ID: 1161072938

View in Genome Browser
Species Human (GRCh38)
Location 19:2271314-2271336
Sequence GGCCGCCCGGACGCCCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161072924_1161072938 28 Left 1161072924 19:2271263-2271285 CCTGGGCGGGGCGGGGTCTTTTG 0: 1
1: 0
2: 0
3: 4
4: 119
Right 1161072938 19:2271314-2271336 GGCCGCCCGGACGCCCTGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 115
1161072933_1161072938 4 Left 1161072933 19:2271287-2271309 CCGAGGCAGGGGTGGGGATGTGC 0: 1
1: 0
2: 6
3: 56
4: 578
Right 1161072938 19:2271314-2271336 GGCCGCCCGGACGCCCTGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161072938 Original CRISPR GGCCGCCCGGACGCCCTGGA GGG Intronic
900176500 1:1293634-1293656 GGTCCCCCGGGCGCCCTGGCGGG - Exonic
900199577 1:1398380-1398402 GGCCGTCAGGACGCCGTGGCTGG - Intronic
901686797 1:10947774-10947796 GGCCCCCCGGCCAGCCTGGAAGG + Exonic
903251016 1:22053061-22053083 GGGAGCCCGGGCGCCCAGGATGG - Intronic
907269345 1:53281494-53281516 GGCCTCCTGCACACCCTGGAAGG - Intronic
910935112 1:92480881-92480903 GGCCACCCGGCCGCGCTGTACGG - Exonic
913975152 1:143450029-143450051 GGCCAACTGGACGCCCTGGGAGG - Intergenic
914069545 1:144275645-144275667 GGCCAACTGGACGCCCTGGGAGG - Intergenic
914109610 1:144690709-144690731 GGCCAACTGGACGCCCTGGGAGG + Intergenic
916966156 1:169945035-169945057 GGCTGCCTGGGCACCCTGGATGG - Intronic
920172640 1:204081501-204081523 GGCCCCACGGACCCCCTGGCGGG + Intronic
922502895 1:226110098-226110120 GGCAGCCTGGACGCCCCGGGTGG - Intergenic
922796238 1:228341124-228341146 GGGGGCCCGCATGCCCTGGAAGG + Exonic
923592028 1:235327947-235327969 GGCCGCTCGGGCTCCCTGGTTGG + Exonic
1066243740 10:33562152-33562174 GTGAGCCCGGACACCCTGGATGG + Intergenic
1073178481 10:101570328-101570350 GGCCGCGCGGAAGGCCTGGGTGG - Intergenic
1073930280 10:108566967-108566989 AGCAGCCTGGACGCCATGGATGG + Intergenic
1074596753 10:114875115-114875137 GGCCGCTCTGCAGCCCTGGATGG + Intronic
1076256003 10:129025418-129025440 GGTCGCCAGGACCCACTGGATGG + Intergenic
1077040708 11:520730-520752 GGCCTCCAGGAGACCCTGGATGG - Intergenic
1077266389 11:1652927-1652949 GGCTGCGCGGAAGCCCTGGAGGG + Intergenic
1077374042 11:2197371-2197393 GGCCACCTGGACACCCTGCAGGG - Intergenic
1077523840 11:3052209-3052231 GGCGGCCCCGACGCCCTCCAGGG + Intronic
1078540501 11:12209577-12209599 GGCCGCAGGAACACCCTGGAAGG + Exonic
1079626723 11:22625439-22625461 GGCGTCCCGGACGCCCGGGCCGG + Exonic
1085477928 11:76799357-76799379 GGCCGCGCGGACTCCCGGGTCGG - Intergenic
1090199364 11:124843307-124843329 GGCCTCTCCGAGGCCCTGGAGGG + Intergenic
1092196008 12:6550116-6550138 GGCCAAACGGAAGCCCTGGAGGG + Intronic
1092270405 12:7018795-7018817 GGCCGGACGGTCGCCCCGGAGGG - Intronic
1096208382 12:49742226-49742248 GGCCGCCCCGTGGGCCTGGAAGG - Exonic
1097218204 12:57430669-57430691 GGCGGCCCGGACGGCCTGTGGGG - Intronic
1098973589 12:76879319-76879341 CGCCGCCGGGCCTCCCTGGAGGG - Intergenic
1105781113 13:23705970-23705992 GGGCCCCGGGACTCCCTGGATGG + Intergenic
1106308298 13:28532500-28532522 GGCCGCCCAGACGCCCCCGGGGG - Intergenic
1113912410 13:113849258-113849280 GGCCGCCCTGAAGGCCAGGAGGG + Intronic
1121325162 14:93015606-93015628 GGCAGGGCAGACGCCCTGGAGGG + Intronic
1121547003 14:94769958-94769980 AGCCGCCCGGCCGCGCTGCAAGG - Exonic
1122329659 14:100903985-100904007 CCCCGTCCGGAAGCCCTGGAGGG - Intergenic
1122388395 14:101364236-101364258 GGACGCCCGCACACCCTCGAGGG - Intergenic
1122975448 14:105168931-105168953 CGCCGCCCGGGCGCCCTGGGGGG - Intergenic
1122992046 14:105241080-105241102 GGCAGCCAGGAGGTCCTGGAGGG + Intronic
1126035067 15:44537608-44537630 GGCCTCCCGGACTCCCTCGCCGG + Intronic
1127753441 15:62068028-62068050 GGCGGCCCGGACGCCCTCCTGGG + Exonic
1131130203 15:89894098-89894120 GGCCTCTCTGACGCCTTGGAGGG + Exonic
1138106020 16:54287416-54287438 GGCAGCCCGGGGGCACTGGAAGG + Intergenic
1138179726 16:54933196-54933218 GGCCGCCTCGACGCGCTGCAGGG + Exonic
1139529889 16:67537842-67537864 GGGCGCCGGGACGCCCGGGCCGG + Intronic
1139837781 16:69853554-69853576 GCCCGCCCTGACGCACTGCAGGG - Intronic
1142291706 16:89196231-89196253 GGCCCCCTGGACACCCTGCACGG - Exonic
1142619380 17:1154999-1155021 GGCCCCCAGGGCGCCCGGGAAGG - Intronic
1144269087 17:13600751-13600773 AGCCGCCCGGACCCCCTGACAGG + Exonic
1151224852 17:72640537-72640559 CGCCGGCCGGCCGCCCTGCAGGG + Intergenic
1151678474 17:75611885-75611907 GGCCATCGGGACGCCCTGGCTGG + Intergenic
1152111314 17:78359223-78359245 GGCGGGCCGGGCGCGCTGGAGGG - Intronic
1152337925 17:79708407-79708429 GGCCCCCCGCAGGCCCTGGTGGG + Intergenic
1152758203 17:82095936-82095958 GGCCCCCCGCACCCCCTGCATGG + Intronic
1152904132 17:82961167-82961189 GTCCTCCGGGACGCCCTGCAGGG + Exonic
1155209154 18:23586251-23586273 GGCCACCGGGACGCCCTGTGGGG - Intronic
1157464210 18:47930542-47930564 GGCGGCCCGGGCGCGCGGGAGGG + Exonic
1157815962 18:50729660-50729682 GGCCGCCCGGCCCCGGTGGACGG + Exonic
1160701839 19:511280-511302 AGCCGCCCGGGAGCCCAGGAGGG + Intronic
1160939624 19:1614237-1614259 GGCCGCCCCCACCACCTGGAGGG - Intronic
1161072938 19:2271314-2271336 GGCCGCCCGGACGCCCTGGAGGG + Intronic
1161118735 19:2513357-2513379 GGCCGCCCCGACCCCCTCCACGG - Exonic
1161327490 19:3670730-3670752 GGCCACCTGGATGCCCTGCAGGG + Intronic
1161420378 19:4173300-4173322 GGCCGCCCAGATCCCCGGGAAGG - Intergenic
1162833077 19:13298980-13299002 GGACGCACGGAGGCCCTGGGCGG - Exonic
1166048455 19:40243448-40243470 GGCCCGCAGGACTCCCTGGAGGG + Intronic
1166759998 19:45218261-45218283 AGCAGCCCGGAGGCCCTGGATGG - Exonic
1167492697 19:49801509-49801531 GGCCCGCAGGACGCCCTGGATGG - Exonic
926751209 2:16200056-16200078 GGCAGCCCGCACGGCATGGAAGG + Intergenic
927477609 2:23425913-23425935 GGCCACCCTGAGGCCCTGGGCGG - Intronic
934179852 2:89611002-89611024 GGCCAACTGGACGCCCTGGGAGG - Intergenic
934290148 2:91685263-91685285 GGCCAACTGGACGCCCTGGGAGG - Intergenic
936935649 2:117836384-117836406 GGTCTCCCGGCAGCCCTGGAAGG + Intergenic
942543544 2:177039147-177039169 AGCAGCCTGGAAGCCCTGGAGGG - Intergenic
947549866 2:231038137-231038159 GGCCGCCTGGACGGCCAGGCAGG - Exonic
948437848 2:237966312-237966334 GGCCTGCCTGACGCCCAGGACGG + Intergenic
948559906 2:238845914-238845936 GGCCCCGGGGACGCCCTGGAAGG - Intergenic
1168955695 20:1832763-1832785 GGCAGCCCGGCAGCTCTGGAAGG + Intergenic
1178922477 21:36747769-36747791 GCCCGCCAGGCCGCCCGGGACGG + Exonic
1179935686 21:44602275-44602297 GGCTGCCAGGACGCCTGGGAAGG - Intronic
1181032433 22:20154986-20155008 GGCGCCCGGGACACCCTGGATGG + Intergenic
1181274139 22:21677886-21677908 GGCCGCCCTGACCCGCTGCAGGG + Intronic
1181652917 22:24270832-24270854 GGCCGCCCGGCCTCCCTCGCGGG - Exonic
953748760 3:45594260-45594282 GGCCGCCCGTGCGTCCCGGACGG + Intronic
963046253 3:141104676-141104698 GGCTCCCAGGACGCCCTGGCAGG - Intronic
968659633 4:1793697-1793719 GGCGGCCCGGGAGCCCTGGGCGG + Intronic
968803145 4:2756120-2756142 GCCCGCCTGGCCGCGCTGGAGGG - Exonic
969341227 4:6543038-6543060 GGCCACCCAGACGCCCCGCAAGG + Intronic
969829428 4:9782620-9782642 GGCCAACTGGACGCCCTGGGAGG + Exonic
985305296 4:188532944-188532966 GGCCGGCCGGCCGGCCGGGATGG + Intergenic
988093243 5:26569266-26569288 AGCAGCCTGGACGCCATGGATGG - Intergenic
992769667 5:80035399-80035421 GGCAGCCCGGACGCCGAGCACGG + Exonic
995725931 5:115180215-115180237 GGCTGCCCGGGAGCCCTCGATGG - Intronic
997727460 5:136133251-136133273 GGCGTCTGGGACGCCCTGGAGGG + Intronic
1003614803 6:7645279-7645301 GGCAGCCTGGATGCCCTGGGAGG - Intergenic
1005947147 6:30602894-30602916 GGCCCCCAGGACCCCCTGGTGGG + Exonic
1006396096 6:33788666-33788688 GGACGCCCGGACGCCCGACAGGG - Exonic
1006806312 6:36791949-36791971 GGCCTCCCTGAGCCCCTGGAGGG - Intronic
1006987277 6:38184330-38184352 GGCAGCACGGAGGCCCTGTATGG - Intronic
1011281214 6:85679318-85679340 GCCCGCCCTGAGGCCCTGCAGGG - Intergenic
1015366372 6:132401538-132401560 GGCCGCGCGCCCGCCCGGGAGGG + Exonic
1016439007 6:144064534-144064556 GGCCGCCCGGACCCGCCGGCCGG - Intronic
1016596961 6:145814394-145814416 GGCCGTCCGGGCGCCCTGAGAGG - Intronic
1023319305 7:38976076-38976098 GGGCTCCCGGGCGCCCAGGAGGG + Intergenic
1026036378 7:66833088-66833110 GGGGGCCCCGACGGCCTGGAGGG - Intergenic
1032268770 7:130385630-130385652 GGCCAGCCGGACACCCTGAAGGG + Intronic
1035051112 7:155999520-155999542 GGGTGACCTGACGCCCTGGACGG + Intergenic
1035223736 7:157422298-157422320 GGCCCTCCAGACGCCCAGGAAGG - Intergenic
1037889926 8:22618680-22618702 AGCCGCCAGGAGGGCCTGGATGG + Exonic
1048178341 8:132172679-132172701 GGACCCCAGGATGCCCTGGAGGG + Exonic
1048854240 8:138673114-138673136 GGCAGCACTGACTCCCTGGAAGG - Intronic
1049635178 8:143684380-143684402 GGCGGCCTGGACGGCCTGGAAGG + Intergenic
1049660108 8:143816021-143816043 GCCCGCCCGCCCGCCTTGGACGG + Intergenic
1049792643 8:144479056-144479078 GGGCGCCAAGACGCCCAGGAGGG - Intronic
1060209022 9:121699220-121699242 GGCCGCGCGGCCGCCCAGCAAGG + Intronic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1060877763 9:127095573-127095595 GGCCGCTCTGACGCCCTGCAAGG + Intronic
1061961672 9:133991967-133991989 GGCGGCCCAGGCGCCCTGGCTGG - Intronic
1062656008 9:137605022-137605044 GGCCGCGCGGGCGTCCTGGGCGG - Intergenic
1185802306 X:3024095-3024117 GGCCACCTGGAGCCCCTGGACGG + Exonic
1194977339 X:100408731-100408753 CGCCGCCGGGCCGCCCTGGGCGG - Exonic