ID: 1161073414

View in Genome Browser
Species Human (GRCh38)
Location 19:2273605-2273627
Sequence CTCCCACGGAGGAGACCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161073407_1161073414 -3 Left 1161073407 19:2273585-2273607 CCCAGGCAGCTGCGGGACCCCTC 0: 1
1: 0
2: 0
3: 14
4: 179
Right 1161073414 19:2273605-2273627 CTCCCACGGAGGAGACCCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 122
1161073401_1161073414 28 Left 1161073401 19:2273554-2273576 CCTGGGTGGAGGGGTCGCGGGGG 0: 1
1: 0
2: 1
3: 40
4: 400
Right 1161073414 19:2273605-2273627 CTCCCACGGAGGAGACCCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 122
1161073399_1161073414 29 Left 1161073399 19:2273553-2273575 CCCTGGGTGGAGGGGTCGCGGGG 0: 1
1: 0
2: 2
3: 21
4: 262
Right 1161073414 19:2273605-2273627 CTCCCACGGAGGAGACCCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 122
1161073408_1161073414 -4 Left 1161073408 19:2273586-2273608 CCAGGCAGCTGCGGGACCCCTCC 0: 1
1: 0
2: 4
3: 27
4: 263
Right 1161073414 19:2273605-2273627 CTCCCACGGAGGAGACCCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161073414 Original CRISPR CTCCCACGGAGGAGACCCCC TGG Intronic
900420149 1:2552770-2552792 CTCCCCCCAGGGAGACCCCCTGG + Intergenic
900424282 1:2568888-2568910 CTCCCCCCAGGGAGACCCCCTGG - Intergenic
900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG + Intronic
900659703 1:3776365-3776387 CTCCCACGGAGGAAAGCAGCCGG - Intergenic
900985918 1:6072773-6072795 GTCCCAGGCAGGAGACCCGCAGG - Exonic
901256255 1:7829892-7829914 CTCCCTGGGAGGTGACCCCGTGG - Exonic
901274522 1:7980756-7980778 CTCACCCAGAGCAGACCCCCAGG - Intronic
901700932 1:11044509-11044531 GACCCACAGAGGAGACACCCTGG - Intronic
902250930 1:15153857-15153879 CGCCCACCGAGGAGGCCGCCCGG + Intronic
902263934 1:15247587-15247609 CGCCCGCGGAGGAAGCCCCCGGG + Intronic
902534807 1:17113525-17113547 CTCCCAGGGAGGGGACAGCCAGG - Intronic
904585125 1:31575989-31576011 CTCCCAGGGATGAGCCGCCCAGG + Intergenic
905301930 1:36991481-36991503 CTCCCATGGAGGTGACCCTCTGG - Intronic
906359025 1:45136858-45136880 CTGCTAAGGAGGAGAGCCCCTGG - Intronic
909545838 1:76845470-76845492 CCCCCACGCAGGACATCCCCAGG + Intergenic
912412605 1:109488944-109488966 CTCCCAAGGAGAAGAGCCCAGGG + Exonic
924561197 1:245156938-245156960 GGCCCACGGGGGAGGCCCCCAGG + Intronic
1066367220 10:34788842-34788864 CTGCCAAGGAGGGGACCTCCTGG - Intronic
1076052587 10:127347398-127347420 CTCCCACGGCTGAGCCCCACGGG - Intronic
1077205028 11:1337769-1337791 GTCCCCCGGAGGCGCCCCCCAGG - Intergenic
1077205941 11:1344299-1344321 CGCCCAAGGAGGAGCCGCCCAGG - Intergenic
1081814732 11:45932215-45932237 TTCCCTCGGAGGTGTCCCCCAGG + Intronic
1082637329 11:55612600-55612622 CTACCACAGAGTAGATCCCCAGG + Intergenic
1090273114 11:125401647-125401669 CTCCCAGGAAGGAGAGGCCCAGG + Intronic
1104489182 12:129179431-129179453 CTCCCACAGAAGAGACACCAGGG - Intronic
1104607232 12:130199016-130199038 ATCCCACGGAGGAGACGGGCAGG + Intergenic
1104786826 12:131455564-131455586 CTCCCTTGGAGGAGCCCCCTCGG - Intergenic
1104916860 12:132269953-132269975 CTCTCACTGAGGGCACCCCCAGG + Intronic
1111331372 13:86764165-86764187 TTCCCAGGGAGGAACCCCCCTGG - Intergenic
1113542973 13:111123236-111123258 CTACCTCCGAGGAGACCCCAGGG + Intronic
1113693690 13:112329614-112329636 CTCCCACTCAGGAGACCATCAGG + Intergenic
1113745657 13:112742374-112742396 GTCCCACGGAGGAGCCCCTGCGG + Intronic
1119378243 14:74212177-74212199 CTCCCTCGAAGGAGAGCCCAAGG - Intergenic
1121454021 14:94027012-94027034 CGCCCACGGAGCAGACGACCTGG - Intronic
1122786871 14:104167978-104168000 TGCCCACGTTGGAGACCCCCTGG + Intronic
1122892315 14:104738521-104738543 CTCCCACGGAGGGGACTGGCAGG + Intronic
1124372101 15:29109869-29109891 CTGCCAAGGAGGAGGCCCCGTGG + Intronic
1128634291 15:69293330-69293352 CAGCCAGGGCGGAGACCCCCAGG - Intergenic
1129184030 15:73894768-73894790 CCCCCATGGCAGAGACCCCCTGG + Intergenic
1130632132 15:85580186-85580208 CTCCCACTGTGAAGACCCACAGG + Exonic
1130938334 15:88488478-88488500 CTCCCAGGGACGAGACCACCAGG - Intergenic
1131000545 15:88936527-88936549 CTCCCTGGCAGGAGCCCCCCAGG - Intergenic
1131518220 15:93093670-93093692 CTCCCGAGGAGAAGACCACCTGG - Intergenic
1132400352 15:101501457-101501479 CTCCCCCAGCAGAGACCCCCAGG + Intronic
1132457971 16:34803-34825 CTCCCAGGAGGGAGGCCCCCAGG + Intergenic
1132669601 16:1097167-1097189 CTCCCACAGGGGGGACCCCTTGG - Intergenic
1132698214 16:1211313-1211335 CTGCGACGGGGCAGACCCCCGGG - Intronic
1132808180 16:1785404-1785426 CTGCCAACGAGGAGAGCCCCTGG + Intronic
1133248243 16:4463373-4463395 CTCCCACAGAGGAGCCCGGCAGG + Intronic
1133739202 16:8639170-8639192 CTCCCTGGCAGAAGACCCCCTGG - Intronic
1133950285 16:10385869-10385891 CGCCCACGGAGGCGAACCCCAGG + Intronic
1134021023 16:10921828-10921850 CTCCCACGGGGCTGACCTCCAGG + Intronic
1136651856 16:31679710-31679732 ATCCAAGGGAGGGGACCCCCTGG - Intergenic
1136671489 16:31862457-31862479 ATCCAAGGGAGGGGACCCCCTGG - Intergenic
1139922241 16:70467588-70467610 CTGCCACGGAGGAAACTCCTTGG - Intronic
1141801783 16:86314777-86314799 CTCGCATGGAGAAGACCCCAGGG + Intergenic
1142631415 17:1228929-1228951 TCGCCGCGGAGGAGACCCCCGGG - Intronic
1147760817 17:42796393-42796415 TTCCCCCGGGGCAGACCCCCAGG - Intronic
1150590263 17:66556071-66556093 GTCCCAGGGAGGAGTCCCCATGG - Intronic
1152071795 17:78137804-78137826 CTGCCTCGGAGGTGAGCCCCGGG + Exonic
1152439653 17:80298260-80298282 CTCCCAGGGAGATGACTCCCTGG + Intronic
1160753533 19:746699-746721 CTCCCACGGAGGCCGCCTCCAGG + Exonic
1161073414 19:2273605-2273627 CTCCCACGGAGGAGACCCCCTGG + Intronic
1162035188 19:7934628-7934650 TTCCCAAGGAGGGGACCCCGGGG + Intronic
1163157898 19:15449309-15449331 AGCCCACGGAGGAGCCCCCTGGG - Intronic
1163209355 19:15829220-15829242 GTCTCACGAAGGAGTCCCCCTGG - Intergenic
1167237984 19:48326407-48326429 CTCTCAGGGAGGAGACCGCTGGG - Intronic
927841851 2:26449878-26449900 ATGCCACGGAGCAGACGCCCAGG - Intronic
936104931 2:109615167-109615189 CTCCCCCGGAGGAGCTGCCCGGG - Exonic
939996780 2:148927319-148927341 TTCCCACGCAGGAGGCCCCAGGG - Intronic
946417088 2:219545329-219545351 CTGACAGGGAGGAGACTCCCTGG + Intronic
948211008 2:236193190-236193212 CTCCCCCGGAGGACACCGGCAGG - Intergenic
1168898103 20:1337909-1337931 TTCCCACAGAGAAGTCCCCCAGG + Intronic
1176243807 20:64087906-64087928 CTCCCACGGAGGAGAACTGGTGG - Intronic
1179451907 21:41473636-41473658 TTCCCCAAGAGGAGACCCCCAGG - Intronic
1180197826 21:46208137-46208159 CGCCAAGGGAGGAGTCCCCCAGG + Intronic
1180771473 22:18390459-18390481 TTCCCAGGGATGGGACCCCCTGG + Intergenic
1181039398 22:20184764-20184786 CTCCCAGGTAGCAGAGCCCCCGG + Intergenic
1181573274 22:23779266-23779288 CTGCCACGCAGGAAGCCCCCCGG + Exonic
1182509511 22:30808979-30809001 CACACACAGAGGAGACCACCAGG + Intronic
1184020074 22:41814863-41814885 CTCCCACGGAGGTGACACAGAGG + Intronic
1184499339 22:44862355-44862377 CACTCAGGGAGGAGACCCCCTGG - Exonic
949559247 3:5187533-5187555 CTCCCACGCAGTAGGCCGCCAGG - Intergenic
953042795 3:39269671-39269693 CCCTCACTGAGCAGACCCCCTGG - Intronic
955940974 3:64146867-64146889 CGCCCACAGAGCAGACCCCTCGG - Exonic
961514223 3:127422858-127422880 CTCCCACATCGGAGAACCCCGGG + Intergenic
962486552 3:135849020-135849042 CTTCCACAGAGGTGACCCCTAGG + Intergenic
965080320 3:164024387-164024409 TTCCCCCGGAGGAACCCCCCTGG - Intergenic
966816388 3:183893279-183893301 CTCCCAGGGCCGAGAACCCCAGG + Intergenic
967270729 3:187729884-187729906 CTGCCACTGAGGAGCGCCCCTGG - Exonic
968410713 4:387288-387310 CTCCCTCGGAGGAGACCTGGAGG - Intergenic
968647398 4:1747573-1747595 CTCCCACGGAGGCAGCCCCCAGG - Intergenic
968973387 4:3808588-3808610 CTGGTATGGAGGAGACCCCCAGG + Intergenic
969043710 4:4321178-4321200 CAACCACGGCGGTGACCCCCTGG + Exonic
969461103 4:7329377-7329399 CACCCATGGAGGACACCTCCCGG + Intronic
969637734 4:8379052-8379074 CGCCGACGGAGAACACCCCCAGG - Intronic
971359344 4:25922530-25922552 CTTCCACGGTGGAGAGGCCCAGG - Intronic
984867181 4:184291584-184291606 CTGCCACAGAAGAGGCCCCCAGG + Intergenic
986765662 5:10923810-10923832 GTGCCACTGAGGAGACTCCCTGG + Intergenic
997665023 5:135623701-135623723 CTTACACAGAGGAGACACCCAGG + Intergenic
999357233 5:150946824-150946846 CTCCCACAGAGGAAACGCCCCGG - Intergenic
1000989905 5:167900879-167900901 CTCCCACAGAAAAGTCCCCCAGG - Intronic
1004620331 6:17325672-17325694 CTCCCCAGGAGGAACCCCCCTGG - Intergenic
1008426800 6:51367742-51367764 CTCCCACGCATGAGACACCATGG - Intergenic
1015939069 6:138431159-138431181 CTACCAAGGAGGAGACCAGCAGG - Exonic
1016950749 6:149577298-149577320 GTTCCACGAAGGAGACCCACGGG + Intronic
1018808637 6:167281253-167281275 ATCCCACGGAGAGGAGCCCCAGG + Intronic
1018998302 6:168726725-168726747 CACCCGTGGAGGAGTCCCCCGGG - Intergenic
1019277429 7:183180-183202 CTCCCCAGGGGGAGACCCCTCGG + Intergenic
1019490067 7:1308458-1308480 CTCCCGAGGTGGTGACCCCCAGG - Intergenic
1025051814 7:55739186-55739208 GTCCCACGGAGCAGCCCCCGAGG - Intergenic
1026501569 7:70947279-70947301 ATCCCCCTGTGGAGACCCCCTGG - Intergenic
1028078393 7:86543858-86543880 CTCCCACTGAGGATATCACCTGG + Intergenic
1029412076 7:100419783-100419805 CCCCTAAGGAGGAGACCCCGGGG - Exonic
1032954164 7:136951122-136951144 CTCAAACAGAGGAGGCCCCCTGG + Intronic
1033147478 7:138883752-138883774 ATTCCATGGAGGAGACCCCTTGG - Intronic
1034959717 7:155357783-155357805 CTGCCAGGGAGGATCCCCCCAGG + Exonic
1039081393 8:33737392-33737414 CTCCTATGAATGAGACCCCCTGG - Intergenic
1048011840 8:130463725-130463747 CACCCACGTAGGATTCCCCCCGG + Intergenic
1049514706 8:143047833-143047855 CTCCCATGGAGGAGCCTCCCTGG + Intronic
1049553456 8:143271107-143271129 CTCCCACGGGGCAAAACCCCTGG - Intronic
1052995519 9:34549899-34549921 CTCACAGGGACCAGACCCCCAGG + Intergenic
1053292219 9:36888752-36888774 ACCCCAGGGAGGAGACCTCCAGG + Intronic
1053306272 9:36986628-36986650 CTCCGACGGAGGAGTCCCCAGGG - Intronic
1060375660 9:123113635-123113657 CTCACACGGAGGAGATGCTCAGG + Intronic
1061839375 9:133348648-133348670 CGCCCACCCAGGAGACACCCCGG - Intronic
1061927072 9:133811129-133811151 ATCCCTCGGGGGAGACCCCCCGG + Intronic
1186660440 X:11664192-11664214 GGCCCAAGGAGGAGGCCCCCAGG - Intronic
1197098688 X:122625751-122625773 ACCCCACGGAGGATACCCCAGGG + Intergenic
1197434976 X:126416189-126416211 CTCCAACGGCAGAGACCCCAGGG + Intergenic
1197769868 X:130083015-130083037 CTCCCCCACAGGAGACACCCAGG + Intronic
1200239627 X:154486777-154486799 CGCCCCGGGAGGAGTCCCCCCGG + Intergenic