ID: 1161072916

View in Genome Browser
Species Human (GRCh38)
Location 19:2271250-2271272
Sequence GGGTGGGCCCCTGCCTGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 732
Summary {0: 1, 1: 0, 2: 2, 3: 60, 4: 669}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161072909_1161072916 -5 Left 1161072909 19:2271232-2271254 CCTCGGGGGTGTGGGACCGGGTG 0: 1
1: 0
2: 1
3: 7
4: 162
Right 1161072916 19:2271250-2271272 GGGTGGGCCCCTGCCTGGGCGGG 0: 1
1: 0
2: 2
3: 60
4: 669
1161072904_1161072916 6 Left 1161072904 19:2271221-2271243 CCTTCGGGAAGCCTCGGGGGTGT 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1161072916 19:2271250-2271272 GGGTGGGCCCCTGCCTGGGCGGG 0: 1
1: 0
2: 2
3: 60
4: 669

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161072916 Original CRISPR GGGTGGGCCCCTGCCTGGGC GGG Intronic