ID: 1161072512

View in Genome Browser
Species Human (GRCh38)
Location 19:2269912-2269934
Sequence GAGAGCACTGCTAAGGCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 86}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161072512_1161072532 21 Left 1161072512 19:2269912-2269934 CCCCCGGCCTTAGCAGTGCTCTC 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1161072532 19:2269956-2269978 CAAGGGTGCGGAGTTGGATTTGG 0: 1
1: 0
2: 0
3: 8
4: 101
1161072512_1161072523 -6 Left 1161072512 19:2269912-2269934 CCCCCGGCCTTAGCAGTGCTCTC 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1161072523 19:2269929-2269951 GCTCTCGGGGGAGTCGGGTTTGG 0: 1
1: 0
2: 0
3: 4
4: 82
1161072512_1161072529 4 Left 1161072512 19:2269912-2269934 CCCCCGGCCTTAGCAGTGCTCTC 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1161072529 19:2269939-2269961 GAGTCGGGTTTGGGGGGCAAGGG 0: 1
1: 0
2: 1
3: 17
4: 216
1161072512_1161072527 -2 Left 1161072512 19:2269912-2269934 CCCCCGGCCTTAGCAGTGCTCTC 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1161072527 19:2269933-2269955 TCGGGGGAGTCGGGTTTGGGGGG 0: 1
1: 0
2: 0
3: 13
4: 148
1161072512_1161072534 23 Left 1161072512 19:2269912-2269934 CCCCCGGCCTTAGCAGTGCTCTC 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1161072534 19:2269958-2269980 AGGGTGCGGAGTTGGATTTGGGG 0: 1
1: 0
2: 1
3: 12
4: 160
1161072512_1161072531 15 Left 1161072512 19:2269912-2269934 CCCCCGGCCTTAGCAGTGCTCTC 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1161072531 19:2269950-2269972 GGGGGGCAAGGGTGCGGAGTTGG 0: 1
1: 0
2: 0
3: 37
4: 503
1161072512_1161072524 -5 Left 1161072512 19:2269912-2269934 CCCCCGGCCTTAGCAGTGCTCTC 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1161072524 19:2269930-2269952 CTCTCGGGGGAGTCGGGTTTGGG 0: 1
1: 0
2: 0
3: 4
4: 62
1161072512_1161072526 -3 Left 1161072512 19:2269912-2269934 CCCCCGGCCTTAGCAGTGCTCTC 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1161072526 19:2269932-2269954 CTCGGGGGAGTCGGGTTTGGGGG 0: 1
1: 0
2: 0
3: 10
4: 131
1161072512_1161072533 22 Left 1161072512 19:2269912-2269934 CCCCCGGCCTTAGCAGTGCTCTC 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1161072533 19:2269957-2269979 AAGGGTGCGGAGTTGGATTTGGG 0: 1
1: 0
2: 0
3: 6
4: 141
1161072512_1161072530 9 Left 1161072512 19:2269912-2269934 CCCCCGGCCTTAGCAGTGCTCTC 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1161072530 19:2269944-2269966 GGGTTTGGGGGGCAAGGGTGCGG 0: 1
1: 5
2: 22
3: 190
4: 1490
1161072512_1161072528 3 Left 1161072512 19:2269912-2269934 CCCCCGGCCTTAGCAGTGCTCTC 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1161072528 19:2269938-2269960 GGAGTCGGGTTTGGGGGGCAAGG 0: 1
1: 0
2: 3
3: 34
4: 357
1161072512_1161072536 25 Left 1161072512 19:2269912-2269934 CCCCCGGCCTTAGCAGTGCTCTC 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1161072536 19:2269960-2269982 GGTGCGGAGTTGGATTTGGGGGG 0: 1
1: 0
2: 0
3: 11
4: 152
1161072512_1161072535 24 Left 1161072512 19:2269912-2269934 CCCCCGGCCTTAGCAGTGCTCTC 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1161072535 19:2269959-2269981 GGGTGCGGAGTTGGATTTGGGGG 0: 1
1: 0
2: 1
3: 21
4: 214
1161072512_1161072525 -4 Left 1161072512 19:2269912-2269934 CCCCCGGCCTTAGCAGTGCTCTC 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1161072525 19:2269931-2269953 TCTCGGGGGAGTCGGGTTTGGGG 0: 1
1: 0
2: 0
3: 7
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161072512 Original CRISPR GAGAGCACTGCTAAGGCCGG GGG (reversed) Intronic
902581967 1:17413500-17413522 CAGAGCACTGATAAGCCAGGGGG + Intronic
903667048 1:25014376-25014398 GTCAGCACTGCTCAGGCTGGTGG + Intergenic
903970933 1:27118327-27118349 GAAAGCACTTCTAGGGCTGGGGG + Intronic
907272687 1:53300105-53300127 GAGTGCCCTGCTAAGGCAGTTGG - Intronic
907311256 1:53540399-53540421 GAGACCCCTGCTGAGGCCGTGGG - Intronic
916150809 1:161787522-161787544 GAGGGCACTGATATGGCAGGCGG - Intronic
918160725 1:181896617-181896639 AAGAGGACTGCTAAGTCTGGAGG - Intergenic
919229207 1:194751705-194751727 GAGAGCACTGTAAAGGCCCTAGG + Intergenic
922727085 1:227927591-227927613 CAGAGCACGGCTAGGGCGGGAGG + Intronic
1063429656 10:5977529-5977551 GCGAGCGCTGCCCAGGCCGGGGG + Exonic
1071513467 10:86281898-86281920 TAGAGCACTGCTCAGGGAGGGGG + Intronic
1072430023 10:95362659-95362681 GTGAGCAATGATAAGGCGGGAGG - Intronic
1072616219 10:97050353-97050375 GAGAGCACCGCCAAGGTCTGAGG - Intronic
1083882371 11:65554951-65554973 GAGAGCCCTGGAAAGGCTGGGGG - Intronic
1089256656 11:117197790-117197812 GGGAGCACTGCTTGGGCCTGTGG - Intergenic
1092016931 12:5167368-5167390 CAGAGGACTGCTAAGGCCGCAGG - Intergenic
1093546700 12:20357094-20357116 AAGAGCACTCCTTAGGCCAGTGG - Intergenic
1095743520 12:45632736-45632758 GAGAGCCCTGCCAAGAACGGAGG + Intergenic
1100745504 12:97641193-97641215 GAGAACCCTGCCAAGGCGGGTGG - Intergenic
1105401240 13:20097959-20097981 GAAATGACTGCTAAGGCTGGGGG - Intergenic
1105734106 13:23249339-23249361 GAAAGGACTGCTAAGGTTGGGGG - Intronic
1106136317 13:26976223-26976245 GAGAGCACTGCCGAGGGCTGTGG - Intergenic
1114672253 14:24417504-24417526 GAGAGCACTGCTGGGACAGGGGG - Exonic
1122685740 14:103505201-103505223 AAGAGCACTGCTTGGGCCTGAGG + Intergenic
1123205736 14:106711373-106711395 GAGAGCACTGCAGAGCCCCGTGG - Intergenic
1125514334 15:40309338-40309360 AAGAGCAATTCTAGGGCCGGGGG + Intergenic
1131496414 15:92915156-92915178 GAGAGCACTGCTGAATCCTGGGG + Intronic
1132870863 16:2115224-2115246 GAGGGCACTGCAGAGGTCGGAGG + Intronic
1134093247 16:11402672-11402694 GAGAGCCCAGCCAAGGCCAGCGG + Intronic
1136070204 16:27782912-27782934 GAGAGCACTGCTCAGGCTCTGGG - Intergenic
1141275907 16:82588134-82588156 GAGAACACAGCTTAGGCCTGAGG + Intergenic
1143771198 17:9170039-9170061 GAGAGCACTTATGGGGCCGGGGG + Intronic
1148080677 17:44966485-44966507 GAGAGCACTGGGAAGGGAGGTGG + Intronic
1148208475 17:45794066-45794088 GAGAGCCCTGCTTTGGCTGGAGG - Intronic
1149641396 17:58205156-58205178 TAAAGCACTGCTAAGGGCAGGGG + Exonic
1155905379 18:31444507-31444529 GAAAGAACTGCTAAGTCCAGAGG + Intergenic
1156347233 18:36268875-36268897 GAGAGCACTTCTGAGGCCTCAGG + Exonic
1157734399 18:50033879-50033901 GAGAGAACTGCTAGTGCTGGAGG - Intronic
1159219570 18:65441787-65441809 GAGTGCACGGCCAAGGCTGGTGG - Intergenic
1159917326 18:74198845-74198867 CAGAGCGCTGCTAAGTCCTGGGG - Intergenic
1161072512 19:2269912-2269934 GAGAGCACTGCTAAGGCCGGGGG - Intronic
1167636937 19:50660705-50660727 GAGAGCACTGAAAATGCTGGGGG + Intronic
1168316774 19:55488090-55488112 GAGACCACTGCTAGGGTTGGGGG - Intergenic
925310266 2:2876778-2876800 GAGGGCACAGCTGAGGCCAGAGG - Intergenic
927635958 2:24817042-24817064 GAGAACACTGCTGAGGTGGGTGG - Intronic
929780167 2:44952280-44952302 GAGAGCGCCGCGAAGGCCGGAGG - Intergenic
933779015 2:85788608-85788630 GAGAGCACTGTCAAGGCAGAAGG + Intergenic
938094254 2:128451349-128451371 AGGAGCCCTGTTAAGGCCGGAGG - Intergenic
938169057 2:129058607-129058629 GAGAGCTCTTGAAAGGCCGGTGG - Intergenic
945060386 2:205903802-205903824 GGGAGGACTGCTAAGCCCAGGGG - Intergenic
948219340 2:236257224-236257246 AAGAGCAATGCTCAGGCTGGTGG + Intronic
1169003629 20:2188600-2188622 GAGAGCCCTGCTAAAACCAGTGG - Intergenic
1169767769 20:9166621-9166643 GAGAGCACGCCTGAGGCAGGTGG - Intronic
1172134978 20:32680820-32680842 GAGAGCTCTGCAAAGGCCCCAGG + Intergenic
1176375414 21:6084720-6084742 CAGAGCAGTGCCAGGGCCGGAGG - Intergenic
1178269139 21:31173924-31173946 GTGGGCCCTGCTATGGCCGGGGG - Intronic
1178636852 21:34311339-34311361 GAGAGAACAGCTAAGGCTGAAGG - Intergenic
1179748060 21:43453524-43453546 CAGAGCAGTGCCAGGGCCGGAGG + Intergenic
1181167963 22:20993379-20993401 CAGAGCTCTGCTGAGGCCTGGGG + Intronic
1183056186 22:35307590-35307612 TAGAGCACTGCAAAGTGCGGTGG + Intronic
1185413031 22:50695903-50695925 GACAGAACTGTAAAGGCCGGCGG - Intergenic
950579454 3:13852927-13852949 GAGAGCACTGGGCAGGCAGGAGG + Intronic
950719138 3:14870202-14870224 GAGAGCAGTGCAAGGGCAGGAGG + Intronic
953028027 3:39156051-39156073 GAGAGCACAGCTGAGGTCTGAGG - Intergenic
959254537 3:103992238-103992260 GAGAGCACAGCAAAGTCTGGGGG + Intergenic
960941971 3:122940810-122940832 GAGAGCTCTGCTAAGGACTTGGG - Intronic
961324912 3:126104260-126104282 CATAGCACTGCCAAGGCCTGGGG - Intronic
962323112 3:134407341-134407363 GTCAGAACTGGTAAGGCCGGTGG + Intergenic
962964211 3:140338568-140338590 CTGAGCACTACTGAGGCCGGGGG - Intronic
967903889 3:194486045-194486067 GAGAGCACTGCTAGGGCAAAGGG + Intronic
981818477 4:148858366-148858388 GATAGCACTCCTAAGGCAAGAGG - Intergenic
988799056 5:34679383-34679405 GAGAGCCTTGCTGAGGCCAGAGG + Intronic
993920377 5:93794009-93794031 GAGAGCACTCCCAAGGGCTGAGG + Intronic
1006798749 6:36746351-36746373 GAGAGGACTGATCAGGCTGGGGG - Intronic
1016926918 6:149360476-149360498 GAGAACAGTGCCAAGGCAGGGGG + Intronic
1018500296 6:164402538-164402560 GGGAGGATTGCTGAGGCCGGTGG - Intergenic
1019703767 7:2487876-2487898 GGGAGCACTGCCAAGTCCTGGGG + Intergenic
1022100445 7:27166246-27166268 GAGTGCCCTGGTAGGGCCGGCGG - Intronic
1032024641 7:128431344-128431366 GAGAGCACTGCTCTGGCCAGTGG + Intergenic
1034218496 7:149426306-149426328 GAGAGCACTGTTATGGCAAGAGG - Intergenic
1039196995 8:35043710-35043732 TAGAGCAGTGCTAAGACAGGTGG + Intergenic
1041100800 8:54395038-54395060 GGGAGCACAGCTCAGGCTGGAGG - Intergenic
1041576488 8:59402131-59402153 GAAAGCAGTGCTAAGGGGGGGGG + Intergenic
1046980421 8:120330734-120330756 GACAGCAATGATAAGGCCGAGGG - Intronic
1049189135 8:141276943-141276965 GAGGGCAGTGCTTAGGCCGGGGG - Intronic
1049196347 8:141317902-141317924 GAGAGCAATGCTAAAGCCAGAGG + Intergenic
1049610431 8:143552654-143552676 AAGAGCCCTGCTAAGGCCAGGGG - Intergenic
1053414088 9:37935477-37935499 TAGAGCACTGCTATGGCCACAGG + Intronic
1056594839 9:87998768-87998790 GAAAGAACTGCTGGGGCCGGGGG - Intergenic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1062688548 9:137828708-137828730 TAGAGCATCTCTAAGGCCGGTGG + Intronic
1195287144 X:103396404-103396426 GAGTGCCCTGCTGGGGCCGGGGG + Intergenic
1196820317 X:119695480-119695502 GCGAGGAGTGCTAAGGCGGGCGG - Intergenic