ID: 1161072904

View in Genome Browser
Species Human (GRCh38)
Location 19:2271221-2271243
Sequence ACACCCCCGAGGCTTCCCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161072904_1161072926 26 Left 1161072904 19:2271221-2271243 CCTTCGGGAAGCCTCGGGGGTGT 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1161072926 19:2271270-2271292 GGGGCGGGGTCTTTTGGCCGAGG 0: 1
1: 0
2: 0
3: 8
4: 107
1161072904_1161072915 5 Left 1161072904 19:2271221-2271243 CCTTCGGGAAGCCTCGGGGGTGT 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1161072915 19:2271249-2271271 CGGGTGGGCCCCTGCCTGGGCGG 0: 1
1: 0
2: 3
3: 22
4: 284
1161072904_1161072918 10 Left 1161072904 19:2271221-2271243 CCTTCGGGAAGCCTCGGGGGTGT 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1161072918 19:2271254-2271276 GGGCCCCTGCCTGGGCGGGGCGG 0: 1
1: 0
2: 4
3: 111
4: 957
1161072904_1161072916 6 Left 1161072904 19:2271221-2271243 CCTTCGGGAAGCCTCGGGGGTGT 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1161072916 19:2271250-2271272 GGGTGGGCCCCTGCCTGGGCGGG 0: 1
1: 0
2: 2
3: 60
4: 669
1161072904_1161072919 11 Left 1161072904 19:2271221-2271243 CCTTCGGGAAGCCTCGGGGGTGT 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1161072919 19:2271255-2271277 GGCCCCTGCCTGGGCGGGGCGGG 0: 1
1: 0
2: 3
3: 89
4: 786
1161072904_1161072911 -10 Left 1161072904 19:2271221-2271243 CCTTCGGGAAGCCTCGGGGGTGT 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1161072911 19:2271234-2271256 TCGGGGGTGTGGGACCGGGTGGG 0: 1
1: 0
2: 3
3: 13
4: 209
1161072904_1161072920 12 Left 1161072904 19:2271221-2271243 CCTTCGGGAAGCCTCGGGGGTGT 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1161072920 19:2271256-2271278 GCCCCTGCCTGGGCGGGGCGGGG 0: 1
1: 0
2: 4
3: 113
4: 883
1161072904_1161072913 2 Left 1161072904 19:2271221-2271243 CCTTCGGGAAGCCTCGGGGGTGT 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1161072913 19:2271246-2271268 GACCGGGTGGGCCCCTGCCTGGG 0: 1
1: 0
2: 0
3: 10
4: 223
1161072904_1161072912 1 Left 1161072904 19:2271221-2271243 CCTTCGGGAAGCCTCGGGGGTGT 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1161072912 19:2271245-2271267 GGACCGGGTGGGCCCCTGCCTGG 0: 1
1: 0
2: 1
3: 24
4: 260
1161072904_1161072925 20 Left 1161072904 19:2271221-2271243 CCTTCGGGAAGCCTCGGGGGTGT 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1161072925 19:2271264-2271286 CTGGGCGGGGCGGGGTCTTTTGG 0: 1
1: 0
2: 0
3: 19
4: 251
1161072904_1161072917 7 Left 1161072904 19:2271221-2271243 CCTTCGGGAAGCCTCGGGGGTGT 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1161072917 19:2271251-2271273 GGTGGGCCCCTGCCTGGGCGGGG 0: 1
1: 0
2: 2
3: 46
4: 408
1161072904_1161072927 30 Left 1161072904 19:2271221-2271243 CCTTCGGGAAGCCTCGGGGGTGT 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1161072927 19:2271274-2271296 CGGGGTCTTTTGGCCGAGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161072904 Original CRISPR ACACCCCCGAGGCTTCCCGA AGG (reversed) Intronic