ID: 1161076316

View in Genome Browser
Species Human (GRCh38)
Location 19:2287504-2287526
Sequence CACGATGTACAGATGGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 65}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161076316_1161076331 19 Left 1161076316 19:2287504-2287526 CCCTGGGCCATCTGTACATCGTG 0: 1
1: 0
2: 0
3: 9
4: 65
Right 1161076331 19:2287546-2287568 CGGCCACAGCTCAGGGAGAACGG 0: 1
1: 0
2: 2
3: 15
4: 218
1161076316_1161076323 -1 Left 1161076316 19:2287504-2287526 CCCTGGGCCATCTGTACATCGTG 0: 1
1: 0
2: 0
3: 9
4: 65
Right 1161076323 19:2287526-2287548 GGTGCTGGCCTGGGCCCTCCCGG 0: 1
1: 0
2: 3
3: 63
4: 532
1161076316_1161076322 -10 Left 1161076316 19:2287504-2287526 CCCTGGGCCATCTGTACATCGTG 0: 1
1: 0
2: 0
3: 9
4: 65
Right 1161076322 19:2287517-2287539 GTACATCGTGGTGCTGGCCTGGG 0: 1
1: 0
2: 4
3: 5
4: 83
1161076316_1161076332 20 Left 1161076316 19:2287504-2287526 CCCTGGGCCATCTGTACATCGTG 0: 1
1: 0
2: 0
3: 9
4: 65
Right 1161076332 19:2287547-2287569 GGCCACAGCTCAGGGAGAACGGG 0: 1
1: 1
2: 0
3: 36
4: 309
1161076316_1161076325 11 Left 1161076316 19:2287504-2287526 CCCTGGGCCATCTGTACATCGTG 0: 1
1: 0
2: 0
3: 9
4: 65
Right 1161076325 19:2287538-2287560 GGCCCTCCCGGCCACAGCTCAGG 0: 1
1: 0
2: 1
3: 26
4: 253
1161076316_1161076326 12 Left 1161076316 19:2287504-2287526 CCCTGGGCCATCTGTACATCGTG 0: 1
1: 0
2: 0
3: 9
4: 65
Right 1161076326 19:2287539-2287561 GCCCTCCCGGCCACAGCTCAGGG 0: 1
1: 0
2: 2
3: 18
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161076316 Original CRISPR CACGATGTACAGATGGCCCA GGG (reversed) Intronic
903213659 1:21831724-21831746 CACGGTGTGGAAATGGCCCAGGG + Exonic
903293425 1:22329022-22329044 CACAATGTGCAGTGGGCCCAGGG - Intergenic
913109005 1:115641615-115641637 CACTATAAACACATGGCCCAGGG - Intergenic
915102975 1:153513908-153513930 CAAGATGAACAGATGGTCCAAGG + Intergenic
916064818 1:161127824-161127846 CACAATCAACAGCTGGCCCAAGG - Intronic
916628692 1:166588373-166588395 CACACAGTAAAGATGGCCCACGG - Intergenic
917479621 1:175400748-175400770 CACGATGTTCCCATTGCCCATGG - Intronic
922180490 1:223229135-223229157 CACTATGTGCAGATGGTCCAAGG + Intronic
1062953008 10:1519327-1519349 CACCATGTACAGATGTTACACGG - Intronic
1068660843 10:59621934-59621956 CAAGATGGACAGATGGCTGATGG - Intergenic
1070058236 10:72955418-72955440 CAAGATCTACAGATGGTCCAAGG + Intergenic
1073671102 10:105590834-105590856 CACTATGTGCAGATGTCCCCAGG - Intergenic
1076611518 10:131728933-131728955 CAGGATGTACACTTGGCTCACGG - Intergenic
1076846264 10:133070995-133071017 CACCAGGCACAGATGGCGCACGG + Intronic
1085976499 11:81661465-81661487 CACAATGCACAGATGGGGCATGG - Intergenic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1104973564 12:132542132-132542154 CAGGATGACCAGATGGCACAGGG + Intronic
1113893929 13:113751775-113751797 CACGATGTCCAGATGCACCGGGG - Intergenic
1120131193 14:80809493-80809515 AACAAGATACAGATGGCCCAGGG + Intronic
1122852641 14:104545358-104545380 CTGGCTGTACTGATGGCCCAAGG + Intronic
1136717313 16:32290734-32290756 CACACAGGACAGATGGCCCAGGG + Intergenic
1136835688 16:33496988-33497010 CACACAGGACAGATGGCCCAGGG + Intergenic
1140700265 16:77575057-77575079 CACGGTGCTCAGACGGCCCAGGG + Intergenic
1141500757 16:84442734-84442756 CACCACCAACAGATGGCCCAAGG - Intronic
1203009116 16_KI270728v1_random:227044-227066 CACACAGGACAGATGGCCCAGGG - Intergenic
1143805052 17:9419267-9419289 CACTATGTTGAGATCGCCCAAGG + Intronic
1147190191 17:38733925-38733947 CAAGAGATACAGATGTCCCAGGG + Exonic
1154506914 18:15050118-15050140 CACAAAGTACAGATGGAGCATGG + Intergenic
1156060105 18:33063618-33063640 CACGCTGTACACAGAGCCCAAGG + Intronic
1159340762 18:67129665-67129687 CAAGGTGTACAAATGGCCAATGG - Intergenic
1160772708 19:840300-840322 CCCGATGTCCACAGGGCCCAGGG - Intergenic
1161076316 19:2287504-2287526 CACGATGTACAGATGGCCCAGGG - Intronic
1163839496 19:19597725-19597747 CACGTTGTGCAGATGACCCTTGG + Intronic
930090075 2:47525556-47525578 CTTGAAGTACAGATGGCCCCTGG - Intronic
934088358 2:88529271-88529293 CACGATCTGCACCTGGCCCAGGG + Exonic
934640007 2:96022317-96022339 GACTGTGTACACATGGCCCAGGG + Intronic
944962475 2:204890695-204890717 CTAGATGTACACATGGCCTAAGG + Intronic
946284490 2:218692845-218692867 CATGTTCTACAAATGGCCCAGGG - Intronic
1170812364 20:19684480-19684502 CCAGATATACAGCTGGCCCAGGG - Intronic
1178599107 21:33980673-33980695 CAAGATGCACAGCTGGCCCCAGG - Intergenic
1179418454 21:41216869-41216891 CACGATGGACAGTGGGCACAGGG + Intronic
1180024679 21:45153718-45153740 CACGGTGCACAGAGGGCCCAGGG - Intronic
1185227186 22:49659807-49659829 CAGGATGTACAGGTGGCCGCAGG + Intergenic
954859407 3:53675129-53675151 CCCTATGTAGAGTTGGCCCAGGG + Intronic
955977752 3:64494385-64494407 CAGGCTGTAGAGATGGACCAGGG - Intergenic
958415708 3:93870477-93870499 CAGCATGTACAGATGGCCACAGG - Intergenic
960088588 3:113616273-113616295 CAAGAAGGCCAGATGGCCCAGGG + Intronic
969897193 4:10316459-10316481 TAAGATATACAGGTGGCCCAGGG - Intergenic
985022761 4:185709641-185709663 CAGGATCTACAGATGGCCACAGG - Intronic
986156819 5:5184402-5184424 ATCGATGCACAGATGGCACAGGG - Intronic
991685418 5:69177678-69177700 TAATATGTACAGATGGCACATGG - Exonic
994309131 5:98246137-98246159 CTCCATCTACAGATGACCCAAGG + Intergenic
996950498 5:129120037-129120059 GAGGATGGACAGATGGCCTAAGG - Intergenic
999817114 5:155188198-155188220 CAAGATATACAAATGGCCAAAGG - Intergenic
1003544291 6:7045414-7045436 CTCCATGCACAGATGGCACAGGG - Intergenic
1007615772 6:43179200-43179222 CGCCCTGGACAGATGGCCCAAGG + Exonic
1008431609 6:51424514-51424536 CAAGATATACAAATGGCCAAAGG + Intergenic
1010381297 6:75228246-75228268 CACGATTTAAAAATGGGCCAAGG + Intergenic
1011991597 6:93526568-93526590 CACGATTTACATATAGCCCAAGG + Intergenic
1020345058 7:7153746-7153768 CAACATGCCCAGATGGCCCATGG - Intergenic
1027255714 7:76429567-76429589 CACGATGGACAGGTTTCCCACGG - Exonic
1030313836 7:108094088-108094110 CACGATGGACAGTTCCCCCATGG + Intronic
1035840174 8:2803047-2803069 AACGATGTACAAATGGACCACGG - Intergenic
1040987194 8:53308384-53308406 CAAGATGTTCAGAAGGCCCAAGG + Intergenic
1042523939 8:69744614-69744636 GAAGATGTACAGATACCCCAAGG - Intronic
1059438090 9:114288490-114288512 CCCGATCTCCAGGTGGCCCAGGG - Exonic
1061673053 9:132200028-132200050 CCCATTCTACAGATGGCCCAGGG - Intronic
1061941561 9:133886908-133886930 CAAGATGCACAGGAGGCCCAGGG + Intronic
1187578189 X:20580084-20580106 CACCATGTACAGATTGGCCAAGG - Intergenic
1189905885 X:45759026-45759048 GAGGATGTACAGAAGCCCCAGGG - Intergenic
1199671944 X:150155010-150155032 CAGGATGCACAGAAGGACCAGGG - Intergenic
1200115580 X:153768409-153768431 CACCTTGTACAGCTGGCCCTGGG - Exonic
1202251531 Y:22878346-22878368 CTCCATGTACACAGGGCCCAAGG + Intergenic
1202404519 Y:24512095-24512117 CTCCATGTACACAGGGCCCAAGG + Intergenic
1202466260 Y:25157987-25158009 CTCCATGTACACAGGGCCCAAGG - Intergenic