGCTGG - Intergenic
1139908452 16:70381902-70381924 CCTGGAGGATGGCGCGGGGCGGG + Intronic
1141981797 16:87555171-87555193 CCTGGACGCTGGCGATGGGCGGG - Intergenic
1142136393 16:88453714-88453736 GCTGGGCTCCGGCGGGGGTCGGG - Intronic
1142156098 16:88533472-88533494 GCTGGAGCCCGGCGTGGGGCTGG - Exonic
1142204576 16:88776743-88776765 GCTGGACCCTGGCTCGGGGCGGG + Intronic
1142299615 16:89248666-89248688 TCTGGACGCATGCGCGGGGCCGG + Intergenic
1142338988 16:89508490-89508512 CCTGGACTCCAGGCCGGGCCTGG - Exonic
1142367434 16:89657537-89657559 CGGGGACTCGCGCGCGGGGCGGG - Intronic
1143508168 17:7380996-7381018 CCTGGCCGCTGGCCCGGGGCCGG - Exonic
1143830232 17:9645455-9645477 GCCGGATTCCCGCGCGGGGCGGG + Intronic
1145246994 17:21275881-21275903 CCTGGACTCCGTCCCGGGCTGGG + Intergenic
1146256092 17:31392129-31392151 CCTGGGCTCCGGCGGAGGGAGGG - Intronic
1146955583 17:36934919-36934941 CCCAGACCCCGACGCGGGGCAGG - Intergenic
1147544872 17:41393548-41393570 CCTGGACCCAGGAGCGAGGCAGG - Intronic
1147880552 17:43650886-43650908 CCTGGACACTGGGGTGGGGCAGG - Intronic
1151577874 17:74962052-74962074 CCTGGGCTGGGGCGCTGGGCTGG - Intronic
1151801664 17:76383038-76383060 CCAGGAATCCGGCGCGGGCGGGG - Intronic
1151969789 17:77451647-77451669 CCTGGGCCCCGGCCCGAGGCCGG + Intronic
1152413557 17:80144140-80144162 CCTGGGGTGCGGCGCAGGGCTGG - Intronic
1152506215 17:80750463-80750485 CCTGGCCTCCGGAAAGGGGCTGG - Intronic
1152558246 17:81065305-81065327 CCTGGACCCCTGCAGGGGGCCGG - Intronic
1152572814 17:81127986-81128008 CCTGGGGGCCGGCGTGGGGCGGG - Intronic
1152659185 17:81534603-81534625 CCTGGGCTCCAGCCAGGGGCTGG - Intronic
1152744880 17:82034026-82034048 CCCGGCCTCCGGCGGGGGCCAGG - Exonic
1152929344 17:83101933-83101955 GCTGGACTCAGGCTCGGGGGAGG - Intergenic
1154155888 18:11943840-11943862 CCTGGACACTGCCGTGGGGCTGG - Intergenic
1157220704 18:45826790-45826812 ACTGGAGTCCAGCTCGGGGCTGG + Intronic
1159797926 18:72867135-72867157 CCTGCAGTCCCGCGCGGGTCGGG - Intronic
1160631268 18:80247597-80247619 CCGGGGCTCGGGGGCGGGGCGGG - Intergenic
1160862096 19:1241790-1241812 AGCGGACTCCGGCGCGGCGCGGG - Exonic
1160914750 19:1491145-1491167 GGCGGACACCGGCGCGGGGCCGG + Exonic
1161069262 19:2252305-2252327 CCTGGACTCCGGCGCGGGGCCGG + Exonic
1161339027 19:3730544-3730566 CCTGGTCGCCGGGGCCGGGCCGG + Exonic
1161973288 19:7595810-7595832 CCTGGGCTCCTCCCCGGGGCGGG + Intergenic
1162312142 19:9913907-9913929 CCCGGAGCCCGGCGGGGGGCGGG + Intronic
1162435436 19:10654983-10655005 CCTGGAATCGGGGGCGGGACCGG - Intronic
1162741374 19:12775589-12775611 CCTGGGCTTGGGGGCGGGGCGGG - Intronic
1162772408 19:12957106-12957128 CCCGGCCTGCGGCGCGGGGGCGG + Exonic
1162893037 19:13747847-13747869 CCAGGACGCCGGCGTGAGGCGGG - Intronic
1163438589 19:17310035-17310057 CCTGGGCCCCGGGGCGGGGGAGG + Intronic
1165099643 19:33431358-33431380 CCTGGCCTCCGGCGGGGACCTGG - Intronic
1165895473 19:39138699-39138721 CCTGGACCCTGGCGGAGGGCGGG + Intronic
1166081062 19:40444349-40444371 GCTCGGCTCCGGGGCGGGGCTGG - Exonic
1166688331 19:44809019-44809041 CCTGGAGGGCGGGGCGGGGCGGG + Intergenic
1168172426 19:54597390-54597412 CCTGGAATCCTGCTCGGGGAGGG - Intronic
1168333035 19:55580607-55580629 CCTGGACTCGGGAGGGAGGCTGG + Intronic
926152433 2:10432574-10432596 CCTGGGCTCCGGCTCCGGGTCGG + Intergenic
927696931 2:25245381-25245403 GCTGGGCTCCGGCCCGGGGAGGG - Intronic
931515291 2:63047680-63047702 CGTGGACTCCGGCGCCTGGCGGG + Intergenic
931587286 2:63841734-63841756 CCTGGACGGCGGCGCGGGGAGGG + Exonic
932073525 2:68643642-68643664 CAGGGAGTCCGGCGCGGGCCGGG + Exonic
934556176 2:95288234-95288256 CCAGGGCTCCGGAGAGGGGCTGG - Exonic
934951862 2:98580996-98581018 CCTGGAACCCGAGGCGGGGCTGG + Intronic
938328088 2:130427813-130427835 CCTGGCCTCGGGCTCGGCGCAGG - Intergenic
938361862 2:130693665-130693687 CCTGGCCTCGGGCTCGGCGCGGG + Intergenic
942098472 2:172555912-172555934 GCGGGACTCCGGCGAGGGGGCGG + Intronic
943624285 2:190181021-190181043 CCTGCGCTCAGGCCCGGGGCGGG - Exonic
946025304 2:216668456-216668478 CCTGGACACCGGCGCATGGTTGG + Intergenic
947229558 2:227871517-227871539 CCGGGGCTCCGGCGCGCGGGGGG - Intronic
948438179 2:237967589-237967611 ACTGGACTCCCGATCGGGGCAGG + Intronic
948617814 2:239212725-239212747 CCTGGACTCCAGGGAGGAGCTGG + Intronic
1168757046 20:325332-325354 GCTGGCCGCCGGAGCGGGGCGGG - Intergenic
1168965228 20:1894688-1894710 CCCGGGCGCCGGCGCGGGGGAGG + Intronic
1169075117 20:2755610-2755632 GCATGACTCCGGGGCGGGGCGGG - Exonic
1172869356 20:38126286-38126308 CCTGGACTCCGGATCAGAGCTGG - Intronic
1172983358 20:38962162-38962184 CGTGGGCTCGGGGGCGGGGCCGG + Intergenic
1173221864 20:41137885-41137907 CCACGACCCCCGCGCGGGGCGGG - Intronic
1174425780 20:50430791-50430813 CCCGGCCTCGGGAGCGGGGCAGG - Intergenic
1175864828 20:62169861-62169883 CCTGGAGTCCCGAGCGCGGCTGG + Intronic
1175997108 20:62816893-62816915 GCTGGGCGGCGGCGCGGGGCGGG + Intronic
1176157092 20:63627290-63627312 CCCGGCCGCCCGCGCGGGGCAGG - Intergenic
1176178686 20:63739924-63739946 CCCGGCCGGCGGCGCGGGGCGGG - Exonic
1176188206 20:63793113-63793135 CCTGGAGTCAGGCGGGGGCCTGG - Intronic
1176194399 20:63830835-63830857 CCAGGCCGGCGGCGCGGGGCGGG - Intronic
1176286592 21:5022145-5022167 CCCGGACTCCTGCTCGGGGAGGG + Intergenic
1179870589 21:44241330-44241352 CCCGGACTCCTGCTCGGGGAGGG - Intergenic
1180744547 22:18078520-18078542 CCTGGACTTCCGGGCGGCGCTGG + Exonic
1180843681 22:18970549-18970571 CCTGGATGCCGGCCCGGGGCTGG + Intergenic
1181027073 22:20132479-20132501 ACTTGACTCTGGCCCGGGGCGGG - Intronic
1181514362 22:23402664-23402686 CCTGGGCGCCGGCGCGGGCGCGG + Intergenic
1182145851 22:27996306-27996328 CCTGGAAGCCGGGGTGGGGCTGG - Intronic
1182321525 22:29480997-29481019 CCAGGGCTCCGGCGCCGCGCAGG + Exonic
1182494245 22:30695040-30695062 CTTGGGCTCCGGCCCGGAGCCGG - Exonic
1182903849 22:33920440-33920462 CCCGGGCTCCGGCGCGGCGGCGG + Intronic
1182903905 22:33920602-33920624 CCCGGCCTGGGGCGCGGGGCCGG + Intronic
1183528130 22:38336283-38336305 CCGGGAAACCGGGGCGGGGCGGG - Intronic
1183912711 22:41091662-41091684 CCGGGCCTCCGGAGGGGGGCGGG - Intergenic
1184004310 22:41697350-41697372 CCTGGACTCCGCTGCCGGCCTGG - Exonic
1184059941 22:42075346-42075368 CCTGGACTCAGGCAGGGAGCTGG + Intronic
1184607138 22:45580658-45580680 CCTGGGCTCCGGCTCTGGGCGGG - Intronic
1185335807 22:50270409-50270431 GCGGGGCTCCGGGGCGGGGCCGG + Intronic
1185397561 22:50600672-50600694 CCCGGACTCCGCGGCGGCGCGGG - Exonic
1185409528 22:50674623-50674645 CCCGGGCCCCGGCGCGGGGATGG + Intergenic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
950043324 3:9933795-9933817 CCTGGACTGCGGCGCGGGTGGGG + Intergenic
950187890 3:10956610-10956632 CCAGGACTCCTGCCCGGGCCTGG + Intergenic
952152315 3:30606696-30606718 CCTGGAGGCCGGCGAGGCGCGGG - Exonic
954279079 3:49563195-49563217 CCTGGAGCCAGGGGCGGGGCTGG + Intronic
954453459 3:50584215-50584237 CCAGGACTCTGGCTGGGGGCTGG - Exonic
955298520 3:57756229-57756251 CCTGGACTACGGCGCGGGAGAGG + Exonic
961641703 3:128368832-128368854 CCTGGACTCCGGCACGTGTCAGG - Intronic
963091582 3:141487524-141487546 GCTGGAGTCCGGGGCGCGGCCGG + Intronic
963123278 3:141794009-141794031 CCTGGACTCAGGTGCAGGGAGGG - Intronic
963228686 3:142888675-142888697 CCTGCGCTCCCGCGCGGTGCAGG - Intronic
968268158 3:197378537-197378559 CCTACGCTCCGGCACGGGGCTGG - Intergenic
968972369 4:3802691-3802713 CCTGGACTCTGGGGCAGGGGAGG + Intergenic
969113372 4:4857075-4857097 CCTGGACTCCGCCGCGGGGGGGG - Intergenic
970456214 4:16226532-16226554 CTCGGGCTCCGGCGAGGGGCGGG - Exonic
974502547 4:62726075-62726097 ACTGGACTGTGGCGGGGGGCTGG + Intergenic
977231064 4:94451974-94451996 CCTCGGGTCCGGCGCGGCGCGGG - Exonic
981069882 4:140523960-140523982 GCGCTACTCCGGCGCGGGGCGGG + Intergenic
981688514 4:147481252-147481274 CCCGGGCTCCGGCGCGGCGGCGG - Exonic
982564535 4:156971478-156971500 CCGGGGCGCCGGAGCGGGGCCGG + Intergenic
983217282 4:165013751-165013773 CCTGGACTCAGGGAAGGGGCAGG + Intergenic
985068343 4:186144709-186144731 CCCGGAGGTCGGCGCGGGGCCGG + Intronic
987673407 5:21044268-21044290 CCTGGAGTCAGGCGCTGAGCAGG + Intergenic
988722468 5:33892231-33892253 CCTGGCGTTCGGGGCGGGGCCGG - Intergenic
992474443 5:77088242-77088264 CCTGGACACTGCCGTGGGGCTGG - Intergenic
992627536 5:78648831-78648853 ACTGGGCAGCGGCGCGGGGCCGG - Intronic
993116250 5:83722584-83722606 CCTGGACTCTGGAGAGAGGCGGG + Intergenic
997225877 5:132209076-132209098 CCTGGACTCTGGCTCTGGGCAGG - Intronic
997583981 5:135034037-135034059 CCGGGGCTGCGGCGCCGGGCGGG + Exonic
998236181 5:140400885-140400907 CCCGAACTGCGGCGCGCGGCCGG + Intergenic
1001577094 5:172771460-172771482 CCTGGAGCGCGGCGCGGGTCCGG - Intergenic
1001640220 5:173238769-173238791 CCGGGAGTCCGGCGCGCAGCCGG - Intergenic
1002026606 5:176400106-176400128 ACTTGAATCCGGGGCGGGGCAGG + Intronic
1002186275 5:177456191-177456213 CCTGGACTGCGGGGAGGGGCGGG + Exonic
1002368463 5:178730688-178730710 CCTGGTCCCCGGCGCGCCGCGGG - Exonic
1004441974 6:15662718-15662740 CCTGGACCGTGGCGCGGGGAAGG + Intronic
1005303778 6:24495068-24495090 CCAGGCCGCCGGCGCGGGGGCGG - Exonic
1005605519 6:27473151-27473173 CCCGCACGCCGGCGCCGGGCGGG + Intergenic
1005895255 6:30172205-30172227 CCTGGACTACGAGGCGGGGCAGG + Exonic
1006295178 6:33167086-33167108 CCTGGTCTCCGGGGCGATGCTGG - Exonic
1006787821 6:36679796-36679818 GCTGGACTCCGGGGCGGGAGCGG + Intronic
1007665487 6:43510651-43510673 CCTGGATTCCGGCGGGGGTATGG - Exonic
1011416272 6:87122835-87122857 CCTCTGTTCCGGCGCGGGGCGGG - Intergenic
1017011952 6:150069180-150069202 CCTGGATCCCGGGGCGGGACGGG - Intergenic
1018443571 6:163834785-163834807 CCTGCCCTACGGGGCGGGGCGGG + Intergenic
1019299152 7:294882-294904 CCTGGACTTGGGGGCCGGGCGGG - Intergenic
1019437232 7:1028444-1028466 ACTGGACCTCGGCGCGGGGGTGG + Intronic
1019494746 7:1332461-1332483 CCTGGTCTCTGGCTTGGGGCTGG + Intergenic
1019711318 7:2519495-2519517 CAGGGACACCGGCGCGGGCCGGG + Intronic
1020010551 7:4803692-4803714 CCTGGAAGCCGTCGCTGGGCAGG + Exonic
1022285837 7:28956003-28956025 CCGGGACCACTGCGCGGGGCTGG - Exonic
1026023392 7:66727686-66727708 CCAGGACCCCTGCGAGGGGCTGG - Intronic
1026894798 7:74003766-74003788 CCGGGACGAAGGCGCGGGGCTGG - Intergenic
1032125248 7:129188787-129188809 TCTGGCCTCCCTCGCGGGGCGGG + Intergenic
1035066413 7:156108433-156108455 CGTGGACCCCGGGGCGGGGATGG - Intergenic
1035818063 8:2562138-2562160 CCTGGAGGCAGGCGCGGGGCTGG - Intergenic
1035818099 8:2562249-2562271 CCTGGAGGCAGGCGCGGGGCTGG - Intergenic
1036659870 8:10700982-10701004 TCTGGACTCAGGCAGGGGGCAGG + Intronic
1037876593 8:22551745-22551767 TCTGGACTGCGGGCCGGGGCTGG - Exonic
1041690370 8:60680348-60680370 GCTGGGCTGCGGTGCGGGGCGGG + Intronic
1042532780 8:69832639-69832661 ACTGGACTGCAGCCCGGGGCGGG - Exonic
1045738002 8:105318810-105318832 CCTGGAGTCCGGCCGGCGGCGGG + Exonic
1049166314 8:141128405-141128427 CCGGGACTTGGGGGCGGGGCCGG - Intronic
1049205604 8:141362058-141362080 CCTGGACTGCTGGGCAGGGCTGG + Intronic
1049442326 8:142615059-142615081 CCTGGACTCAGGACCCGGGCAGG - Intergenic
1049628239 8:143636271-143636293 CCTGGACGCCCTAGCGGGGCGGG - Intronic
1049683231 8:143929071-143929093 CCTGGCCACAGGCGAGGGGCTGG - Intronic
1049847064 8:144807948-144807970 CCAGGACGGCGGCGTGGGGCAGG + Exonic
1053198355 9:36136699-36136721 CCTGGGCTCTGGGGCGGCGCTGG + Intronic
1055454369 9:76459219-76459241 CCTAGAGCGCGGCGCGGGGCGGG + Intronic
1055459383 9:76503488-76503510 CATGGACTCCATCGCAGGGCGGG - Exonic
1058157732 9:101533861-101533883 CCTTGTCTCCGCCGCGGGTCAGG + Exonic
1060700824 9:125747697-125747719 CCTCGACTCGGCCGCGGGCCCGG - Intronic
1060812020 9:126615321-126615343 CCGGGACGCCGGGGCTGGGCCGG + Intronic
1060812134 9:126615802-126615824 CCCGGAATCCTGCGCTGGGCCGG + Intronic
1061127971 9:128688979-128689001 CCAGGACACTGGCGCGCGGCAGG - Intronic
1061149061 9:128818711-128818733 CCTGGCGTCGGGCGCGGGGCTGG + Exonic
1061267259 9:129514087-129514109 CCTGGGCTCCTGCTAGGGGCAGG + Intergenic
1061293728 9:129666194-129666216 CCGGGGAGCCGGCGCGGGGCGGG + Intronic
1061480520 9:130895739-130895761 GCTGGGCTCCGGGGCTGGGCTGG + Intergenic
1061491129 9:130944845-130944867 CCTGGACTTTGGTGTGGGGCAGG - Intergenic
1061954257 9:133953458-133953480 CCTGCACCCCGGCTCGGAGCTGG + Intronic
1062548371 9:137074091-137074113 CATGGACTCTGGCCTGGGGCGGG + Intergenic
1185449657 X:275572-275594 CCTGGAGTCCAGCCCGGGGTGGG + Intergenic
1185761237 X:2691184-2691206 CGTGGAGGCCGGGGCGGGGCGGG + Exonic
1189262590 X:39689060-39689082 GCAGGGCTCCGGCGCGGAGCCGG + Intergenic
1190320286 X:49176019-49176041 CGTGGCCTGCGGCGCTGGGCCGG + Exonic
1191606681 X:63070318-63070340 CCTGGACATGGGGGCGGGGCAGG + Intergenic
1192481887 X:71492868-71492890 GCGGGACGCCGGGGCGGGGCGGG + Intronic
1196763641 X:119223206-119223228 GCGGGGCTCTGGCGCGGGGCCGG + Intergenic
1197774375 X:130110229-130110251 CCGGGGCCCCGGCGTGGGGCTGG - Intronic
1200107685 X:153724135-153724157 GCTGGTCTCGGGGGCGGGGCGGG - Intronic