ID: 1161072694

View in Genome Browser
Species Human (GRCh38)
Location 19:2270512-2270534
Sequence GTGCGCCACCCCCAGCTCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1010
Summary {0: 1, 1: 0, 2: 4, 3: 141, 4: 864}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161072694_1161072698 2 Left 1161072694 19:2270512-2270534 CCGGGGAGCTGGGGGTGGCGCAC 0: 1
1: 0
2: 4
3: 141
4: 864
Right 1161072698 19:2270537-2270559 CGACAGCCCGGCAGCGCCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 85
1161072694_1161072697 1 Left 1161072694 19:2270512-2270534 CCGGGGAGCTGGGGGTGGCGCAC 0: 1
1: 0
2: 4
3: 141
4: 864
Right 1161072697 19:2270536-2270558 CCGACAGCCCGGCAGCGCCCTGG 0: 1
1: 0
2: 1
3: 15
4: 174
1161072694_1161072704 24 Left 1161072694 19:2270512-2270534 CCGGGGAGCTGGGGGTGGCGCAC 0: 1
1: 0
2: 4
3: 141
4: 864
Right 1161072704 19:2270559-2270581 GAAGACCCCCGCCGCTTCCCGGG 0: 1
1: 0
2: 0
3: 10
4: 98
1161072694_1161072703 23 Left 1161072694 19:2270512-2270534 CCGGGGAGCTGGGGGTGGCGCAC 0: 1
1: 0
2: 4
3: 141
4: 864
Right 1161072703 19:2270558-2270580 GGAAGACCCCCGCCGCTTCCCGG 0: 1
1: 0
2: 1
3: 9
4: 104
1161072694_1161072695 -10 Left 1161072694 19:2270512-2270534 CCGGGGAGCTGGGGGTGGCGCAC 0: 1
1: 0
2: 4
3: 141
4: 864
Right 1161072695 19:2270525-2270547 GGTGGCGCACTCCGACAGCCCGG 0: 1
1: 0
2: 0
3: 9
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161072694 Original CRISPR GTGCGCCACCCCCAGCTCCC CGG (reversed) Intronic
900134149 1:1107085-1107107 GGGCACCACCCCCTGCTCCGCGG + Intronic
900473247 1:2864634-2864656 GTGCCCCCACCCCAGCTGCCTGG - Intergenic
900979086 1:6035956-6035978 CTGCGGCTTCCCCAGCTCCCAGG - Intronic
901783391 1:11609038-11609060 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
901954083 1:12771360-12771382 TTGCACCACCCCCAGGACCCTGG - Intergenic
902100378 1:13983201-13983223 GAGCGCCACCCCTTGCTCCACGG - Intergenic
902396758 1:16136153-16136175 GGTCACCACGCCCAGCTCCCAGG + Intronic
902515976 1:16989863-16989885 TAGGGCCGCCCCCAGCTCCCTGG - Intronic
902827644 1:18987946-18987968 CTGGGCCACCACCACCTCCCAGG - Intergenic
902963916 1:19984529-19984551 GAGCGCCATCCCCTGCTCCATGG - Intergenic
903326284 1:22570705-22570727 GTGGCCTGCCCCCAGCTCCCGGG - Intronic
903365396 1:22802658-22802680 CAGCCCCACCCCCAACTCCCTGG + Intronic
904238846 1:29131182-29131204 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
904481933 1:30799427-30799449 TTGCCCCACCCCCATCTCTCAGG - Intergenic
904859159 1:33521709-33521731 CTGCCCCACCCCGGGCTCCCCGG - Intronic
905519848 1:38589299-38589321 GTGCTCCACTCCCAGGGCCCTGG - Intergenic
906797719 1:48711104-48711126 GTGATCCACCTCCAGGTCCCAGG + Intronic
907102189 1:51847416-51847438 GAGCGCCGCCCCCTGCTCCACGG - Intronic
907283781 1:53367731-53367753 TGGCTCCACACCCAGCTCCCTGG + Intergenic
907513543 1:54979655-54979677 GTTAGTCACCCCCAGCTCACTGG + Intergenic
907889544 1:58623753-58623775 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
907980100 1:59472407-59472429 GAGCGCCGCCCCCTGCTCCACGG + Intronic
908888640 1:68818034-68818056 GAGCGCCACCCCCTGCTCCACGG + Intergenic
909317980 1:74247938-74247960 GGGCACCACCCCCTGCTCCACGG - Intronic
909904515 1:81178645-81178667 GAGCACCACCCCCTGCTCCACGG - Intergenic
910034719 1:82776820-82776842 GAGCACCACCCCCTGCTCCACGG - Intergenic
910550344 1:88467393-88467415 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
911001494 1:93170551-93170573 GAGCGCCACTCCCTGCTCCACGG + Intronic
911259548 1:95669666-95669688 GAGTGCCACCCCCTGCTCCACGG - Intergenic
911305185 1:96224376-96224398 GAGCACCACCCCCTGCTCCCCGG - Intergenic
911839197 1:102660050-102660072 GAGCGCCGCCCCCTGCTCCAGGG - Intergenic
911853996 1:102854098-102854120 GGGCGCCGCCCCCTGCTCCAGGG + Intergenic
912449123 1:109758769-109758791 GAGTCCCACCCCCTGCTCCCTGG + Intronic
912819322 1:112854551-112854573 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
913469045 1:119171827-119171849 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
913692064 1:121289142-121289164 GAGCACCACCCCCTGCTCCATGG - Intronic
914145494 1:144990972-144990994 GAGCACCACCCCCTGCTCCATGG + Intronic
914203379 1:145505908-145505930 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
914482501 1:148079062-148079084 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
915104172 1:153522099-153522121 GAGCGCCACCCCCTGCTCCACGG + Intergenic
915325899 1:155080975-155080997 CGGCCCCGCCCCCAGCTCCCCGG - Intronic
915586745 1:156847920-156847942 GTGAATCTCCCCCAGCTCCCCGG - Intronic
915604473 1:156941896-156941918 ATCCTCCACCCCCAGGTCCCCGG - Exonic
915973916 1:160372602-160372624 GTGCTCCTCCCCCAGCTCCAGGG + Exonic
916004311 1:160645822-160645844 GTGCAGCACCCCCACATCCCTGG + Intronic
916008253 1:160681167-160681189 CTGTGCCCCCCTCAGCTCCCAGG + Intronic
916219917 1:162433474-162433496 GAGCGCCGCCCCCTGCTCCAAGG + Intergenic
916939059 1:169661444-169661466 CTGAGCCTCCCCCAACTCCCTGG + Intergenic
916940096 1:169668282-169668304 CTGAGCCTCCCCCAACTCCCTGG + Intronic
917578501 1:176349305-176349327 GAGCGCCGCCCCCTGCTCCATGG - Intergenic
918458804 1:184754855-184754877 GAGCGCCTCCCCCAGCTTTCCGG + Exonic
918511970 1:185321753-185321775 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
918659714 1:187073854-187073876 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
918708990 1:187703942-187703964 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
918720882 1:187850524-187850546 GAGCGCCTCCCCCTGCTCCACGG + Intergenic
918732257 1:188013359-188013381 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
918973379 1:191448469-191448491 GTGCCCCACCCCCAGCCTCGCGG + Intergenic
919167903 1:193918950-193918972 GAGCACCACCCCCTGCTCCGCGG - Intergenic
919174517 1:194002163-194002185 GAGCGCCACCCCCTGCTCCATGG + Intergenic
919297726 1:195722952-195722974 GAGCACCACCCCCTGCTCCACGG - Intergenic
919382158 1:196872833-196872855 GTCCTCCACCCCCAGTTCCAGGG + Intronic
919419725 1:197355433-197355455 GAGCACCACCCCCTGCTCCGCGG - Intronic
919841240 1:201610942-201610964 CTTCGCCACCCCCAGGGCCCAGG - Intergenic
920479385 1:206307490-206307512 GAGCACCACCCCCTGCTCCATGG - Intronic
920731321 1:208488476-208488498 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
920756729 1:208740000-208740022 GAGCGCCACCCCCTGCTCCAGGG + Intergenic
920881982 1:209888989-209889011 GAGCGCCGCCCCCTGCTCCGCGG - Intergenic
921341144 1:214135950-214135972 ATGCGCCACCCCCAGTGGCCAGG - Intergenic
921396331 1:214673185-214673207 CAGCGCCACCCCCTGCTCCACGG - Intergenic
921801859 1:219410974-219410996 GAGCGCCACCCCCTGCTCCATGG + Intergenic
921897143 1:220412754-220412776 GAGCACCACCCCCTGCTCCACGG + Intergenic
922056876 1:222050068-222050090 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
922166089 1:223117000-223117022 GGGCGCCGCCCCCTGCTCCACGG - Intronic
922423261 1:225473029-225473051 GAGCACCACCCCCTGCTCCACGG + Intergenic
923035362 1:230281445-230281467 GTGCGTAGCCCCCAGCACCCAGG + Exonic
923126927 1:231040761-231040783 CTGTGCCACCCTCAGCTCACTGG + Intergenic
923126955 1:231040859-231040881 CTGTGCCACCCCCAGTTCACTGG + Intergenic
923157185 1:231289513-231289535 GAGCGCCACCCTCTGCTCCATGG - Intergenic
923172561 1:231430855-231430877 GAGCCCCACCCCCTGCTCCAAGG - Intergenic
923324763 1:232871482-232871504 GAGCACCACCCCCTGCTCCACGG - Intergenic
923565543 1:235073530-235073552 GTGCTCCACACCCAGAGCCCTGG + Intergenic
924117572 1:240762811-240762833 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
924219186 1:241855618-241855640 GAGCACCACCCCCTGCTCCACGG - Intronic
924313726 1:242774407-242774429 GGGCGCCACCCCCTGCTCCATGG - Intergenic
924681155 1:246235571-246235593 GTGAGCCACCTCCAGCTCACAGG + Intronic
1063318676 10:5032557-5032579 GAGCACCACCCCCTGCTCCACGG - Intronic
1063929888 10:11018235-11018257 GGGCGTCGCCCGCAGCTCCCGGG + Intronic
1063960461 10:11301633-11301655 GAGGGCCACGCTCAGCTCCCAGG - Intronic
1063971329 10:11383132-11383154 AAGCCCCAACCCCAGCTCCCAGG + Intergenic
1063993522 10:11593784-11593806 GTGAGCCACGCCTAGCTGCCTGG + Intronic
1064059979 10:12129490-12129512 GCGCGCCAGCCCCGCCTCCCGGG + Intergenic
1064197840 10:13259928-13259950 GAGCACCACCCCCTGCTCCACGG + Intergenic
1065441386 10:25756320-25756342 GAGCGCCACCCCCTGCTCCAGGG + Intergenic
1065690408 10:28326821-28326843 GTTTGCAAACCCCAGCTCCCGGG + Intronic
1065743226 10:28815712-28815734 GAGCGCCACTCCCTGCTCCACGG - Intergenic
1065895933 10:30163134-30163156 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1066190319 10:33049548-33049570 GAGCGCCACCACCTGCTCCAGGG + Intergenic
1066234096 10:33468355-33468377 GAGCACCACCCCCTGCTCCACGG + Intergenic
1066235410 10:33480506-33480528 GAGCACCACCCCCTGCTCCAGGG - Intergenic
1066293668 10:34035709-34035731 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1066544196 10:36482036-36482058 GAGCGCCACCCCCTGCTCCATGG - Intergenic
1066567348 10:36734657-36734679 GAGCGCCAACCCCTGCTCCAAGG - Intergenic
1066575523 10:36820254-36820276 GAGTGCCACCCCCTGCTCCGTGG + Intergenic
1067294050 10:44964364-44964386 GTTCCCCTCCCCCAGGTCCCAGG - Intronic
1067831807 10:49614830-49614852 CTTCCCCACCCCCTGCTCCCGGG - Intronic
1068374075 10:56155445-56155467 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1068681528 10:59825401-59825423 GTGGGCCTTCCCCAGCTCCAAGG + Intronic
1068978191 10:63033911-63033933 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1069186474 10:65429446-65429468 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1069766195 10:70861965-70861987 GAGCGCCACTCCCTGCTCCACGG + Intronic
1069988730 10:72300925-72300947 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1070536694 10:77384007-77384029 GTGCGTCACCATCAGCTCTCTGG + Intronic
1070564046 10:77590319-77590341 GAGCGCCGCCCCCTGCTCCACGG - Intronic
1070651689 10:78241945-78241967 GTGCCACAGCTCCAGCTCCCAGG + Intergenic
1070942517 10:80359535-80359557 GAGCGCCACCCACTGCTCCGCGG - Intronic
1070968358 10:80543536-80543558 GAGCGCCACCCCCTGCTCCACGG + Intronic
1071003809 10:80859576-80859598 GAGCGCCACCCCCTGCTCCATGG + Intergenic
1071037429 10:81264952-81264974 GAGCACCACCCCCTGCTCCACGG - Intergenic
1071511110 10:86263080-86263102 GTGCTGCAACCCCAGCACCCGGG - Intronic
1071610958 10:87031024-87031046 GGGTGCCACCCCCTGCTCCGTGG - Intergenic
1071900959 10:90119867-90119889 GAGCGCCACCCCCTGCTCCATGG - Intergenic
1071963734 10:90832213-90832235 GAGTGCCACCCCCTGCTCCACGG - Intronic
1072435457 10:95410597-95410619 GTGCCCCACTCCCAGCCCACTGG - Intronic
1072740980 10:97909245-97909267 AGGCCCCACCTCCAGCTCCCAGG + Intronic
1072915498 10:99535337-99535359 GTGCGTCACGCCCAGCGCGCAGG + Exonic
1073352183 10:102827808-102827830 AGGCCCCATCCCCAGCTCCCTGG - Intergenic
1074098185 10:110331788-110331810 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1075180235 10:120204573-120204595 CTGCTCCACCCCCTGCCCCCCGG - Intergenic
1075255673 10:120924147-120924169 GAGCGCCGCCCCCTGCTCCAAGG + Intergenic
1075269329 10:121035377-121035399 GAGCACCACCCCCTGCTCCATGG - Intergenic
1075375972 10:121978427-121978449 GAGCGCCGCCCCCTGCTCCAGGG - Intergenic
1075537472 10:123283391-123283413 GAGCGCCGCCCCCTGCTCCAAGG - Intergenic
1076061436 10:127417078-127417100 CTGCCCCACCCCCAGCTCCCAGG + Intronic
1076250074 10:128978429-128978451 GTGCGCCCCGGCCAGCTCACCGG + Intergenic
1076258371 10:129046331-129046353 GTGCGCAGCGCCCGGCTCCCCGG + Intergenic
1076261607 10:129071390-129071412 GAGTGCCACCCCCTGCTCCAGGG - Intergenic
1076726030 10:132413752-132413774 GTGGGACACACCCAACTCCCTGG + Intronic
1076783925 10:132739638-132739660 GTGCGACTCACCCGGCTCCCAGG - Intronic
1076922221 10:133459952-133459974 GTGCGCGTCCCGCAGGTCCCAGG - Intergenic
1076935313 10:133564993-133565015 GTCGGCCTCCCCCGGCTCCCCGG + Intronic
1077145258 11:1041661-1041683 GGGCGGGACCCCCACCTCCCCGG + Intergenic
1077183822 11:1227789-1227811 CCCCGCCACCCCCAGCTCCTGGG + Intronic
1077281816 11:1749377-1749399 CCGCGCCACCTCCATCTCCCCGG + Intronic
1077609360 11:3635015-3635037 TTGCACCACCCCCTGCTGCCTGG + Intergenic
1077764641 11:5144718-5144740 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
1077778171 11:5294481-5294503 GAGCGCCGCCCCCTGCTCCAGGG - Intronic
1077805815 11:5590201-5590223 GAGTGCCACCCCCTGCTCCAGGG + Intronic
1078251849 11:9623073-9623095 GAGCGCCACCCTCTGCTCCACGG - Intergenic
1078743643 11:14091365-14091387 GAGCACCACCCCCTGCTCCACGG - Intronic
1078891387 11:15561245-15561267 GACCGCCGCCCCCTGCTCCCCGG + Intergenic
1079162937 11:18011798-18011820 CAACTCCACCCCCAGCTCCCGGG + Intronic
1080195149 11:29600186-29600208 GAGCACCACCCCCTGCTCCACGG - Intergenic
1081125110 11:39312154-39312176 GAGCGCCACCCCCTGCCCCATGG + Intergenic
1082698710 11:56401958-56401980 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1083344317 11:61978937-61978959 GTGTGCCAGCCTCAGCTCTCTGG + Intergenic
1083540003 11:63505993-63506015 CAGCCCCACCCCCAGCTCCCTGG - Intergenic
1083572538 11:63768299-63768321 GAGCCCCCCGCCCAGCTCCCGGG - Intronic
1083623976 11:64062601-64062623 CTGCTCCATCCCCAGCGCCCAGG - Intronic
1084024702 11:66440816-66440838 GAGCACCACCCCCTGCTCCACGG - Intronic
1084107461 11:66989115-66989137 GAGCACCACCCCCTGCTCCAAGG + Intergenic
1084210514 11:67619359-67619381 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
1084270531 11:68027018-68027040 GAAAGCCTCCCCCAGCTCCCAGG + Intronic
1084305270 11:68278596-68278618 GTGGTGCACCCCCAGCTCCACGG - Intergenic
1084458276 11:69281621-69281643 GTCACCCACCCCCAGGTCCCTGG + Intergenic
1085018856 11:73192498-73192520 GTGAGTCACCTCCACCTCCCAGG - Intergenic
1085671045 11:78465008-78465030 GAGCGCCGCCCCCTGCTCCACGG - Intronic
1085763047 11:79258784-79258806 GTGCTCCCCCACCGGCTCCCTGG + Intronic
1086012192 11:82119134-82119156 GTGCGCCAGCCAAATCTCCCTGG - Intergenic
1086043082 11:82501480-82501502 GAGCACCACCCCCTGCTCCACGG + Intergenic
1086590525 11:88509329-88509351 CTGCGCCAGCGCCAGCGCCCAGG + Exonic
1089257035 11:117199523-117199545 AGGCGCCAGCTCCAGCTCCCTGG + Intronic
1089373519 11:117978525-117978547 GAGCACCACCCCCTGCTCCAAGG - Intergenic
1089666912 11:120026222-120026244 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1089800293 11:121021982-121022004 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1090133513 11:124170759-124170781 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1090202898 11:124868780-124868802 CTGCGCCACCCCCTGTCCCCAGG + Exonic
1090307632 11:125704740-125704762 GAGCACCACCCCCTGCTCCAGGG - Intergenic
1090311810 11:125747723-125747745 ATGTGCCACCTCCAGTTCCCAGG + Exonic
1090733329 11:129590366-129590388 GTGGGTCACCCCCTCCTCCCTGG - Intergenic
1090820480 11:130337434-130337456 CAGCGCCACCCCCTGCTCCACGG - Intergenic
1091233405 11:134002927-134002949 GAGCGCCGCCCCCCGCTCCACGG - Intergenic
1091448319 12:557525-557547 CGCCTCCACCCCCAGCTCCCAGG - Intronic
1092133973 12:6132803-6132825 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
1092135253 12:6142519-6142541 GAGCACCACCCCCTGCTCCACGG + Intergenic
1092142058 12:6190909-6190931 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1092220336 12:6708605-6708627 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
1092238405 12:6823483-6823505 GAGCCCCACCCCCAAATCCCTGG + Exonic
1092272974 12:7037743-7037765 GAGCGCCGCCCCCTGCTCCACGG + Intronic
1092336730 12:7640161-7640183 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1092350467 12:7752107-7752129 GAGCGCCACCCCCTGCTCCAAGG - Intergenic
1092471819 12:8787589-8787611 GAGGGCCACCCCCTGCTCCACGG + Intergenic
1092473014 12:8795048-8795070 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1092597075 12:10018962-10018984 GTGCTGCAGCCCCAGCTACCAGG - Intergenic
1092617101 12:10225666-10225688 GAGCACCACCCCCTGCTCCACGG - Intergenic
1092732504 12:11547570-11547592 AAGCGCCACCCCCTGCTCCGCGG + Intergenic
1092778160 12:11961990-11962012 GTGCCCCACCTCCTGCTTCCTGG - Intergenic
1093172393 12:15874911-15874933 GAGTGCCACCCCCTGCTCCATGG + Intronic
1093267086 12:17016339-17016361 ATGAGCCCCACCCAGCTCCCAGG + Intergenic
1093793769 12:23286250-23286272 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
1093970260 12:25369688-25369710 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1094327611 12:29256965-29256987 GAGCGCCACCCCCTGCTCCAGGG + Intronic
1094409888 12:30157182-30157204 GAGTGCCACCCCCTGCTCCACGG + Intergenic
1094448775 12:30561955-30561977 GAGCACCACCCCCTGCTCCATGG + Intergenic
1094589250 12:31805827-31805849 GAGCACCACCCCCTGCTCCAAGG - Intergenic
1094661334 12:32472614-32472636 GAGCACCACCCCCTGCTCCACGG + Intronic
1094666535 12:32525994-32526016 GAGCACCACCCCCTGCTCCACGG + Intronic
1095271583 12:40225044-40225066 GGGCGCCGGCCACAGCTCCCCGG - Intronic
1095452824 12:42350170-42350192 GGGCGCCTCCCCCAGCCGCCCGG - Intronic
1096104891 12:48991424-48991446 GTGTGCCACCCACAGAGCCCTGG + Intergenic
1097128887 12:56795877-56795899 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1097253734 12:57656086-57656108 GAGCGCCACCCCCTGCTCGACGG + Intergenic
1098588727 12:72185368-72185390 GAGCACCACCCCCTGCTCCACGG + Intronic
1099192477 12:79574194-79574216 GAGTGCCACCCCCTGCTCCACGG + Intergenic
1099450539 12:82802076-82802098 GAACGCCACCCCCTGCTCCATGG - Intronic
1099559574 12:84155161-84155183 GAGCACCACCCCCTGCTCCACGG - Intergenic
1100600683 12:96109184-96109206 GAGCGCCACCCCCTGCTCCAGGG + Intergenic
1100618402 12:96249358-96249380 GCGCGTCACCACCAGCTCACAGG - Intronic
1101009041 12:100430624-100430646 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1101021675 12:100559704-100559726 GAGCACCACCCCCTGCTCCACGG + Intronic
1101461914 12:104905550-104905572 GAGCGCCACCCCCTGCTCCACGG - Intronic
1102157580 12:110743033-110743055 CTGCGCCCCGCCCAGCGCCCGGG - Intergenic
1102309810 12:111835975-111835997 GAGCACCACCCCCTGCTCCACGG + Intergenic
1103339519 12:120214069-120214091 GTCTCCCACCCCCACCTCCCCGG + Intronic
1103593654 12:122010004-122010026 CTGCACCACCCCCAGCCCACCGG + Intergenic
1103690951 12:122774262-122774284 CTGCGCCGCCCCCAGCACTCTGG - Intergenic
1103783343 12:123414151-123414173 GAGCCCCACCCCCTGCTCCATGG - Exonic
1104127401 12:125861386-125861408 GTGCGCCCGCCGCAGCACCCGGG - Intergenic
1104582686 12:130022377-130022399 GAGTGCCACCCCCTGCTCCACGG + Intergenic
1104602541 12:130162993-130163015 GTGCGCCGCCATCAGCTCCATGG + Exonic
1104614466 12:130256692-130256714 GAGTGCCACCCCCTGCTCCACGG - Intergenic
1104749292 12:131228134-131228156 GAGCACCACCCCCTGCTCCACGG + Intergenic
1104847880 12:131855913-131855935 GGCCGCCCCTCCCAGCTCCCGGG + Intergenic
1104901128 12:132190089-132190111 GTGCCCTCCGCCCAGCTCCCGGG + Intergenic
1104940001 12:132390593-132390615 GTGCCGCAGCCCCAGCTCACAGG + Intergenic
1105037803 12:132939076-132939098 GAGCACCACCCCCTGCTCCACGG + Intronic
1105722220 13:23127893-23127915 GAGCACCACCCCCTGCTCCACGG + Intergenic
1106221277 13:27748352-27748374 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1106617015 13:31339704-31339726 GAGCACCACCCCCTGCTCCACGG - Intergenic
1106776680 13:33016337-33016359 GCGCGCCCACCCCCGCTCCCCGG - Intergenic
1106810998 13:33358303-33358325 GAGCACCACCCCCTGCTCCACGG + Intergenic
1107229012 13:38086152-38086174 TTGAGCCACCCTCAGCCCCCTGG - Intergenic
1107259332 13:38472468-38472490 GAGCGCCATCCCCTGCTCCACGG - Intergenic
1108469408 13:50753345-50753367 GAGCGCCGCCCCCTGCTCCAGGG - Intronic
1108851565 13:54737314-54737336 GAGCGCCACCCCCTGCTCCAGGG - Intergenic
1108858910 13:54829538-54829560 GAGCGCCACCCCCTGCTCCATGG - Intergenic
1109141098 13:58714405-58714427 GAGCGCCAGCCCCTGCTCCACGG + Intergenic
1109152070 13:58858894-58858916 GAGCGCCGCCCCCTGCTCCCTGG - Intergenic
1110711839 13:78658877-78658899 GTGCGCTACCCCCATCTCCCAGG + Intronic
1110874314 13:80490595-80490617 GAGCGCCGCCCCCTGCTCCATGG - Intergenic
1110999792 13:82164985-82165007 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1111006696 13:82258282-82258304 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
1111138746 13:84086452-84086474 GAGCGCCGCCCCCTGCTCCAGGG - Intergenic
1111441953 13:88292142-88292164 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1111556129 13:89883904-89883926 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1111591079 13:90348921-90348943 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
1111602772 13:90495102-90495124 GAGCACCACCCCCTGCTCCACGG + Intergenic
1111748377 13:92296988-92297010 GAGCACCACCCCCTGCTCCATGG + Intronic
1112505069 13:99970540-99970562 CAGCACCACCCCCACCTCCCAGG - Exonic
1112533121 13:100224087-100224109 GTGCGCCGCCCCCTGCTCCACGG - Intronic
1112613148 13:100976018-100976040 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1113371904 13:109732707-109732729 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1113482635 13:110633067-110633089 GAGCACCACCCCCTGCTCCACGG - Intronic
1113538081 13:111083910-111083932 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1113664496 13:112131833-112131855 GTGAACCATTCCCAGCTCCCGGG - Intergenic
1114483264 14:23048096-23048118 TTGCGGCTCCCTCAGCTCCCTGG - Exonic
1114593586 14:23892080-23892102 GAGCACCACCCCCTGCTCCACGG + Intergenic
1116114453 14:40629679-40629701 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1116250988 14:42482431-42482453 GAGCGCCGCCCCCTGCTCCATGG - Intergenic
1116311057 14:43326925-43326947 GAGCACCACCCCCTGCTCCACGG + Intergenic
1116390573 14:44385065-44385087 GAACGCCACCCCCTGCTCCACGG + Intergenic
1116624064 14:47242766-47242788 GAGCACCACCCCCTGCTCCAGGG + Intronic
1116944270 14:50821802-50821824 CCGCCCCACCCCCAGCACCCCGG + Intronic
1117077914 14:52122566-52122588 AAGCGCCACCCCCTGCTCCAGGG + Intergenic
1117302563 14:54443374-54443396 GAGCGCCACCCCCTGCTCCATGG + Intergenic
1117368151 14:55051573-55051595 GTGCGCCTCCCGCAGGCCCCTGG - Intergenic
1117571877 14:57056654-57056676 GAGCACCACCCCCTGCTCCACGG - Intergenic
1119027819 14:71167815-71167837 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1119300273 14:73566371-73566393 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1119382691 14:74239285-74239307 GTGCTCCACCCCCAGCACCCTGG + Intergenic
1119673402 14:76536789-76536811 GAGCGCCGCCCCCTGCTCCATGG - Intergenic
1119707223 14:76790567-76790589 TTCCTCCACCCCCAGGTCCCTGG - Intronic
1119748298 14:77059867-77059889 GTGCTCCATCCCCACCTACCAGG - Intergenic
1120331029 14:83092706-83092728 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1121022938 14:90592790-90592812 GTGCCCCTTCCCCAGTTCCCAGG - Intronic
1121332405 14:93057956-93057978 GAGAGCCCTCCCCAGCTCCCTGG + Intronic
1121350611 14:93170155-93170177 GAGTGCCACCCCCTGCTCCACGG - Intergenic
1122048266 14:99038549-99038571 CTGCCCCATCCCCAGCTCCAAGG + Intergenic
1122407972 14:101511752-101511774 GTCCACCACCCTCAGCTCTCAGG + Intergenic
1122411177 14:101526952-101526974 CTGGGCCACCCCCATCTCTCGGG - Intergenic
1122787291 14:104169540-104169562 CTGCACACCCCCCAGCTCCCCGG + Intronic
1122807522 14:104267538-104267560 GGGCACCACCCCCAGTGCCCGGG - Intergenic
1122861219 14:104583169-104583191 GTGGGCCACGCTCTGCTCCCAGG - Intronic
1122941653 14:104984244-104984266 CTGCCCCCCTCCCAGCTCCCTGG + Intergenic
1124114803 15:26831217-26831239 GAGCGCCGCCCCCTGCTCCACGG - Intronic
1124387812 15:29224831-29224853 GTGCACCGCCCCCTGCTCCACGG - Intronic
1124573178 15:30884079-30884101 GAGCACCACCCCCTGCTCCACGG + Intergenic
1124831492 15:33153774-33153796 GAGCCCCAGCCTCAGCTCCCGGG + Exonic
1125500623 15:40238573-40238595 GTGCCCCCCTGCCAGCTCCCCGG - Intergenic
1125609746 15:40961940-40961962 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1125631635 15:41151961-41151983 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1125937546 15:43649424-43649446 GCGAGGCACCTCCAGCTCCCGGG - Intronic
1126128130 15:45314415-45314437 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1128043673 15:64597779-64597801 CTGCCCCATCCCCAGCTCACAGG + Intronic
1128067981 15:64775970-64775992 GTGCCCCGCACCCAGCGCCCCGG + Intergenic
1128474776 15:67987893-67987915 GCTGGCCACCCCCTGCTCCCTGG - Intergenic
1128709755 15:69862931-69862953 GTGGGCCACCCCCGTCTCCTAGG + Intergenic
1129193483 15:73951262-73951284 GCGCGGCCCTCCCAGCTCCCCGG + Intronic
1129196972 15:73974031-73974053 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
1129208679 15:74052822-74052844 GAGCGCCACCCCCTGCTCCATGG + Intergenic
1129280348 15:74480383-74480405 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1129331858 15:74831950-74831972 GTGCCCCACCCCGAGGTCCAGGG + Intergenic
1129373965 15:75116034-75116056 GAGCGCCACCCCTTGCTCCAAGG - Intronic
1129792064 15:78348118-78348140 GTCCCCCACCCCCACCCCCCAGG + Exonic
1129997188 15:80016800-80016822 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
1130628660 15:85542619-85542641 GGGTGCCATTCCCAGCTCCCTGG + Intronic
1131000917 15:88939278-88939300 CTCCACCACCCCCAGCTTCCAGG + Intergenic
1131117910 15:89805753-89805775 GTCCCTCATCCCCAGCTCCCTGG + Intronic
1131802572 15:96086336-96086358 GGGCGGCAACCTCAGCTCCCAGG + Intergenic
1132464617 16:71981-72003 GTCCCCCACCCCCAGCTCCACGG + Intronic
1132527708 16:425871-425893 GAGCGCCAGCCCCAGCAGCCCGG + Exonic
1132701462 16:1223919-1223941 GGCAGCCACCCCCAGCACCCCGG - Intronic
1132732632 16:1370350-1370372 GTCCGCCCCCGCCAGGTCCCAGG - Intronic
1132836768 16:1958238-1958260 GAGCGCCGCCCCCTGCTCCAGGG - Intergenic
1132852817 16:2032586-2032608 GAGAGCCACCCTTAGCTCCCAGG - Intronic
1133058182 16:3157963-3157985 GTGCGGCACCTGCAGCTCCCGGG + Intergenic
1133362608 16:5186402-5186424 GAGCGCCACTCCCTGCTCCAGGG - Intergenic
1133367485 16:5222048-5222070 GAGCGCCGCCCCCTGCTCCATGG - Intergenic
1134193504 16:12140416-12140438 GCCAGCCACCCCCAGCTCCAGGG - Intronic
1134684071 16:16146586-16146608 GTGGCCCACCCTCTGCTCCCTGG + Intergenic
1135262076 16:20989680-20989702 GAGCACCACCCCCTGCTCCACGG - Intronic
1135280903 16:21152920-21152942 GAGCGCCACCCCCTGCTCCACGG + Intronic
1135751014 16:25058948-25058970 GAGCACCACCCCCTGCTCCACGG - Intergenic
1135942653 16:26836136-26836158 GAGCGCCGCCCCCTGCTCCATGG - Intergenic
1136271610 16:29152075-29152097 GTCCCCCACCCCCAGCTTCATGG + Intergenic
1137492272 16:48943211-48943233 GTGCGGCACCCCCAGAACCCTGG + Intergenic
1137665934 16:50249056-50249078 CTGCACCACTCCCACCTCCCAGG + Intronic
1137725041 16:50651256-50651278 GTACCCCAACCCCAGCTCCATGG - Intergenic
1138688830 16:58749179-58749201 GAGCACCACCCCCTGCTCCAGGG + Intergenic
1139147786 16:64344216-64344238 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
1139908243 16:70381074-70381096 GGGCGCCACTCCCGGCTTCCTGG + Exonic
1140040515 16:71404470-71404492 GTGGTCCAACCCCAGCTCCTGGG + Intergenic
1140473975 16:75229455-75229477 GTGCGGCGGTCCCAGCTCCCTGG - Exonic
1140722471 16:77784422-77784444 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1141699751 16:85636919-85636941 GTGCTACCCCCCCAGCTCCCTGG + Intronic
1141709952 16:85692608-85692630 CTGAGCCACTCCCAGCACCCAGG + Intronic
1142018403 16:87765086-87765108 GTGCGCCAGGCACAGCTCCCTGG - Intronic
1142075225 16:88114059-88114081 GTCCCCCACCCCCAGCTTCATGG + Intronic
1142144873 16:88488714-88488736 ATGCGCCGTCGCCAGCTCCCTGG - Intronic
1142155732 16:88532189-88532211 CTGCCCCAGCGCCAGCTCCCTGG + Exonic
1142205552 16:88781314-88781336 GAGCTCCAGCCCCAGCTGCCAGG - Intronic
1142215851 16:88829484-88829506 CTGGGCCACCCCAAGTTCCCAGG - Intronic
1142295148 16:89216640-89216662 GTGCGCCACCGCCACCTCCTGGG + Intergenic
1142435554 16:90054755-90054777 TTGGGCCAGCCCCAGATCCCTGG + Intergenic
1142809095 17:2386974-2386996 GTGCACCACCCCCAGCTGGTGGG - Exonic
1142978565 17:3658960-3658982 GGAAGCCCCCCCCAGCTCCCGGG - Intronic
1143283410 17:5771539-5771561 GAGCGCCGCCCCCTGCTCCAAGG + Intergenic
1143552775 17:7641159-7641181 GAGCGCCACCCCCTGCTCCATGG + Intergenic
1143747492 17:9004561-9004583 TTGCGGCACCCCCAGCCCACTGG + Intergenic
1143857669 17:9864268-9864290 GTTCTCCAGCCCCATCTCCCAGG + Intronic
1144624891 17:16839560-16839582 GGGCCCCACCCCCAGCCTCCAGG + Intergenic
1144723256 17:17486676-17486698 GAGCACCACCCCCTGCTCCAGGG + Intronic
1144881539 17:18433161-18433183 GGGCCCCACCCCCAGCCTCCAGG - Intergenic
1145094868 17:20016698-20016720 CTGAGCCACCCCCACCTCCTGGG + Intronic
1145150694 17:20511225-20511247 GGGCCCCACCCCCAGCCTCCAGG + Intergenic
1145241501 17:21243161-21243183 GTGCCCCACGTCCAGATCCCTGG - Exonic
1146206922 17:30912793-30912815 GTGCTCCACCCCCAACTCTCAGG + Intronic
1146740414 17:35278952-35278974 GAGCGCCATCCCCTGCTCCAGGG - Intergenic
1147326020 17:39670015-39670037 GTGCACCAGCCCCAGCCCCTGGG + Exonic
1147951929 17:44112298-44112320 GTGCACCAGCCCCAGGACCCAGG - Intronic
1148366128 17:47057320-47057342 GAGCGCCACCCCCTGCTTCACGG - Intergenic
1148641590 17:49192232-49192254 CTGCTCCAACCCCAGCTCCAGGG - Intergenic
1148852711 17:50562429-50562451 GGGCTCCACTCCCAGCTCCGGGG - Intronic
1148890314 17:50802372-50802394 GAGCTCCTCCCCCAGCTCCAGGG + Intergenic
1149865710 17:60149992-60150014 GTGCGCGACCCCCGGCTCAGAGG + Exonic
1149916440 17:60613939-60613961 GAGCACCACCCCCTGCTCCACGG + Intronic
1150275859 17:63897189-63897211 GTGGGGCTCCCCCAGGTCCCTGG + Intergenic
1150311069 17:64129945-64129967 GTCCTCCACCCCACGCTCCCCGG + Intronic
1150786710 17:68169396-68169418 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1151139280 17:71976133-71976155 TTGCTTCACCCCCAGCCCCCAGG - Intergenic
1151748665 17:76024671-76024693 TTGCGCCTGCCCCACCTCCCCGG - Intronic
1152162483 17:78677451-78677473 ATGCCCCACCTCCACCTCCCTGG + Intronic
1152267878 17:79306779-79306801 CTCCTCCACCCCCAGCTCCACGG + Intronic
1152533990 17:80939972-80939994 GAGCGCCTCTCCCAGCTCCGGGG + Intronic
1152618996 17:81352071-81352093 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1152716894 17:81904537-81904559 GTGCGCCCCCACCTGGTCCCCGG - Exonic
1153644007 18:7178704-7178726 GAGCGCCTCCCCCTGCTCCACGG - Intergenic
1153973011 18:10243458-10243480 GTTGGCCACACCCAGCTCCATGG - Intergenic
1154166324 18:12017280-12017302 TCCCGCCACCCCCAGCTGCCTGG + Intronic
1154231108 18:12557184-12557206 GGGCGCCACCCCCTGCTCCGCGG - Intronic
1154231381 18:12559119-12559141 GGGCGCCTCCCCCTGCTCCAAGG - Intronic
1154255261 18:12776884-12776906 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1155207998 18:23577667-23577689 GAGCGCCACCCCCTGCTCCACGG - Intronic
1155772922 18:29723840-29723862 GAGTGCCACCCCCTGCTCCACGG + Intergenic
1156038719 18:32794897-32794919 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1156150358 18:34234166-34234188 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
1156657875 18:39309415-39309437 GGGAGCCACCCCCTGCTCCGTGG + Intergenic
1157979752 18:52366941-52366963 GAGCACCACCCCCTGCTCCACGG - Intronic
1158351970 18:56572613-56572635 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1158553929 18:58459699-58459721 AAGCGCCACCCCCTGCTCCAGGG + Intergenic
1158697212 18:59714130-59714152 GAGCACCACCCCCTGCTCCACGG - Intergenic
1158705705 18:59790489-59790511 GAGCACCACCCCCTGCTCCACGG - Intergenic
1158893606 18:61894354-61894376 GGGCGGCACCCCCACCTGCCCGG + Intergenic
1159656056 18:71031375-71031397 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1160042492 18:75358612-75358634 GTGAGCCACCCCCATCTCCAAGG + Intergenic
1160176571 18:76600168-76600190 GAGCACCACCCCCTGCTCCACGG - Intergenic
1160198605 18:76777567-76777589 GAGCACCACCCCCTGCTCCACGG + Intergenic
1160299756 18:77668985-77669007 CTGCTCCAGCCCCAGCTGCCGGG + Intergenic
1160788395 19:912239-912261 GTCCACCCCCCCCACCTCCCCGG - Intronic
1161072694 19:2270512-2270534 GTGCGCCACCCCCAGCTCCCCGG - Intronic
1161210217 19:3062040-3062062 CGGCGCCCCCCCCAACTCCCCGG - Intronic
1161319388 19:3633949-3633971 GTCCGGCACCCCGACCTCCCAGG - Intronic
1161561878 19:4977866-4977888 GGGCGCCACCCTGGGCTCCCTGG + Intronic
1161851032 19:6738214-6738236 GAGCCCCACCCCCAGATTCCAGG + Intronic
1161975546 19:7606220-7606242 GTGCGCCTCCTGCAGCTCTCAGG + Intronic
1161993285 19:7697418-7697440 GTGCCCCACCCCCGACACCCGGG - Intronic
1162077128 19:8195464-8195486 GTGCACCTCCCACAGCCCCCTGG + Intronic
1162111045 19:8399963-8399985 GTTCGCCACCCGCAGCATCCAGG + Exonic
1162233059 19:9283491-9283513 GAGCGCCACCCTCTGCTCCGCGG - Intergenic
1162263097 19:9548125-9548147 GGGCGCCACCCCCTGCTCCATGG + Intergenic
1162462208 19:10819881-10819903 ATGCGCCACCACCAGCCCCGGGG - Intronic
1162814678 19:13186742-13186764 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1163029603 19:14535677-14535699 GTCCGCGACCTCCACCTCCCAGG - Intronic
1163097308 19:15068957-15068979 GTTCCCCACCCCCACCCCCCCGG - Intergenic
1163181677 19:15608683-15608705 GAGCGCCGCCCCCTGCTCCAGGG - Intergenic
1163218898 19:15900006-15900028 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
1163279495 19:16306918-16306940 GGGCCCCACCCCCAGCCCACTGG - Intergenic
1163419371 19:17205639-17205661 TTGCTGCACCCCCAGCACCCAGG - Intronic
1163518470 19:17778774-17778796 GGGCGCCACCCCCAGAGGCCAGG + Exonic
1164143986 19:22499026-22499048 GAGCGCCACCCCCTGCTCCACGG - Intronic
1164310507 19:24041637-24041659 GAGCACCACCCCCTGCTCCACGG + Intronic
1165036426 19:33036920-33036942 GAGCGCCGCCCCCTGCTCCACGG + Intronic
1165243152 19:34482591-34482613 GAGCGCCCGCTCCAGCTCCCGGG - Exonic
1165421419 19:35723834-35723856 GTGGGCCACCACCTCCTCCCGGG - Exonic
1165826852 19:38710459-38710481 GGAAGCCACCCCCAGCTCCCTGG + Intronic
1165832089 19:38735394-38735416 CTGCTCCAACCCCAGCTCCAGGG + Exonic
1165846635 19:38821819-38821841 GAGCGCCACCCCCTGCTCGGCGG + Intronic
1165941511 19:39416835-39416857 GTGCTGTGCCCCCAGCTCCCTGG + Exonic
1166036168 19:40170178-40170200 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1166042627 19:40213006-40213028 GTGCCCAAGCCCCAGCTCCCAGG + Intronic
1166328532 19:42065713-42065735 CTTCGCCAGCCCCAGCTGCCAGG - Exonic
1166649685 19:44563279-44563301 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1166788931 19:45386064-45386086 CTGCACCACCTCCAGCTCCCCGG + Exonic
1167702662 19:51059825-51059847 GGGCACCACCACCAGCCCCCAGG - Exonic
1168173709 19:54607965-54607987 GTTCTCCAGCCCCAGCTGCCCGG - Intronic
924967419 2:91312-91334 GAGCGCCACCCCCTGTTCCGCGG + Intergenic
925648971 2:6068632-6068654 ATATGCCACCCCCAACTCCCTGG - Intergenic
925734053 2:6944744-6944766 GTTGGCCACGCCCACCTCCCAGG + Intronic
926757484 2:16247871-16247893 GTGTGGCTCCCCCAGCTCCCTGG + Intergenic
927942149 2:27111551-27111573 GAGCGCCACCCCCTGCTCCACGG - Intronic
927980444 2:27371308-27371330 GTGCGCTACAGCCAGCTCCTGGG + Exonic
928086089 2:28347311-28347333 GTGCACTAGCCCCAGCTTCCTGG - Intergenic
928373377 2:30757122-30757144 GTTCCCCACCCCCAGCCCCACGG + Intronic
928688610 2:33775672-33775694 GGGTGCCACCCCCTGCTCCATGG + Intergenic
928753243 2:34494616-34494638 GAGCGCCACCCCCTGCTCCACGG + Intergenic
928936947 2:36688583-36688605 GAGCGCCACCCCCTGCTCCACGG + Intergenic
929070107 2:38020833-38020855 GAGCGCCACCCCCTGCTCCACGG + Intronic
929201904 2:39244598-39244620 GAGTGCCACCCCCTGCTCCACGG + Intergenic
929379735 2:41335913-41335935 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
929890820 2:45917708-45917730 GAGCGCCGCCCCCTGCTCCACGG - Intronic
930468184 2:51780373-51780395 GAGCGCCGCCCCCAGCTCCACGG - Intergenic
931708736 2:64969327-64969349 GAGCGCCGCCCCCCGCTCCACGG + Intergenic
931869044 2:66439905-66439927 GCCCGCCACCCCCGGCTCGCGGG - Exonic
932337890 2:70941418-70941440 GTGCCCTTTCCCCAGCTCCCTGG + Exonic
932359474 2:71092525-71092547 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
932521821 2:72422149-72422171 GAGCACCACCCCCTGCTCCAGGG + Intronic
932570194 2:72934439-72934461 GTACCCCACCCCAGGCTCCCAGG - Exonic
932902094 2:75711897-75711919 GAGCACCACCCCCTGCTCCACGG + Intergenic
933139863 2:78779319-78779341 GGGCGCCACCCCCTGCTCAGGGG + Intergenic
933487206 2:82938480-82938502 GAGCACCACCCCCTGCTCCACGG - Intergenic
933671039 2:85007514-85007536 TTGGCCCACCTCCAGCTCCCAGG + Intronic
933775527 2:85769112-85769134 GTGGGCCACCCCCAGATCTATGG + Intronic
934085165 2:88503418-88503440 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
934898542 2:98139325-98139347 GAGCGCCACCCCCTGCTCCACGG + Intronic
935866482 2:107392608-107392630 GAGCGCCGCCCCCTGCTCCGCGG + Intergenic
935896802 2:107747376-107747398 GAGCGCCGCCCCCTGCTCCGGGG - Intergenic
936346936 2:111682173-111682195 GAGCGCCACCCCCTGCTCCACGG + Intergenic
937209548 2:120259788-120259810 GAGCGCCACCCCCTGCTCCACGG - Intronic
937230430 2:120395337-120395359 GTGCCCCACACCCTACTCCCTGG - Intergenic
937312146 2:120909062-120909084 GTGAGGCTCCCCCAGTTCCCCGG + Intronic
938265103 2:129922951-129922973 GTGCACCACCTCCAGCTGCTGGG + Intergenic
939003174 2:136758743-136758765 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
939085725 2:137716116-137716138 GGGCGCCGCCCCCTGCTCCATGG + Intergenic
939229808 2:139410663-139410685 GAGCGCCACCCCCTGCACCGGGG + Intergenic
939281798 2:140074102-140074124 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
939465179 2:142546383-142546405 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
939777312 2:146403729-146403751 GAGCACCACCCCCTGCTCCACGG - Intergenic
939869099 2:147507233-147507255 GAGCGCCACCCCATGCTCCACGG + Intergenic
939972500 2:148678438-148678460 AAGCGCCACCCCCTGCTCCACGG - Intronic
941240132 2:163026598-163026620 GAGTGCCACCCCCTGCTCCACGG + Intergenic
941309833 2:163913940-163913962 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
941476543 2:165957101-165957123 GGGCGCCGCCCCCTGCTCCACGG - Intergenic
941705824 2:168657476-168657498 GAGCTCCACCCCCTGCTCCACGG - Intronic
941712075 2:168724935-168724957 GAGTGCCACCCCCTGCTCCACGG - Intronic
941878554 2:170459666-170459688 GGGCACCACCCCCTGCTCCATGG - Intronic
943680292 2:190760992-190761014 GAGCGCCACCCCCTGCTCCATGG - Intergenic
943835205 2:192508291-192508313 AAGCGCCACCCCCTGCTCCATGG + Intergenic
943906079 2:193502503-193502525 GAGCGCCGCCCCCTGCTCCAGGG - Intergenic
943954999 2:194176687-194176709 GAGCACCACCCCCTGCTCCACGG + Intergenic
944058446 2:195547392-195547414 AAGCGCCACCCCCTGCTCCAGGG - Intergenic
944482838 2:200175061-200175083 AAGCGCCACCCCCTGCTCCAGGG + Intergenic
944857885 2:203785612-203785634 GAGCGCCACCCCCTGCTCCACGG - Intergenic
945575428 2:211524415-211524437 GAGCACCACCCCCTGCTCCACGG - Intronic
946420588 2:219562377-219562399 GTGGGCCCAGCCCAGCTCCCCGG - Intronic
946923517 2:224603739-224603761 GAGCGCCACCCCCTGCTCCAGGG - Intergenic
947026680 2:225744456-225744478 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
947412038 2:229851039-229851061 GAGCGCCGCCCCCTGCTCCAGGG + Intronic
947593099 2:231396045-231396067 GGGCGCCGCGCTCAGCTCCCCGG + Intronic
947619010 2:231576673-231576695 GTGCCCCAGCCCCAGCATCCGGG - Intergenic
947720472 2:232366663-232366685 GAGCGCCACCCCCTGCTCCATGG + Intergenic
947932010 2:233972506-233972528 GAGCGCCACCCCCTGCTCCATGG - Intronic
948567922 2:238898134-238898156 TGGCCCCACCCCCAGCACCCGGG - Intronic
948712127 2:239831661-239831683 GTGCACCACCCCCAGCCCAGAGG - Intergenic
948876853 2:240834004-240834026 CTGCTCCACACCCAGGTCCCCGG - Intergenic
1169849237 20:10032001-10032023 GAGCACCACCCCCTGCTCCACGG + Intronic
1169978162 20:11353656-11353678 GGGCTCCAGCTCCAGCTCCCAGG - Intergenic
1170246517 20:14226829-14226851 GAGCGCCGCCCCCTGCTCCACGG + Intronic
1170533264 20:17315497-17315519 GTGCACAGCGCCCAGCTCCCGGG + Intronic
1170806801 20:19639668-19639690 GAGCGCCGCCCCCTGCTCCTCGG - Intronic
1170989934 20:21292194-21292216 GAGTGCCACCCCCTGCTCCAGGG + Intergenic
1172178518 20:32986828-32986850 GTGCACCACCCCCCACTCCCGGG + Intronic
1172372802 20:34408199-34408221 GTGTGCCAGTCCCAGCTACCTGG - Intronic
1172474560 20:35226977-35226999 GCGCGCCAGCCCCACCTGCCCGG - Exonic
1172640180 20:36436094-36436116 GTGCCCCATCCCCAGGTGCCCGG + Exonic
1173195482 20:40910507-40910529 GAGCACCACCCCCTGCTCCACGG - Intergenic
1173849993 20:46211594-46211616 CTCCCCCACCCCCAGCTCTCAGG - Intronic
1174414372 20:50357326-50357348 GAGCCCCACACCAAGCTCCCGGG - Intergenic
1175047655 20:56122455-56122477 GACCCCCACCCCCAGCGCCCTGG + Intergenic
1175254197 20:57629111-57629133 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
1176872205 21:14093007-14093029 GAGTGCCACCCCCTGCTCCATGG - Intergenic
1176952865 21:15065730-15065752 GAGCGCCCCGCTCAGCTCCCTGG + Intergenic
1177795939 21:25778639-25778661 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1178377059 21:32075535-32075557 GTGAGCCACCCCCCGCCCCCCGG + Intergenic
1178398790 21:32265654-32265676 GAGCACCACCCCCTGCTCCATGG + Intergenic
1178404005 21:32310124-32310146 CTCCACCACGCCCAGCTCCCTGG + Intronic
1178488087 21:33031341-33031363 CTGCGCCCCGGCCAGCTCCCAGG - Intergenic
1178489083 21:33036483-33036505 GAGCCCCATGCCCAGCTCCCAGG - Intergenic
1178563267 21:33659055-33659077 CTCCGCCACCACCAGCTCCAGGG + Intronic
1178585598 21:33868355-33868377 GAGCGCCGCCCCCTGCTCCACGG - Intronic
1178695695 21:34791855-34791877 GTCCGCCGGCCCCAGCACCCAGG - Exonic
1179190000 21:39115563-39115585 GTGACCCACAACCAGCTCCCAGG + Intergenic
1179374721 21:40840362-40840384 CTCCGCCACCCCCAGCTCTTGGG - Intronic
1179505450 21:41836787-41836809 GGGCGTCACTCCCAGCTTCCAGG + Intronic
1179617944 21:42593800-42593822 ATCCGCCACCCCCTCCTCCCAGG + Intergenic
1179646549 21:42779483-42779505 GGGCACCGGCCCCAGCTCCCAGG - Intergenic
1179991016 21:44948275-44948297 ATGCTCCACGACCAGCTCCCCGG - Intronic
1179991025 21:44948306-44948328 ATGCTCCACGACCAGCTCCCCGG - Intronic
1179991033 21:44948336-44948358 ATGCTCCACGACCAGCTCCCCGG - Intronic
1179991049 21:44948397-44948419 GTGCTCCACGACCAGCTCCCCGG - Intronic
1180093718 21:45544796-45544818 GTGCCCCATCCCCAGCTCCTGGG + Intergenic
1180986885 22:19910183-19910205 GTGGGCCATCCCGAGGTCCCAGG - Intronic
1180993541 22:19953160-19953182 CAGCCCCACCCCCAGCGCCCAGG - Intronic
1181044428 22:20207832-20207854 AGGCCCCACCCCCAGCTCCTGGG - Intergenic
1182369251 22:29799339-29799361 TTGCAACACCCCCAGATCCCAGG - Intronic
1182422383 22:30254752-30254774 CTGTGCCACCCCCACCTGCCGGG + Intergenic
1183471503 22:38009402-38009424 CCAGGCCACCCCCAGCTCCCTGG - Intronic
1183685285 22:39357922-39357944 GAGCACCACCCCCTGCTCCACGG + Intronic
1183990401 22:41593841-41593863 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
1184274013 22:43400040-43400062 GTCGCCCAGCCCCAGCTCCCAGG - Intergenic
1184755900 22:46515568-46515590 GTCCTCCACCTCCAGCCCCCGGG - Intronic
1184906201 22:47488344-47488366 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1185229071 22:49670239-49670261 GAGCGCCGCCCCCTGCTCCGCGG - Intergenic
949259025 3:2083950-2083972 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
949384900 3:3489911-3489933 GTGGGCCAACCTCAGGTCCCTGG - Intergenic
950203644 3:11061695-11061717 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
950207928 3:11094322-11094344 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
951332908 3:21387289-21387311 AAGCGCCACCCCCTGCTCCACGG - Intergenic
951415490 3:22417273-22417295 GAGCACCACCCCCTGCTCCATGG + Intergenic
951951039 3:28200451-28200473 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
952076344 3:29701859-29701881 GAGCCCCACCCCCTGCTCCACGG + Intronic
952713358 3:36453625-36453647 GAGCGCCGCCCCCTGCTCCACGG + Intronic
952730693 3:36634230-36634252 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
952795296 3:37233341-37233363 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
953089878 3:39713638-39713660 GAGCGCCACCCCCTGCTCCACGG + Intergenic
953124464 3:40077965-40077987 GAGCGCCACCCCCTGCTCCACGG - Intronic
954609939 3:51939043-51939065 ATGACCTACCCCCAGCTCCCAGG - Intronic
954620182 3:51990895-51990917 GAGCGCCGCCCCCCGCTCCACGG + Intergenic
954812710 3:53257773-53257795 GTGTGCCACCCTCAGATGCCTGG + Intergenic
955183401 3:56692203-56692225 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
955186473 3:56719255-56719277 GAGCACCACCCCCTGCTCCACGG + Intergenic
955266412 3:57449383-57449405 GAGCACCACCCCCTGCTCCATGG - Intronic
955449528 3:59051180-59051202 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
956459273 3:69454751-69454773 GGGCACCACCCCCTGCTCCGTGG + Intronic
957002224 3:74900014-74900036 GAGCGCCGCCCCCTGCTCCAGGG - Intergenic
957009135 3:74985163-74985185 GAGCGCCGCCCCCTGCTCCATGG - Intergenic
957074125 3:75588077-75588099 GAGCACCACCCCCTGCTCCATGG + Intergenic
957277515 3:78108711-78108733 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
957419617 3:79951408-79951430 GAGCACCACCCCCTGCTCCACGG - Intergenic
957560120 3:81812046-81812068 GAGCGCCACCCCCTGCTCCACGG - Intergenic
957630986 3:82715649-82715671 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
957804857 3:85133898-85133920 GAGCGCCGCCCCCTGCTCCACGG - Intronic
957829964 3:85504713-85504735 GAGCGCCGCCCCCTGCTCCACGG - Intronic
957995155 3:87679421-87679443 GAGCACCACCCCCTGCTCCACGG + Intergenic
958022684 3:88016011-88016033 GAGCGCCGCCCCCTGCTCCCGGG + Intergenic
958419917 3:93917907-93917929 GAGCCCCACCCCCTGCTCCAGGG + Intronic
960149752 3:114238327-114238349 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
960227487 3:115184925-115184947 GAGCGCCGCCCCCTGCTCCAGGG - Intergenic
960282187 3:115791885-115791907 GAGCGCCGCCCCCTGCTCCAAGG + Intergenic
960559989 3:119073445-119073467 GGGCGCCACCACCTGCTCCATGG - Intronic
960761621 3:121078569-121078591 GAGCACCACCCCCTGCTCCATGG - Intronic
960868546 3:122227250-122227272 GAGCACCACCCCCTGCTCCATGG - Intronic
961268851 3:125672067-125672089 GGGCGCCACCCCCTGCTCTGCGG + Intergenic
961460511 3:127047000-127047022 GAGCACCACCCCCTGCTCCACGG + Intergenic
961551401 3:127672400-127672422 ATGAGCGCCCCCCAGCTCCCCGG - Exonic
961688854 3:128653721-128653743 GAGCGCCGCCCCCTGCTCCAAGG + Intronic
962283702 3:134070298-134070320 GAGCACCACCCCCTGCTCCACGG - Intronic
962600452 3:136987625-136987647 GAGCGCCACCCCCTGCTCCACGG - Intronic
963589943 3:147245646-147245668 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
963862221 3:150323291-150323313 GAGCGCCACCCCCTGCTCCAAGG + Intergenic
963880266 3:150520601-150520623 CCGCGCCACCCCCAGCTCCAGGG + Intergenic
963967600 3:151390081-151390103 GTGGGCCAGCCCCAGCAGCCCGG + Exonic
964032371 3:152152741-152152763 GAGCGCCACCCCCTGCTCCACGG + Intergenic
964117925 3:153155786-153155808 GAGCGCCGCCCCCTGCTCCAGGG - Intergenic
964139172 3:153378373-153378395 GAGCACCACCCCCTGCTCCACGG - Intergenic
964444051 3:156740900-156740922 GAGTGCCACCCCCTGCTCCATGG + Intergenic
965078042 3:164003291-164003313 GAGCACCACCCCCTGCTCCAGGG + Intergenic
965200298 3:165649354-165649376 GAGCGCCACCCCCTGCTCCATGG - Intergenic
965220166 3:165918483-165918505 GAGCGCCGCCCCCTGCTCCCTGG - Intergenic
965288091 3:166843135-166843157 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
966096738 3:176213453-176213475 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
966725053 3:183101220-183101242 GAGCGCCACCCCCTGCTCCACGG + Intronic
966877414 3:184331020-184331042 GTGAGCCACCGCCCGCTCCTGGG + Intronic
967234056 3:187367613-187367635 GAGTGCCACCCCCTGCTCCATGG - Intergenic
967448551 3:189596447-189596469 AAGCGCCACCCCCTGCTCCACGG + Intergenic
967499105 3:190177086-190177108 AAGCGCCACCCCCTGCTCCACGG - Intergenic
967594869 3:191317050-191317072 GGGCACCACCCCCTGCTCCAAGG - Intronic
967882300 3:194310353-194310375 GTGCTCCATGCCCAGCTTCCGGG - Intergenic
968577169 4:1372926-1372948 TTGCTCCACCCCCTGCCCCCTGG + Intronic
968716209 4:2161590-2161612 GAGCGCCGCCCCCTGCTCCATGG + Intronic
968727693 4:2255898-2255920 CTGGGCCACCCCCAGCTCCCCGG - Intronic
968830810 4:2932256-2932278 GTGTGCCAGCCCCAGATGCCAGG - Intronic
969309381 4:6344258-6344280 ATTCTTCACCCCCAGCTCCCAGG - Intronic
969362403 4:6673047-6673069 GAGCACCACCCCCTGCTCCACGG + Intergenic
969440789 4:7215452-7215474 GAGCGCGACCCCCTGCTCCACGG + Intronic
969654928 4:8491447-8491469 GAGCACCACCCCCTGCTCCACGG - Intronic
969795445 4:9524498-9524520 GAGCACCACCCCCTGCTCCATGG - Intergenic
970649278 4:18159307-18159329 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
971230942 4:24799930-24799952 GTGCCGCACCCGCAGCACCCGGG + Exonic
971280487 4:25239279-25239301 AAGCGCCACCCCCTGCTCCATGG - Intronic
971552990 4:27978372-27978394 GAGCACCACCCCCTGCTCCACGG - Intergenic
971564146 4:28117180-28117202 GGGCGCCGCCCCCAGCTCCAGGG - Intergenic
971812001 4:31438975-31438997 GAGCACCACCCCCTGCTCCACGG + Intergenic
971852155 4:31996741-31996763 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
972022741 4:34335678-34335700 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
972900176 4:43672681-43672703 GAGCACCACCCCCTGCTCCAAGG + Intergenic
973048622 4:45567376-45567398 GAGCCCCACCCCCTGCTCCATGG + Intergenic
973146369 4:46831371-46831393 GAGTGCCACCCCCGGCTCCACGG + Intronic
973196218 4:47445044-47445066 CTCCTCCACCCCCAGTTCCCAGG - Intergenic
973339017 4:48985850-48985872 GTGCACCAGCTCCAGCGCCCTGG - Intergenic
973550601 4:52031954-52031976 ATTCTCCACCTCCAGCTCCCTGG - Intronic
973587714 4:52409783-52409805 GAGCACCACCCCCTGCTCCAGGG - Intergenic
974147468 4:57965748-57965770 GAGCACCACCCCCTGCTCCACGG + Intergenic
974484737 4:62491934-62491956 GAGCGCCACCCCCTGCTCCACGG - Intergenic
975439902 4:74399101-74399123 GAGCGCCGCCCCCTGCTCCATGG - Intergenic
975595140 4:76043332-76043354 GAGTGCCACCCCCTGCTCCACGG - Intronic
975823085 4:78291278-78291300 CGAAGCCACCCCCAGCTCCCCGG - Intronic
976520581 4:86021644-86021666 GAGCACCACCCCCTGCTCCATGG - Intronic
977606873 4:98993518-98993540 GAGGGCCACCCCCTGCTCCAGGG - Intergenic
977674405 4:99732007-99732029 GAGTGCAACCCCCACCTCCCAGG - Intergenic
977717302 4:100196557-100196579 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
977750916 4:100608802-100608824 GAGCACCACCCCCTGCTCCATGG - Intronic
978080299 4:104582304-104582326 GAGCGCCACCCCCTGCTCCACGG + Intergenic
978241839 4:106525382-106525404 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
978285632 4:107073518-107073540 GAGCGCTACCCCCTGCTCCATGG + Intronic
978997996 4:115179468-115179490 AAGCGCCACCCCCTGCTCCGTGG - Intergenic
979290768 4:118977087-118977109 GAGCACCACCCCCTGCTCCACGG - Intronic
979688640 4:123538240-123538262 GAGTGCCACCCCCTGCTCCACGG + Intergenic
980051881 4:128047596-128047618 GAGCGCCGCCCCCTGCTCCCCGG - Intergenic
980470180 4:133240444-133240466 GAGCACCACCCCCTGCTCCACGG - Intergenic
980815606 4:137942394-137942416 GAGCGCCACCCCCTGCTCCACGG + Intergenic
980824065 4:138052982-138053004 GAGCGCCGCCCCCTGCTCCAGGG - Intergenic
981146674 4:141333055-141333077 GAGCGCCATCCCCTGCTCCACGG - Intergenic
981275863 4:142897820-142897842 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
981280645 4:142954584-142954606 GGGCGCCACCCCCTGCTCCGCGG + Intergenic
982027410 4:151264356-151264378 TTGGCTCACCCCCAGCTCCCAGG - Intronic
982408276 4:155044626-155044648 GAGCACCACCCCCTGCTCCAAGG + Intergenic
982728236 4:158928025-158928047 GAGCGCCGCCCCCTGCTCCACGG + Intronic
982814533 4:159869069-159869091 GAGCGCCACCCCCTGCTCCACGG - Intergenic
982921316 4:161277551-161277573 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
983026145 4:162739864-162739886 GAGTGCCACCCCCTGCTCCACGG + Intergenic
983064039 4:163189752-163189774 GAGCGCCACCCCCTGCTCCAGGG - Intergenic
983425754 4:167581879-167581901 GGGCGCCACCCCCTGCTCCGTGG + Intergenic
983553007 4:169035872-169035894 GAGCACCACCCCCTGCTCCATGG - Intergenic
983734761 4:171043481-171043503 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
983752891 4:171298601-171298623 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
983834190 4:172369510-172369532 GGGTGCCACCCCCTGCTCCGCGG - Intronic
984134680 4:175920771-175920793 GTGAGCCACCACCGCCTCCCGGG - Intronic
984192787 4:176625202-176625224 GAGCGCCGCCCCCTGCTCCAAGG - Intergenic
984265709 4:177495915-177495937 GAGCGCCACCCCCTGCTCCACGG + Intergenic
984776063 4:183482729-183482751 GAGCTCCACCCCCTGCTCCAGGG - Intergenic
984948668 4:184990124-184990146 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
985087148 4:186324907-186324929 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
985195065 4:187420659-187420681 GAGCACCACCCCCTGCTCCATGG - Intergenic
985203298 4:187505954-187505976 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
985324751 4:188754816-188754838 GTGTGCCACCCCCTCCTCCATGG + Intergenic
985403822 4:189616683-189616705 GAGCGCCACCCCCTGCTCCATGG - Intergenic
985750600 5:1672021-1672043 CTGTGCCACCCCCAGCTTCACGG + Intergenic
986912335 5:12573981-12574003 GAGCGCCACCCCCTGCTCCACGG - Intergenic
986919074 5:12662227-12662249 GGGCGCCGCCCCCTGCTCCGTGG + Intergenic
987146201 5:14993843-14993865 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
987283779 5:16436504-16436526 GAGCACCACCCCCTGCTCCACGG + Intergenic
987355888 5:17062513-17062535 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
987383961 5:17311810-17311832 GAGCGCCACCCCCTGCTCCACGG - Intergenic
987476634 5:18399697-18399719 GAGCGCCGCCCCCTGCTCCAAGG - Intergenic
987876998 5:23691448-23691470 GAGCACCACCCCCTGCTCCACGG + Intergenic
987896339 5:23951620-23951642 GAGCGCCGCCCCCTGCTCCAGGG + Exonic
988086939 5:26485317-26485339 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
988132207 5:27120223-27120245 GAGCACCACCCCCTGCTCCACGG + Intronic
988155003 5:27439487-27439509 GAGCACCACCCCCTGCTCCATGG - Intergenic
988500193 5:31777439-31777461 GGGCGCCGCCCCCTGCTCCGTGG + Intronic
988915849 5:35892904-35892926 GAGCACCACCCCCTGCTCCACGG - Intergenic
989346844 5:40438983-40439005 GAGCACCACCCCCTGCTCCACGG + Intergenic
989750185 5:44883966-44883988 GAGCGCCACCCCTTGCTCCGCGG - Intergenic
989957975 5:50377154-50377176 GATCGCCACCCCCTGCTCCATGG + Intergenic
990461571 5:56035813-56035835 GTGCACCACCCCCTACTCCACGG + Intergenic
990512097 5:56498696-56498718 GAGCACCACCCCCTGCTCCATGG - Intergenic
991567512 5:68020439-68020461 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
992296785 5:75334009-75334031 GAGCACCACCCCCTGCTCCACGG + Intergenic
992494996 5:77283235-77283257 CTGCACCACCCCCCACTCCCTGG + Intronic
993822086 5:92631655-92631677 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
994096389 5:95851490-95851512 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
994210728 5:97085265-97085287 AGGCGCCACCCCCTGCTCCAAGG - Intergenic
994254747 5:97580031-97580053 TAGCGCCACCCCCTGCTCCACGG - Intergenic
994359609 5:98835230-98835252 GTGAGCTACTCCCAGCTCCAGGG + Intergenic
994507165 5:100657086-100657108 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
994701652 5:103142071-103142093 GAGCACCACCCCCTGCTCCACGG - Intronic
995140371 5:108728420-108728442 GTGCTCCTGCCCCACCTCCCAGG - Intergenic
995388285 5:111612188-111612210 TAGCGCCACCCCCTGCTCCATGG - Intergenic
995596407 5:113753155-113753177 GAGCACCACCCCCTGCTCCAAGG - Intergenic
995656555 5:114433004-114433026 GAGCGCCACCCCCTGCTCCACGG + Intronic
996107092 5:119517428-119517450 GAGTGCCACCCCCTGCTCCACGG + Intronic
996435741 5:123430873-123430895 GAGCGCCACCCCCTGCTCCACGG + Intergenic
996478653 5:123949226-123949248 GAGTGCCACCCCCTGCTCCGTGG - Intergenic
996948109 5:129094507-129094529 GTCCGCCCCCTCCAGCTTCCCGG - Intergenic
997313247 5:132908844-132908866 CTCTGCCACCTCCAGCTCCCAGG + Intronic
997685647 5:135786036-135786058 GTGTTCCACCCCCAGCCCCACGG - Intergenic
998117587 5:139549667-139549689 GGGCGCCACCCCCTGCTCCGCGG + Intronic
998334060 5:141355346-141355368 GGGCGCCAACCCCAGGTCCTTGG - Exonic
998342511 5:141430905-141430927 GGGCTCCAGCCCCAGGTCCCTGG - Exonic
1000066084 5:157694162-157694184 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1000891767 5:166810232-166810254 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1001425407 5:171619235-171619257 GTCCTCCACCCCCAGCCCCAGGG + Intergenic
1001636493 5:173213755-173213777 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1001808781 5:174610987-174611009 CTGAGCCACCCCCATCTTCCAGG + Intergenic
1002616502 5:180459498-180459520 GAGCGCCACCCCGTGCTCCATGG + Intergenic
1002636682 5:180612201-180612223 GTGAGGCAGCCCCATCTCCCTGG - Intronic
1002906979 6:1457007-1457029 GAGCGCCACCCCCTGCTCTACGG - Intergenic
1003137535 6:3445015-3445037 GTGCCCCACCCCCACGTACCTGG - Intronic
1003170800 6:3720801-3720823 GAGCACCACCCCCTGCTCCACGG - Intergenic
1003284806 6:4725367-4725389 GAGCGCCGCCCCCTGCTCCACGG - Intronic
1003508788 6:6762517-6762539 GAGTGCCACCCCCTGCTCCACGG - Intergenic
1003717616 6:8665816-8665838 GAGCACCACCCCCTGCTCCACGG - Intergenic
1003717751 6:8666292-8666314 GAGCACCACCCCCTGCTCCACGG + Intergenic
1003736945 6:8887489-8887511 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1003748062 6:9024590-9024612 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
1003836168 6:10074746-10074768 GAGCGCCACCCCCTGCTCCACGG - Intronic
1003845777 6:10172048-10172070 GAGCGCCACCCCCTGCTCCACGG + Intronic
1003862843 6:10337735-10337757 GAGCACCACCCCCTGCTCCACGG + Intergenic
1004053102 6:12108426-12108448 GAGCGCCGCCCCCTGCTCCATGG - Intronic
1004196537 6:13511072-13511094 GAGCGCCGCCCCCTGCTCCGTGG - Intergenic
1004200313 6:13541864-13541886 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1004338176 6:14783640-14783662 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1004497728 6:16180757-16180779 GAGCGCCGCCCCCTGCTCTCCGG - Intergenic
1004511696 6:16288579-16288601 GAGCGCCGCCCCCTGCTCCAAGG + Intronic
1004665484 6:17745344-17745366 GAGTGCCACCCCCTGCTCCACGG - Intergenic
1004912673 6:20301576-20301598 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1005596161 6:27381104-27381126 GAGCGCCGCCCCCTGCTCCACGG - Intronic
1005600818 6:27424864-27424886 GAGCGCCACCCCCTGTTCCACGG - Intergenic
1005749032 6:28866520-28866542 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1005749873 6:28872628-28872650 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1005751258 6:28885171-28885193 GGGCGCCGCCCCCTGCTCCGCGG - Intergenic
1005758846 6:28949830-28949852 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1005978185 6:30816334-30816356 GAGCGCCGCCCCCTGCTCCAGGG - Intergenic
1006005824 6:31000789-31000811 GAGTGCCACCCCCTGCTCCAGGG + Intergenic
1006008357 6:31021044-31021066 GAGCGCCGCCCCCTGCTCCAGGG + Intronic
1006033684 6:31195785-31195807 GAGCACCACCCCCTGCTCCACGG + Intergenic
1006127998 6:31852339-31852361 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1006227018 6:32547960-32547982 GAGCACCACCCCCTGCTCCAGGG - Intergenic
1006352693 6:33532714-33532736 GAGCACCACCCCCTGCTCCAGGG + Intergenic
1006477881 6:34269350-34269372 GAGCACCACCCCCTGCTCCACGG + Intergenic
1006602680 6:35236398-35236420 GTGCCCCTCCCCCTGCTCCTGGG + Intronic
1006978316 6:38124365-38124387 GAGCGCCGCCCCCTGCTCCATGG - Intronic
1007077779 6:39078834-39078856 GTGCCACACACACAGCTCCCAGG - Intronic
1007738773 6:43998380-43998402 GAGCGCCACCCCCTGCTCCATGG + Intergenic
1007764731 6:44153859-44153881 GCTCGCCACCCCCCGTTCCCTGG - Intronic
1008005542 6:46405803-46405825 GAGCACCACCCCCTGCTCCACGG - Intronic
1008284291 6:49629586-49629608 GAACGCCACCCCCTGCTCCACGG - Intronic
1008771046 6:54979560-54979582 GAGCACCACCCCCTGCTCCACGG + Intergenic
1010199265 6:73268910-73268932 GAGCACCACCCCCTGCTCCATGG - Intronic
1011129281 6:84037515-84037537 GGGCGCCGCCCCCTGCTCCATGG - Intronic
1011143741 6:84189692-84189714 GAGCACCACCCCCTGCTCCACGG + Intronic
1011178160 6:84587710-84587732 GAGCACCACCCCCTGCTCCACGG + Intergenic
1012046472 6:94281669-94281691 CTGCCCCACCCCCAGGTCCATGG - Intergenic
1012145068 6:95670366-95670388 TAGCGCCACCCCCTGCTCCACGG + Intergenic
1012578183 6:100829268-100829290 GAGCGCCGCCCCCTGCTCCACGG - Intronic
1012760453 6:103294440-103294462 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1013081433 6:106816798-106816820 GAGCACCACCCCCTGCTCCACGG - Intergenic
1013182876 6:107732741-107732763 CTTCGCCTCCCCCAGCTCTCGGG - Intronic
1013242761 6:108261142-108261164 GAACGCCACGCCCGGCTCCCGGG + Exonic
1013410734 6:109881180-109881202 GAGTGCCACCCCCTGCTCCACGG - Intergenic
1013955296 6:115834636-115834658 GAGTGCCACCCCCTGCTCCACGG - Intergenic
1013963404 6:115928118-115928140 GAGCGCCGCCCCCTGCTCCAGGG - Intergenic
1014055937 6:117015077-117015099 GTGCGCCGCTCCCTGCTCCACGG + Intergenic
1014921023 6:127214626-127214648 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1015600397 6:134905054-134905076 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1015926899 6:138319835-138319857 GTGCTCCACCACCAGCTCACAGG - Exonic
1016092778 6:139999620-139999642 GAGTGCCACCCCCTGCTCCAGGG - Intergenic
1016482268 6:144495186-144495208 GAGTGCCACCCCCTGCTCCACGG - Intronic
1017299031 6:152834668-152834690 GAGCACCACCCCCTGCTCCAGGG + Intergenic
1017325140 6:153133946-153133968 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1017537423 6:155363395-155363417 GAGTGCCACCCCCTGCTCCACGG + Intergenic
1017581165 6:155866791-155866813 GAGTGCCACCCCCTGCTCCAGGG - Intergenic
1018064185 6:160114538-160114560 GAGCACCACCCCCTGCTCCACGG - Intergenic
1018696146 6:166393388-166393410 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1019000213 6:168743820-168743842 GAGCACCACCCCCTGCTCCACGG - Intergenic
1019506844 7:1395704-1395726 GTGGGACACCCCCAAATCCCTGG + Intergenic
1019701410 7:2476453-2476475 GCTCCCCACCCCCAGCCCCCCGG - Intronic
1020071636 7:5230848-5230870 AGGCGCCACCCACAGCACCCAGG - Exonic
1021324175 7:19245808-19245830 GAGCACCACCCCCTGCTCCATGG + Intergenic
1021945233 7:25719841-25719863 GTGAGCCACCGCCACCTGCCCGG - Intergenic
1022174100 7:27857092-27857114 GAGCGCCGCCCCCTGCTCCACGG - Intronic
1022790691 7:33686152-33686174 GTGCGCCACACACAGCAGCCAGG - Intergenic
1024037775 7:45523459-45523481 GTGAGCAAAACCCAGCTCCCTGG - Intergenic
1024269126 7:47628800-47628822 GAGCGCCACCCCCTGCTCCATGG + Intergenic
1024335587 7:48202950-48202972 GAGCGCCGCCCCCTGCTCCACGG - Intronic
1024700586 7:51900921-51900943 GAGCGCCACCCCCTGCTCCATGG - Intergenic
1024707146 7:51972880-51972902 TTTCGCCTCCCCCAGCTTCCAGG + Intergenic
1024748156 7:52431278-52431300 GGGCGCCACCCCCTGCTCCACGG - Intergenic
1024825379 7:53385197-53385219 GAGCACCACCCCCTGCTCCAAGG - Intergenic
1025263788 7:57439634-57439656 GTGCCCCACCCCCACCCCACAGG - Intergenic
1025635446 7:63316476-63316498 GTGCTCCACCCCCACCCCACAGG + Intergenic
1025647249 7:63431694-63431716 GTGCTCCACCCCCACCCCACAGG - Intergenic
1026187043 7:68090450-68090472 GAGCACCACCCCCTGCTCCACGG - Intergenic
1026335941 7:69394150-69394172 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1026512391 7:71037918-71037940 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1026596511 7:71738116-71738138 GAGCGCCGCCCCCTGCTCCAGGG - Intergenic
1027265997 7:76495588-76495610 TTGGGCCACCACCAGCCCCCAGG - Intronic
1027317371 7:76993705-76993727 TTGGGCCACCACCAGCCCCCAGG - Intergenic
1027563993 7:79768001-79768023 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1027665942 7:81043032-81043054 GAGCACCACCCCCTGCTCCACGG + Intergenic
1027868147 7:83673635-83673657 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1027956085 7:84880851-84880873 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1028070148 7:86440891-86440913 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1028511170 7:91627430-91627452 GACCGCCACCCCCTGCTCCACGG - Intergenic
1028778371 7:94705817-94705839 GAGCACCACCCCCTGCTCCACGG + Intergenic
1029407148 7:100382056-100382078 GAGCGCCGCCCCCTGCTCCACGG + Intronic
1029567557 7:101348899-101348921 GAGCACCACCCCCTGCTCCAGGG + Intergenic
1029694831 7:102205705-102205727 CTCCGCCACCACCTGCTCCCAGG - Intronic
1029832327 7:103274961-103274983 GAGCACCACCCCCTGCTCCACGG - Intergenic
1030059642 7:105612546-105612568 GGGTGCCACCGCCAGGTCCCAGG - Intronic
1030079242 7:105763061-105763083 CTGAGCCACTCCCAGATCCCTGG + Intronic
1030102088 7:105955846-105955868 CAGCGCCACCCCCTGCTCCACGG - Intronic
1030733532 7:113017667-113017689 GAGCGCCACCCCCTGCTCCATGG + Intergenic
1030772173 7:113488171-113488193 GGGTGCCACCCCCTGCTCCAAGG - Intergenic
1030780463 7:113593642-113593664 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1030980645 7:116182019-116182041 GAGCGCCGCCCCCTGCTCCAGGG - Intergenic
1031292212 7:119951547-119951569 GAGCACCACCCCCTGCTCCAAGG - Intergenic
1031605489 7:123763252-123763274 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1032248119 7:130230346-130230368 GAGCACCACCCCCTGCTCCACGG + Intergenic
1033065123 7:138146445-138146467 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1033394045 7:140956991-140957013 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1033866602 7:145697449-145697471 GAGCGCCGCCCCCTGCTCCAAGG - Intergenic
1034155066 7:148949405-148949427 GAGCACCACCCCCTGCTCCACGG + Intergenic
1034167709 7:149038735-149038757 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1034422555 7:150997076-150997098 CTGCCCCACCCTCAGCACCCAGG + Intronic
1034655990 7:152730312-152730334 GAGCACCACCCCCTGCTCCATGG - Intergenic
1034983163 7:155491107-155491129 GGGCTCCACCCCCCGCGCCCTGG + Intronic
1035151138 7:156874042-156874064 GAGCACCACCCCCTGCTCCACGG - Intronic
1035745543 8:1959983-1960005 CTGCGTCTCCCCCAGCTTCCGGG + Intergenic
1035746714 8:1966332-1966354 CTGCCCCTCCCCCAGCTCCAAGG - Intergenic
1036195368 8:6708888-6708910 GTGAGCCGCCTCCCGCTCCCGGG + Intronic
1036280086 8:7393161-7393183 GTGAGCCCCTCCCAGGTCCCTGG - Intergenic
1036341437 8:7918722-7918744 GTGAGCCCCTCCCAGGTCCCTGG + Intergenic
1036378307 8:8219196-8219218 GGGCACCACCCCCTGCTCCAGGG + Intergenic
1036440980 8:8781428-8781450 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1036588609 8:10147705-10147727 GTGCTCAACCACCAGCTCACAGG + Intronic
1036788396 8:11702705-11702727 GTGTGTCGCCCCCAGCTTCCGGG + Intronic
1036801411 8:11795087-11795109 GAGCGCCACCCCCTGTTCCACGG + Intergenic
1036915025 8:12796587-12796609 GGGCGCCGCCCCCTGCTCCACGG + Intergenic
1037241600 8:16784230-16784252 GAGCACCACCCCCTGCTCCACGG + Intergenic
1037558983 8:20055049-20055071 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
1037608637 8:20458272-20458294 GAGCACCACCCCCACCGCCCCGG + Intergenic
1037811026 8:22086879-22086901 GAGCGCCGCCCCCTGCTCCAGGG + Intergenic
1038174114 8:25164819-25164841 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1039061353 8:33574227-33574249 GAGCGCCACCCTCTGCTCCACGG + Intergenic
1039587654 8:38720120-38720142 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1040899447 8:52403081-52403103 GTGCCCCAGCCCCAGCTACTTGG - Intronic
1040952662 8:52952893-52952915 GAGCACCACCCCCTGCTCCATGG - Intergenic
1040964539 8:53071180-53071202 GGGTGCCGCCCCCTGCTCCCCGG - Intergenic
1041914568 8:63126397-63126419 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1043346506 8:79303818-79303840 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1043516773 8:81001908-81001930 GAGAGCCACACCCATCTCCCTGG + Intronic
1043709933 8:83403270-83403292 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1044075870 8:87821158-87821180 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1044404929 8:91816645-91816667 GAGCGCCGCCCCCTGCTCCAAGG + Intergenic
1044633427 8:94300370-94300392 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1044788732 8:95823962-95823984 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1044862110 8:96533883-96533905 GAGCGCCGCCCCCTGCTCCATGG - Intronic
1045232281 8:100316811-100316833 GAGCACCACCCCCTGCTCCACGG - Intronic
1045386034 8:101671470-101671492 GTGCCCCTCCCCCAGCTTGCAGG - Intergenic
1045933780 8:107655922-107655944 GGGCACCACCCCCTGCTCCGTGG + Intergenic
1046208840 8:111040874-111040896 GAGCGCCGCCCCCTGCTCCTCGG - Intergenic
1046265346 8:111823329-111823351 GAGCACCACCCCCTGCTCCACGG - Intergenic
1046285007 8:112083056-112083078 GAGCGCCACCCTCTGCTCCACGG - Intergenic
1046288956 8:112133015-112133037 GAGCGCCACCTCCTGCTCCACGG + Intergenic
1046445385 8:114311674-114311696 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1046450759 8:114386480-114386502 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
1046661153 8:116949786-116949808 GAGCGCCGCCCCCTGCTCCGCGG - Intergenic
1047124806 8:121948403-121948425 GAGTGCCACCCCCTGCTCCAGGG + Intergenic
1047631659 8:126714674-126714696 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1048187019 8:132250728-132250750 GGGCTCCTCCCCCAGCTCACTGG + Intronic
1048655372 8:136530489-136530511 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1048757453 8:137755157-137755179 GAGCACCACCCCCTGCTCCACGG - Intergenic
1048789222 8:138084459-138084481 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
1049166532 8:141129094-141129116 GGGCGGCACCCCCAGATTCCCGG - Intronic
1049709866 8:144058634-144058656 GTGCGTGAAGCCCAGCTCCCGGG + Exonic
1049748267 8:144272117-144272139 GTGCCCCACCCCTAGCATCCTGG - Intronic
1049828599 8:144685745-144685767 GTGAGCCAGCCGCCGCTCCCCGG + Intergenic
1051419676 9:16877126-16877148 GAGCACCACTCCCAGCTCCATGG - Intergenic
1051439903 9:17072926-17072948 GAGCACCACCCCCTGCTCCAGGG + Intergenic
1051463845 9:17354258-17354280 GAGCACCACCCCCTGCTCCAGGG + Intronic
1051892742 9:21959574-21959596 GAGCACCACCCCCTGCTCCACGG + Intronic
1052437105 9:28443718-28443740 CTGAGTCACCCTCAGCTCCCTGG - Intronic
1052979597 9:34438268-34438290 GAGCGCCACCCCCTGCTCCACGG + Intronic
1053547867 9:39042394-39042416 GAGCACCACCCCCTGCTCCACGG - Intergenic
1055049407 9:71963861-71963883 CAGCGCCACCCCCTGCTCCACGG + Intronic
1055091618 9:72369143-72369165 GACCGCCACCTCCACCTCCCGGG - Intergenic
1056003569 9:82243105-82243127 GTGCTCAACACCCAGGTCCCTGG + Intergenic
1056216327 9:84408804-84408826 GAGCGCCACCCCCTGCTCCATGG + Intergenic
1056330382 9:85516414-85516436 CTGCCCCACTCCCAGCCCCCAGG - Intergenic
1056698432 9:88880364-88880386 GTGTGACACCTCCAGCTGCCTGG - Intergenic
1056757581 9:89391609-89391631 GTGCCCTACCCCCACCTCCTCGG + Intronic
1056771347 9:89480455-89480477 GAGAGCCACCCCCTGCTCCACGG - Intronic
1056806187 9:89730804-89730826 CTCCACCACCCCCAGCTCGCTGG - Intergenic
1056972328 9:91216746-91216768 GTGCACCACCCCCTCCTCCCAGG + Intronic
1056999274 9:91492638-91492660 GTGCCACACCCTCACCTCCCTGG - Intergenic
1057543814 9:96001756-96001778 GAGCGCCACCCCCTGCTCCACGG - Intronic
1058174823 9:101724152-101724174 GAACGCCACCCCCTGCTCCATGG - Intronic
1058379526 9:104362939-104362961 GAGCGCCGCCCCCTGCTCCGCGG - Intergenic
1058727574 9:107818126-107818148 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1058786543 9:108393837-108393859 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1059791111 9:117642802-117642824 GAGCGCCACCCCCTGCTCCAAGG - Intergenic
1059891410 9:118809296-118809318 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1060126453 9:121052379-121052401 GTGCTCAACCTCCACCTCCCAGG - Intergenic
1060295912 9:122342871-122342893 TTGCCCTACCCCCTGCTCCCCGG - Intergenic
1060305334 9:122406236-122406258 GAGCGCCACCCCCTGCTCTACGG - Intergenic
1060839368 9:126781867-126781889 GTTTGCCAACTCCAGCTCCCAGG - Intergenic
1060931441 9:127491824-127491846 CTGGGCCACACCCGGCTCCCAGG - Intronic
1061320188 9:129823664-129823686 CAGCCCCACCCCCAGCCCCCGGG + Intronic
1061333941 9:129916918-129916940 GTGTGCCACCCCTTGCTCCGTGG + Intronic
1062137042 9:134934711-134934733 GTGGGCCTCCCCCAGCACCCAGG + Intergenic
1062389808 9:136329489-136329511 GTGGGCCGCCCCCAGCACTCGGG - Intronic
1062444557 9:136588181-136588203 GTGTGCGCCCCCCAGGTCCCAGG + Intergenic
1186152549 X:6690545-6690567 GAGCGCCACGCCCTGCTCCACGG - Intergenic
1186323208 X:8452528-8452550 GAGCACCACCCCCTGCTCCACGG - Intergenic
1186463175 X:9764896-9764918 GCGCGCCTCCCCCAGCTACTCGG + Intronic
1187139098 X:16575775-16575797 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1187304654 X:18084126-18084148 GAGCACCACCCCCTGCTCCACGG + Intergenic
1187336964 X:18389762-18389784 CTGCTCCAGCCCCAACTCCCAGG + Intergenic
1187557529 X:20366887-20366909 GAGCACCACCCCCTGCTCCACGG - Intergenic
1188112045 X:26205082-26205104 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1188881879 X:35499602-35499624 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
1189491510 X:41474536-41474558 GTGCGCCTCCCCGGGCTCCGTGG + Exonic
1189883138 X:45512501-45512523 GTGCGCCACTCCATTCTCCCTGG + Intergenic
1191846300 X:65550347-65550369 GTGCTCCACCCCCCACTGCCAGG - Intergenic
1192358740 X:70425512-70425534 GTGGGCCACCCCCGGGTCCCAGG - Intronic
1192870525 X:75179555-75179577 GAGCACCACCCCCTGCTCCATGG - Intergenic
1194071557 X:89331067-89331089 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1194121166 X:89965684-89965706 GAGCACCACCCCCTGCTCCAGGG - Intergenic
1194166390 X:90521658-90521680 GAGCACCACCCCCTGCTCCACGG + Intergenic
1194650778 X:96512289-96512311 GAGCACCACCCCCTGCTCCACGG - Intergenic
1195257994 X:103107387-103107409 GAGCGCCACCCCCTGCTCCATGG - Intergenic
1195909563 X:109875932-109875954 GAGCGCCACCCCCTGCTTCAAGG - Intergenic
1196042814 X:111224121-111224143 GTGTGCCAACCTCAGCACCCAGG - Intronic
1196662486 X:118282779-118282801 GAGCACCACCCCCTGCTCCACGG - Intergenic
1196762303 X:119210917-119210939 GAGCACCACCCCCTGCTCCATGG - Intergenic
1196781423 X:119387622-119387644 GAGCACCACCCCCTGCTCCATGG - Intergenic
1196827225 X:119750859-119750881 GAGCACCACCCCCTGCTCCACGG - Intergenic
1196845101 X:119890914-119890936 GAGCGCCGCCCCCTGCTCCACGG + Intergenic
1197331132 X:125155506-125155528 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1197344788 X:125319100-125319122 GAGCACCACCCCCTGCTCCACGG - Intergenic
1197376754 X:125690617-125690639 GAGCGCCGCCCCCTGCTCCATGG - Intergenic
1198300031 X:135325777-135325799 AGGCGCCACCCCCTGCTCCACGG + Intronic
1198462911 X:136880505-136880527 GCCCGCCACCCCCATCTCCAGGG + Intronic
1198468147 X:136921686-136921708 GAGCGCCGCCCCCTGCTCCATGG + Intergenic
1198972546 X:142298283-142298305 GAGCGCCACCCCCTGCTCCACGG - Intergenic
1199009896 X:142745761-142745783 GAGCACCACCCCCTGCTCCACGG - Intergenic
1199094792 X:143726272-143726294 GGGCACCACCCCCTGCTCCGCGG - Intergenic
1199628148 X:149758848-149758870 GAGCGCCACTCCCTGCTCCACGG + Intergenic
1199831238 X:151551224-151551246 GAGCACCACCCCCTGCTCCACGG - Intergenic
1200039623 X:153355792-153355814 CTGGGCCAGCCCCAGCTCCAGGG + Intronic
1200423519 Y:2998413-2998435 GAGCACCACCCCCTGCTCCACGG - Intergenic
1200470851 Y:3584128-3584150 GAGCGCCGCCCCCTGCTCCACGG - Intergenic
1200474020 Y:3623135-3623157 GAGCACCACCCCCTGCTCCAGGG - Intergenic
1200512658 Y:4099439-4099461 GAGCACCACCCCCTGCTCCACGG + Intergenic
1200725795 Y:6666796-6666818 GAGCGCCACCCCCTGCTCCTCGG - Intergenic
1200824250 Y:7622254-7622276 GAGCACCACCCCCTGCTCCACGG - Intergenic
1201060200 Y:10037729-10037751 CTGAGACACCCCCAGGTCCCAGG - Intergenic
1201260916 Y:12158480-12158502 GGGTGCCACCCCCTGCTCCATGG - Intergenic
1201479980 Y:14428413-14428435 GAGCGCCACCCCCTGCTCCACGG + Intergenic
1201715848 Y:17043435-17043457 GAGCGCCACCCCCTGCTCCATGG + Intergenic
1201901069 Y:19046609-19046631 GAGCGCCGCCCCCTGCTCCAAGG - Intergenic
1201982578 Y:19923754-19923776 GAGCACCACCCCCTGCTCCACGG - Intergenic
1202137049 Y:21676701-21676723 GAGCGCCGCCCCCTGCTCCAGGG - Intergenic
1202235804 Y:22708833-22708855 GAGCACCACCCCCTGCTCCACGG + Intergenic
1202271449 Y:23078377-23078399 GAGCGCCACCCCCTACTCCATGG - Intergenic
1202294577 Y:23342305-23342327 GAGCGCCACCCCCTACTCCATGG + Intergenic
1202307359 Y:23487335-23487357 GAGCACCACCCCCTGCTCCACGG - Intergenic
1202424444 Y:24712121-24712143 GAGCGCCACCCCCTACTCCATGG - Intergenic
1202446345 Y:24957964-24957986 GAGCGCCACCCCCTACTCCATGG + Intergenic
1202563446 Y:26183251-26183273 GAGCACCACCCCCTGCTCCACGG + Intergenic