ID: 1161072511

View in Genome Browser
Species Human (GRCh38)
Location 19:2269911-2269933
Sequence AGAGCACTGCTAAGGCCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 105}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161072511_1161072536 26 Left 1161072511 19:2269911-2269933 CCCCCCGGCCTTAGCAGTGCTCT 0: 1
1: 0
2: 2
3: 9
4: 105
Right 1161072536 19:2269960-2269982 GGTGCGGAGTTGGATTTGGGGGG 0: 1
1: 0
2: 0
3: 11
4: 152
1161072511_1161072528 4 Left 1161072511 19:2269911-2269933 CCCCCCGGCCTTAGCAGTGCTCT 0: 1
1: 0
2: 2
3: 9
4: 105
Right 1161072528 19:2269938-2269960 GGAGTCGGGTTTGGGGGGCAAGG 0: 1
1: 0
2: 3
3: 34
4: 357
1161072511_1161072532 22 Left 1161072511 19:2269911-2269933 CCCCCCGGCCTTAGCAGTGCTCT 0: 1
1: 0
2: 2
3: 9
4: 105
Right 1161072532 19:2269956-2269978 CAAGGGTGCGGAGTTGGATTTGG 0: 1
1: 0
2: 0
3: 8
4: 101
1161072511_1161072529 5 Left 1161072511 19:2269911-2269933 CCCCCCGGCCTTAGCAGTGCTCT 0: 1
1: 0
2: 2
3: 9
4: 105
Right 1161072529 19:2269939-2269961 GAGTCGGGTTTGGGGGGCAAGGG 0: 1
1: 0
2: 1
3: 17
4: 216
1161072511_1161072522 -10 Left 1161072511 19:2269911-2269933 CCCCCCGGCCTTAGCAGTGCTCT 0: 1
1: 0
2: 2
3: 9
4: 105
Right 1161072522 19:2269924-2269946 GCAGTGCTCTCGGGGGAGTCGGG 0: 1
1: 0
2: 1
3: 13
4: 151
1161072511_1161072530 10 Left 1161072511 19:2269911-2269933 CCCCCCGGCCTTAGCAGTGCTCT 0: 1
1: 0
2: 2
3: 9
4: 105
Right 1161072530 19:2269944-2269966 GGGTTTGGGGGGCAAGGGTGCGG 0: 1
1: 5
2: 22
3: 190
4: 1490
1161072511_1161072527 -1 Left 1161072511 19:2269911-2269933 CCCCCCGGCCTTAGCAGTGCTCT 0: 1
1: 0
2: 2
3: 9
4: 105
Right 1161072527 19:2269933-2269955 TCGGGGGAGTCGGGTTTGGGGGG 0: 1
1: 0
2: 0
3: 13
4: 148
1161072511_1161072524 -4 Left 1161072511 19:2269911-2269933 CCCCCCGGCCTTAGCAGTGCTCT 0: 1
1: 0
2: 2
3: 9
4: 105
Right 1161072524 19:2269930-2269952 CTCTCGGGGGAGTCGGGTTTGGG 0: 1
1: 0
2: 0
3: 4
4: 62
1161072511_1161072526 -2 Left 1161072511 19:2269911-2269933 CCCCCCGGCCTTAGCAGTGCTCT 0: 1
1: 0
2: 2
3: 9
4: 105
Right 1161072526 19:2269932-2269954 CTCGGGGGAGTCGGGTTTGGGGG 0: 1
1: 0
2: 0
3: 10
4: 131
1161072511_1161072533 23 Left 1161072511 19:2269911-2269933 CCCCCCGGCCTTAGCAGTGCTCT 0: 1
1: 0
2: 2
3: 9
4: 105
Right 1161072533 19:2269957-2269979 AAGGGTGCGGAGTTGGATTTGGG 0: 1
1: 0
2: 0
3: 6
4: 141
1161072511_1161072534 24 Left 1161072511 19:2269911-2269933 CCCCCCGGCCTTAGCAGTGCTCT 0: 1
1: 0
2: 2
3: 9
4: 105
Right 1161072534 19:2269958-2269980 AGGGTGCGGAGTTGGATTTGGGG 0: 1
1: 0
2: 1
3: 12
4: 160
1161072511_1161072523 -5 Left 1161072511 19:2269911-2269933 CCCCCCGGCCTTAGCAGTGCTCT 0: 1
1: 0
2: 2
3: 9
4: 105
Right 1161072523 19:2269929-2269951 GCTCTCGGGGGAGTCGGGTTTGG 0: 1
1: 0
2: 0
3: 4
4: 82
1161072511_1161072525 -3 Left 1161072511 19:2269911-2269933 CCCCCCGGCCTTAGCAGTGCTCT 0: 1
1: 0
2: 2
3: 9
4: 105
Right 1161072525 19:2269931-2269953 TCTCGGGGGAGTCGGGTTTGGGG 0: 1
1: 0
2: 0
3: 7
4: 83
1161072511_1161072535 25 Left 1161072511 19:2269911-2269933 CCCCCCGGCCTTAGCAGTGCTCT 0: 1
1: 0
2: 2
3: 9
4: 105
Right 1161072535 19:2269959-2269981 GGGTGCGGAGTTGGATTTGGGGG 0: 1
1: 0
2: 1
3: 21
4: 214
1161072511_1161072531 16 Left 1161072511 19:2269911-2269933 CCCCCCGGCCTTAGCAGTGCTCT 0: 1
1: 0
2: 2
3: 9
4: 105
Right 1161072531 19:2269950-2269972 GGGGGGCAAGGGTGCGGAGTTGG 0: 1
1: 0
2: 0
3: 37
4: 503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161072511 Original CRISPR AGAGCACTGCTAAGGCCGGG GGG (reversed) Intronic
902609162 1:17587285-17587307 ACAGTGCTGGTAAGGCCGGGGGG - Intronic
902627574 1:17685394-17685416 ACAGCAGTGCAAAGGCCCGGAGG - Intronic
903930261 1:26857821-26857843 AGAGGTCAGCTAAGGCTGGGTGG - Intergenic
907311255 1:53540398-53540420 AGACCCCTGCTGAGGCCGTGGGG - Intronic
914675956 1:149907686-149907708 ATAACACTGGTAAGGCGGGGTGG - Exonic
919780576 1:201218347-201218369 AGAGCACTGCTCAGGGCGTCAGG - Intronic
922909730 1:229205353-229205375 ACAGCACCTCTCAGGCCGGGCGG + Intergenic
1063429657 10:5977530-5977552 CGAGCGCTGCCCAGGCCGGGGGG + Exonic
1065812213 10:29452554-29452576 ACAGCTCTGCTGAGGCTGGGAGG + Intergenic
1065959574 10:30723589-30723611 ACAGCTCTGCTGAGGCTGGGAGG - Intergenic
1070288401 10:75099735-75099757 AGAGAACTTCTGAGGCAGGGAGG + Intronic
1072069966 10:91906738-91906760 AGAACAATGATAAGGCCAGGTGG + Exonic
1072801246 10:98393769-98393791 AGAGCAGTGCCAAGCCGGGGAGG - Intronic
1073306062 10:102504218-102504240 AGAGCGAAGCGAAGGCCGGGGGG - Exonic
1074867993 10:117555944-117555966 AAAGCACAGCTAGGGCTGGGTGG + Intergenic
1077578681 11:3403182-3403204 AGAGCACTGCTCTGGTGGGGAGG - Intergenic
1078519313 11:12050789-12050811 AGAGTGCTGCTCAGGCAGGGAGG - Intergenic
1084144231 11:67255606-67255628 AGAGCACAGTTAAGGACGTGAGG - Exonic
1084195795 11:67523192-67523214 AGAGCCCTCCGAGGGCCGGGCGG - Intronic
1084220454 11:67674526-67674548 AGAGCAGGGCTGAGGCCTGGGGG - Exonic
1089234350 11:117010399-117010421 AGAGCACCGATAAGCCAGGGAGG + Intronic
1092100012 12:5875369-5875391 AGAGCAGTGCTGAGGCCAGCAGG - Intronic
1101710787 12:107263270-107263292 GGAGAACTGCGAAGGCTGGGAGG + Intergenic
1105401239 13:20097958-20097980 AAATGACTGCTAAGGCTGGGGGG - Intergenic
1106786308 13:33111044-33111066 AGATCATTGCCAAGGCCGGGAGG + Intronic
1111557088 13:89894869-89894891 GTAGCAATGCAAAGGCCGGGTGG - Intergenic
1120974331 14:90235469-90235491 AGAGCACTTCTTAGGCAGGGAGG + Intergenic
1122739292 14:103861963-103861985 AGAGCACAGGCAAGGCCAGGAGG + Intergenic
1122985487 14:105209759-105209781 AGAGCTATGCTCAGGACGGGTGG + Exonic
1125718478 15:41833643-41833665 GGAGGATTGCTGAGGCCGGGAGG - Intronic
1128688369 15:69704348-69704370 AGAGCTCTGCCAAGGCCAAGAGG - Intergenic
1129460991 15:75700023-75700045 GGAGCCCTGCTAGGGCTGGGGGG - Intronic
1132396353 15:101477935-101477957 AGAGCCCTGATAAGGAGGGGAGG + Intronic
1132969111 16:2676550-2676572 AGAGCACTGGCCAGGCCAGGTGG + Intergenic
1133347288 16:5079332-5079354 AGAGCACTGCTCTGGCGGGGAGG - Intronic
1136070203 16:27782911-27782933 AGAGCACTGCTCAGGCTCTGGGG - Intergenic
1140483345 16:75274870-75274892 AGAGCAGTGCAAAGGCCCTGGGG - Intergenic
1140771457 16:78208103-78208125 AGAGCACTGCTGAGGCCAGATGG - Intronic
1141156342 16:81599803-81599825 ACAACAATGCTAAGGCGGGGAGG - Intronic
1142534135 17:602045-602067 AAAGCACTGTGAAGGCCCGGAGG - Intronic
1142744341 17:1948231-1948253 AGAGCACTGCCAGGACCAGGTGG - Intronic
1143661459 17:8327038-8327060 GGAGCCCCGCTAAGGTCGGGAGG - Intergenic
1146935864 17:36812434-36812456 ATAGCAGTGCAAAGGCCTGGAGG - Intergenic
1153792773 18:8595101-8595123 AGGGCACTGCTATGGCCTAGTGG + Intergenic
1156628123 18:38934287-38934309 AGAGCAGTGAGAAGGCCTGGAGG + Intergenic
1161072511 19:2269911-2269933 AGAGCACTGCTAAGGCCGGGGGG - Intronic
1166959873 19:46490939-46490961 AGAGCAGTGCAAAGGCCATGAGG + Intronic
1167019274 19:46861586-46861608 GGAGCACTGCAGAGCCCGGGAGG - Intergenic
1167118340 19:47501192-47501214 GGAGGACTGCCCAGGCCGGGAGG - Intronic
1167248918 19:48390716-48390738 AGGGCCCTGCTCAGGCGGGGCGG - Intronic
1167636938 19:50660706-50660728 AGAGCACTGAAAATGCTGGGGGG + Intronic
1168401351 19:56087733-56087755 AGAGAACTGCAGAGGCCGAGTGG - Exonic
1168552186 19:57305607-57305629 GGAGGACTGCTTAGGCCAGGAGG - Intergenic
929780166 2:44952279-44952301 AGAGCGCCGCGAAGGCCGGAGGG - Intergenic
938094253 2:128451348-128451370 GGAGCCCTGTTAAGGCCGGAGGG - Intergenic
942182208 2:173390662-173390684 AGAGCAGTGCCCAGCCCGGGAGG - Intergenic
942445966 2:176079506-176079528 GGAGGTCTGATAAGGCCGGGAGG - Exonic
946669051 2:222082803-222082825 AGAGCATTGCTGTGGCGGGGAGG - Intergenic
948945181 2:241215764-241215786 AGAGCTCTGCCAAGGTTGGGAGG - Intronic
1170674596 20:18467398-18467420 AGCGCTCTGCTGAGGCCGAGGGG - Exonic
1170893234 20:20393267-20393289 AGAGAACTGCTAAGTCATGGAGG + Intronic
1171973838 20:31581432-31581454 AAAGCACTGCCGAGGCTGGGTGG - Intergenic
1173576814 20:44117362-44117384 AGATCTCTACCAAGGCCGGGAGG + Intronic
1184322746 22:43755236-43755258 AGCACACAGCTAAGGCGGGGAGG - Intronic
1185058181 22:48592014-48592036 AGAGACCTGCTAAGGAGGGGAGG - Intronic
949508696 3:4750027-4750049 AGACAACTGCTTAGGCCTGGAGG + Intronic
955195417 3:56801399-56801421 AGAGCCCTGCAAAGGCAAGGAGG + Intronic
956647087 3:71466766-71466788 AGAGCACTGCCTAGGGCAGGGGG + Intronic
957001615 3:74893149-74893171 AGAGCACTGCTTAAACCTGGAGG + Intergenic
960941970 3:122940809-122940831 AGAGCTCTGCTAAGGACTTGGGG - Intronic
961302791 3:125933099-125933121 AGAGCACTGCTCTGGTGGGGAGG + Intronic
961885274 3:130092673-130092695 AGTGCACTGCTCTGGCAGGGAGG - Intronic
962964210 3:140338567-140338589 TGAGCACTACTGAGGCCGGGGGG - Intronic
963328889 3:143892400-143892422 AGAGAGCTGCTAAGGCCAAGTGG - Intergenic
965595333 3:170405083-170405105 AAAGAACTAATAAGGCCGGGCGG - Intergenic
965845760 3:172959384-172959406 AGAGCCCTGTTAAGGCCTGAAGG - Intronic
966751198 3:183323705-183323727 AGAGGACTGCTTGGGCCTGGAGG + Intronic
967035259 3:185644573-185644595 AGAGCACTGCTTTGCCTGGGGGG + Exonic
968994466 4:3936875-3936897 AGAGCACTGCTCTGGTGGGGAGG - Intergenic
969819471 4:9709361-9709383 AGAGCACTGCTCTGGTGGGGAGG + Intergenic
971144031 4:23957140-23957162 TGAGCACTGCATAGGCTGGGTGG - Intergenic
972639021 4:40908974-40908996 AGAGCAGTGCTGTGGCCTGGAGG - Intronic
972793952 4:42398131-42398153 AGAGTACTGCCACGGCTGGGTGG + Exonic
977020331 4:91750999-91751021 TGAGAACTGCTAAGGTAGGGAGG + Intergenic
986826744 5:11530610-11530632 AGTGCAGTGCTGAGGCCTGGAGG - Intronic
997698832 5:135882163-135882185 GGAGGACTGCTAAGGCAGGGAGG + Intronic
1001565983 5:172699795-172699817 AGAGCACAGCGAAGGCCCAGGGG + Intergenic
1016336607 6:143012162-143012184 AAAGCTATGCTAAGGACGGGAGG - Intergenic
1018065631 6:160123424-160123446 AGAGCAATGCTCAGGCCCAGAGG - Intronic
1019161256 6:170068250-170068272 AGGGCACTGCAAAGGCCCAGTGG + Intergenic
1019161273 6:170068310-170068332 AGGGCACTGCAAAGGCCCAGTGG + Intergenic
1019264067 7:102549-102571 AGAGCACTGCTGAGGACAGCTGG - Intergenic
1021730033 7:23587012-23587034 AGAGCACTGAGAAGGGAGGGGGG - Intergenic
1024971994 7:55079146-55079168 AAAGCCCCGCTAAGGCTGGGCGG + Intronic
1030148958 7:106383532-106383554 AGAGCACTGCAAAGGCTTGTAGG - Intergenic
1033399411 7:141007657-141007679 AGAGCACAGCAAAGGCCTTGAGG - Intronic
1033660591 7:143399328-143399350 AGAGCACTGCTGAGTCTGAGGGG - Exonic
1034555234 7:151846035-151846057 CGAGCACTGATCAGGCCGGGAGG - Intronic
1036381668 8:8239954-8239976 AGTGCACTGCTCTGGCAGGGAGG + Intergenic
1037694982 8:21215706-21215728 AGAGCACTGCTAAGCCCTGGAGG + Intergenic
1039114359 8:34075587-34075609 AAAGCACTGATCAGGCCGGGCGG - Intergenic
1039908743 8:41807629-41807651 AGGACACTGATGAGGCCGGGCGG + Intronic
1041576489 8:59402132-59402154 AAAGCAGTGCTAAGGGGGGGGGG + Intergenic
1045267278 8:100630472-100630494 AGAGCACTGGCAAGGCATGGAGG - Intronic
1045513246 8:102831863-102831885 GGAGGACTGCTTAAGCCGGGAGG + Intronic
1049189134 8:141276942-141276964 AGGGCAGTGCTTAGGCCGGGGGG - Intronic
1049610430 8:143552653-143552675 AGAGCCCTGCTAAGGCCAGGGGG - Intergenic
1049820023 8:144627855-144627877 AGAGCACTGCTGTGACTGGGAGG - Intergenic
1057438382 9:95063280-95063302 AGAGACCTGCTAAGGCAGGCAGG - Intronic
1058486250 9:105445949-105445971 AGAGCTTGGCTAAGGCTGGGTGG - Intergenic
1059412142 9:114139278-114139300 AGAGCACTGCTGACCCAGGGAGG - Intergenic
1060400551 9:123346347-123346369 AGCGCACTGCACAGCCCGGGAGG - Intergenic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1060899461 9:127244980-127245002 AGCGCACTGCAGAGGACGGGAGG + Intronic
1061904874 9:133691458-133691480 AGAGCAGTGAGAAGGCAGGGTGG + Intronic
1188368813 X:29343474-29343496 AGAACCCTGCTAAAACCGGGTGG + Intronic
1197750556 X:129961055-129961077 AGAGCAGTGCCAAGGCAGAGAGG + Intergenic