ID: 1161076653

View in Genome Browser
Species Human (GRCh38)
Location 19:2289161-2289183
Sequence CGGGTGTGAGCTCTGTGTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 1, 2: 2, 3: 19, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161076647_1161076653 27 Left 1161076647 19:2289111-2289133 CCTTGTATCAGGTGTGAGCTGAG 0: 1
1: 0
2: 0
3: 12
4: 145
Right 1161076653 19:2289161-2289183 CGGGTGTGAGCTCTGTGTTCCGG 0: 1
1: 1
2: 2
3: 19
4: 148
1161076648_1161076653 -1 Left 1161076648 19:2289139-2289161 CCTGCGTATGAGCTGTGTGTCCC 0: 1
1: 0
2: 1
3: 6
4: 100
Right 1161076653 19:2289161-2289183 CGGGTGTGAGCTCTGTGTTCCGG 0: 1
1: 1
2: 2
3: 19
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161076653 Original CRISPR CGGGTGTGAGCTCTGTGTTC CGG Intronic
901747513 1:11384253-11384275 TTGGGGTGTGCTCTGTGTTCTGG - Intergenic
902786066 1:18733537-18733559 CTGGTCTGAGCTCTGAGCTCTGG + Intronic
904835227 1:33331409-33331431 CAAGTGTGAGCTCTGTGGCCGGG - Exonic
905293686 1:36940775-36940797 TGAGTGTGAGCTCTGTTTTCAGG - Intronic
906191514 1:43902250-43902272 CAGGAGGCAGCTCTGTGTTCTGG + Intronic
907254373 1:53167395-53167417 TGGGTGTGGGCTCTCTGTCCAGG + Intergenic
909269160 1:73600846-73600868 CCAGTGGGAGCTCTGTGTTGGGG + Intergenic
910110574 1:83678422-83678444 CAGAAGTGGGCTCTGTGTTCTGG - Intergenic
910340226 1:86178566-86178588 CAGGTAGGAGCTCTGTGTTGGGG + Intergenic
912490270 1:110058988-110059010 CAGGTGTGAGCCCTGTATCCGGG - Intronic
915038274 1:152946860-152946882 GGGGTGTGAGGGCAGTGTTCTGG - Intergenic
915478325 1:156167718-156167740 TGGTTGTGTGCTCTTTGTTCTGG + Intronic
916316935 1:163459447-163459469 CAGGAGTGAGCACTGGGTTCAGG + Intergenic
918962805 1:191302641-191302663 TGGGTGTGAGCTTGGTCTTCAGG + Intergenic
919797125 1:201327598-201327620 CGGGGGTGGACTCTGTGTTTTGG - Intronic
919981488 1:202644851-202644873 CGGGAGTGAGGTCTATGTCCTGG - Intronic
921183182 1:212647205-212647227 GGGGTGTGAACTCTGTGCTGGGG - Intergenic
922770245 1:228177887-228177909 AGGGTCAGAGCTTTGTGTTCAGG + Exonic
922795251 1:228336524-228336546 TGGATGTGAGCTCTGTGCCCAGG - Intronic
1069298494 10:66877199-66877221 AGGGTTTGGGCACTGTGTTCTGG + Intronic
1074882382 10:117669137-117669159 AGGGGGTGATCTGTGTGTTCTGG + Intergenic
1075944624 10:126421753-126421775 TGTGTGAGAGCTCTGGGTTCAGG - Intergenic
1076502034 10:130944715-130944737 TGGGTGTGAGCCCTCTATTCTGG + Intergenic
1076901151 10:133338470-133338492 CGTGTGTGAGGTGTGTGTTTGGG - Intronic
1077352461 11:2099278-2099300 CTGGTGGGAGTTCTGGGTTCAGG - Intergenic
1079096418 11:17513320-17513342 CGGGGGTGAGCTCAGTGAACAGG - Intronic
1080871860 11:36243438-36243460 AGGGTGTGGACTCTGTCTTCTGG - Intergenic
1083197764 11:61099324-61099346 CTTGTGTGATCTCTGTGTTGTGG - Intergenic
1083198247 11:61103628-61103650 CGTGTGTGAGAACTGTGTTGGGG + Intronic
1083718883 11:64594217-64594239 CGGCTGTGCGCTGTGTGTGCGGG - Intronic
1089667369 11:120029121-120029143 GGAGTGTGAGCTCTGTGGCCAGG + Intergenic
1092490808 12:8943227-8943249 CAGGCGTGAGCCCTGTGTCCTGG + Intronic
1092612391 12:10186379-10186401 CGAGTGGGAGCTCTGGGATCTGG - Intronic
1101947206 12:109146572-109146594 CTGGTGGGAGGTCTGGGTTCAGG - Intronic
1103572814 12:121856485-121856507 CGTGGGTGGGCTCTGGGTTCAGG - Intronic
1107976229 13:45691219-45691241 TGGATGTGGGCTCTATGTTCTGG - Intergenic
1108791252 13:53971954-53971976 CAGGTCTGAGTTCTGTGTGCAGG + Intergenic
1110184314 13:72655676-72655698 TGAGTGTGTGCTCTGTGTCCAGG - Intergenic
1119430887 14:74567423-74567445 CGGGTGTGAGCCCAGTGCCCAGG - Intronic
1122815887 14:104313797-104313819 GGGGTGGGTGCTCTGTGTCCTGG + Intergenic
1122913282 14:104844029-104844051 CGGGTGTAAGTTCTGGGTCCCGG + Intergenic
1124023818 15:25946403-25946425 GGGGTGTGGGTTCTGTGTCCTGG - Intergenic
1127029054 15:54841295-54841317 AGGCTGAGAGCTCTGTGTTCTGG + Intergenic
1129651216 15:77491639-77491661 CGGCTGTGAGCGCAGTATTCTGG + Intergenic
1130411452 15:83652339-83652361 AGGCTGTGAGCTCAGTGTTCAGG + Intergenic
1132734048 16:1376889-1376911 CTGGTGCGAGGTCTGGGTTCAGG - Intronic
1134719350 16:16372102-16372124 CCGGGGTGAGCTCTGTGGGCCGG + Intergenic
1136478077 16:30525665-30525687 GGGTTTTGAGCTCAGTGTTCTGG + Exonic
1136616290 16:31400482-31400504 GGGGTGTGTGGCCTGTGTTCAGG - Intronic
1138214057 16:55187551-55187573 CGGGGCTGAGCTCTGAGTTCTGG - Intergenic
1141317061 16:82972295-82972317 TGGGTGTGAGAGCTGTGTTTGGG + Intronic
1141994151 16:87626344-87626366 CGGGTGGGAGTTGTGTGCTCAGG - Intronic
1142198612 16:88750572-88750594 CGGGTGGGAGCTGTGTGGTTGGG - Intronic
1144832190 17:18137975-18137997 AGGGGGTGAGCTCCCTGTTCTGG + Intronic
1144891940 17:18499376-18499398 CTGGTTTTAGGTCTGTGTTCAGG - Intergenic
1145140282 17:20444941-20444963 CTGGTTTTAGGTCTGTGTTCAGG + Intergenic
1145961207 17:28887459-28887481 TGGGTGTGAGGTCGGTGTCCTGG + Intronic
1148616052 17:48999854-48999876 GGGGTGAGAGCTTTGTGTTGAGG + Intronic
1150442645 17:65203673-65203695 CGGGTCAGACCTCTGGGTTCTGG + Intronic
1151321055 17:73352534-73352556 CGGGCGTGAGCTATGACTTCCGG - Exonic
1151766593 17:76136280-76136302 CAGGTGAGGGCTCAGTGTTCTGG - Intergenic
1152354512 17:79800229-79800251 CGGGAGGAAGCCCTGTGTTCCGG + Intronic
1152421129 17:80193747-80193769 CGTGTGTGCACTCAGTGTTCTGG - Intronic
1153271571 18:3327496-3327518 CTGGTGTGTTCTCTGTGTTCTGG - Intergenic
1153795268 18:8616160-8616182 CAGGTGTGAGCTTTGTGCCCAGG - Intronic
1158175045 18:54646327-54646349 GAGGTGGGAGTTCTGTGTTCTGG + Intergenic
1161076635 19:2288999-2289021 CAGATGTGAGTTCTGTGTTCTGG + Intronic
1161076653 19:2289161-2289183 CGGGTGTGAGCTCTGTGTTCCGG + Intronic
1161076656 19:2289181-2289203 CGGGTGTGAGCTGTGTGTCCCGG + Intronic
1161076660 19:2289201-2289223 CGGGTGTGAGCTGTGTTTCCCGG + Intronic
1161076664 19:2289221-2289243 CGGGTGTAAGCTGTGTGTCCCGG + Intronic
1161076668 19:2289241-2289263 CGGGTGTGAGCTGTGTGTTCTGG + Intronic
1161076673 19:2289283-2289305 TGGGTGTGAGCTGTGTGTCCCGG + Intronic
1161819075 19:6518057-6518079 TGGGTGTGCCCTTTGTGTTCTGG + Intergenic
1162132674 19:8536716-8536738 GGGGGGTGAGTTCTGTGGTCTGG + Intronic
1162481217 19:10928202-10928224 CGGGTTTGAGGTCTGAGTTCAGG + Intronic
1164022225 19:21318068-21318090 CAGCTGTGAGCTCTGTGCTTTGG - Intronic
1164575165 19:29401603-29401625 CCCCTGTGAGTTCTGTGTTCTGG - Intergenic
1166821622 19:45584082-45584104 CGGGGGTGAAGTCTGGGTTCTGG - Intronic
1167489075 19:49781541-49781563 AGGGTGTGTGCTCTGTGCTGTGG + Intronic
1167695383 19:51012610-51012632 CGGGGGTGACTTCTGTGTGCCGG + Intergenic
1168259642 19:55186205-55186227 CGGGTGAGAGATCTGAGTCCTGG - Exonic
926107579 2:10162072-10162094 CGGATGGGAGCTGTGGGTTCTGG - Intronic
926358441 2:12062863-12062885 CTGGGTTGACCTCTGTGTTCTGG + Intergenic
926671707 2:15582866-15582888 CGAGCCTGAGCTCTGTGTGCAGG + Intergenic
930742319 2:54844171-54844193 CGAGGGTGAGCTCTGGGCTCTGG + Exonic
932415535 2:71571507-71571529 TGGGTGTGAGCTGTGTGTGGTGG - Intronic
932415545 2:71571589-71571611 TGGGTGTGAGCTGTGTGTGCTGG - Intronic
932415561 2:71571792-71571814 TGGGTGTGAGCTGTGTGTGCTGG - Intronic
932415570 2:71571874-71571896 TGGGTGTGAGCTGTGTGTGCTGG - Intronic
932415623 2:71572306-71572328 TGGGTGTGATTTCTGTGTGCTGG - Intronic
935163300 2:100547998-100548020 TGAGTGGGTGCTCTGTGTTCTGG + Intergenic
938098254 2:128477211-128477233 AGGGTCTGAGCCCTGTGGTCAGG + Intergenic
940783605 2:157959086-157959108 CCAGTGGGAGCTCTGTGTTGGGG + Intronic
942571053 2:177314795-177314817 CATATCTGAGCTCTGTGTTCTGG - Intronic
1172222600 20:33283997-33284019 CGGGGTTCAGCTCTGTCTTCTGG + Intronic
1172987765 20:39006636-39006658 AGGGTGTGGGCTGTGTGTCCTGG + Intronic
1173565088 20:44032729-44032751 GGGGTGTGAGGTTTCTGTTCAGG - Intronic
1173920256 20:46739203-46739225 CGGGTGTGAGAGAGGTGTTCAGG + Intergenic
1174452985 20:50631149-50631171 GGGGTGAGAGGGCTGTGTTCAGG - Intronic
1175883565 20:62274605-62274627 CCAGAGTGAGCTCTGTGTGCTGG - Intronic
1179997939 21:44982445-44982467 CTGGAGTCAGCTCTGTGTGCAGG - Intergenic
1181035543 22:20168241-20168263 CGAGTCCCAGCTCTGTGTTCTGG + Intergenic
1181492265 22:23268003-23268025 AGGGGGTGACCTCTGTGTCCAGG + Intronic
1182358945 22:29735408-29735430 GGGGTCTGAGCCCTGTGCTCTGG - Intronic
1184412861 22:44335674-44335696 GGGGTGTGTGCTGTGTGTGCTGG + Intergenic
1185362339 22:50415837-50415859 CGTATGTAAGCTCTGTCTTCAGG - Intronic
950140706 3:10613216-10613238 TGTGTGGGAGCTCTGTGTTCAGG + Intronic
952262954 3:31758394-31758416 TGGCTGTGAACTCTGTTTTCAGG - Intronic
954630657 3:52046114-52046136 CAGGTGAGAGCACTGTGTCCTGG + Intergenic
954875663 3:53801499-53801521 CGGGTCTGTGCTCTGTGCTCTGG + Intronic
960128319 3:114025062-114025084 CAGGTCTTAGCACTGTGTTCTGG - Intronic
961464811 3:127074878-127074900 CTGGGCTGAGCTCTGTGGTCTGG + Intergenic
961464850 3:127075126-127075148 CTGGGTTGAGCTCTGTGGTCTGG + Intergenic
961760014 3:129160415-129160437 AGGGTGTGCTCTCTGTGGTCTGG - Intronic
965795652 3:172436179-172436201 AGCATGTGAGGTCTGTGTTCAGG - Intergenic
968191424 3:196670518-196670540 TGGGTGTGTGCTCTCTTTTCCGG + Intronic
969066445 4:4485658-4485680 CGTGTGTGAGCTCTGGGGTGAGG - Intronic
982657165 4:158164105-158164127 CATGTGTGAGTTCAGTGTTCTGG - Intronic
983887694 4:172998940-172998962 CTGGTGTGATTTCTGTCTTCTGG - Intronic
985959307 5:3287742-3287764 GGGGTCTGAGCTCTGGGTGCTGG - Intergenic
989113660 5:37930958-37930980 GGGGTGCGAGGTGTGTGTTCTGG + Intergenic
992409091 5:76487791-76487813 CAGCTTTGGGCTCTGTGTTCTGG - Intronic
995560510 5:113376008-113376030 CTGATGTGAACTCAGTGTTCTGG + Intronic
995843983 5:116473609-116473631 TGGGTGTGTGCTGTGTGTTGGGG + Intronic
997589107 5:135062200-135062222 CGAGAGTGAGCTGGGTGTTCAGG + Intronic
999642235 5:153683122-153683144 CAGGTCTGAGCTCTGGGATCTGG - Intronic
1002432777 5:179212800-179212822 CAGGTGTGGGCTCTGAGGTCAGG + Intronic
1002972120 6:2034428-2034450 TGGGTATGAGCTTTCTGTTCGGG + Intronic
1006094534 6:31647640-31647662 CAGGAGTGAGCTCCGGGTTCTGG + Exonic
1006308413 6:33239500-33239522 ATGGTGTGGACTCTGTGTTCTGG + Intergenic
1007177284 6:39905646-39905668 CAGGTGTGGGCTGTGTGGTCTGG + Exonic
1010017946 6:71126061-71126083 TGGGTGAGAGCTCTGTGGTGGGG + Intergenic
1012051994 6:94358555-94358577 GGGGTGTGAGCTCTCTTCTCAGG - Intergenic
1015065828 6:129025713-129025735 ATGATGTGAGCTCTGTGGTCTGG + Intronic
1016051402 6:139534203-139534225 CTGGTGGGAGCTGCGTGTTCTGG + Intergenic
1016663088 6:146604004-146604026 CTGGTGTGAGCTATGTGAACTGG - Intronic
1016728336 6:147400905-147400927 CTAGTGGGAGCTCTGTGTTGGGG + Intergenic
1019054534 6:169213715-169213737 CGGGTGTCAGCCCTGTGCCCAGG - Intergenic
1019132928 6:169890611-169890633 CAGGTGTGAGCTCTCTGTCCAGG - Intergenic
1019171395 6:170135132-170135154 CGGGTGTGTGATTTGTGTTCTGG - Intergenic
1019281841 7:204518-204540 GGGGTGTGAGCTGTGAGCTCAGG + Intronic
1020100931 7:5394075-5394097 CCGGAGTGAGCCCTGAGTTCAGG - Intronic
1021284086 7:18757728-18757750 CGTGTGTGTGCTCTGTGTGTGGG + Intronic
1023499858 7:40836174-40836196 CAGATGTGAGCCCTGTGCTCAGG + Intronic
1025791104 7:64687464-64687486 CAGGTGTGAGCTGTGTGCTGGGG + Intronic
1026207217 7:68268356-68268378 AGGGTGAGGTCTCTGTGTTCCGG + Intergenic
1026443143 7:70460956-70460978 CAGGTGTGAGCCCTGGGTTTGGG + Intronic
1030305398 7:108013207-108013229 CAGGTGCCAGCTCTGTGTTTAGG - Intergenic
1031988760 7:128181661-128181683 CATGTGGGAGCTGTGTGTTCTGG - Intergenic
1032083338 7:128870666-128870688 CGGGAGTGAGCTTTCTTTTCTGG + Intronic
1033910728 7:146260305-146260327 CAGGTGGGGACTCTGTGTTCAGG - Intronic
1036227540 8:6972155-6972177 CTGGAGTGTGCTCTGTGTGCAGG - Intergenic
1036229998 8:6991315-6991337 CTGGAGTGTGCTCTGTGTGCAGG - Intergenic
1036232450 8:7010418-7010440 CTGGAGTGTGCTCTGTGTGCAGG - Intronic
1036788093 8:11701398-11701420 CGGGTGGGTGCTCTGAGGTCCGG - Intronic
1038416120 8:27397295-27397317 GGGGTATGAGCTCTGTCTCCTGG - Intronic
1041299518 8:56396418-56396440 AGGGTGTGAGCTATTAGTTCAGG - Intergenic
1046016353 8:108609938-108609960 CTGTTCTGAGCTCTGTGTTAGGG - Intronic
1047443342 8:124898816-124898838 CAGGTGTGCTCTCTTTGTTCAGG + Intergenic
1047443343 8:124898835-124898857 CAGGTGTGCTCTCTTTGTTCAGG + Intergenic
1049566418 8:143341444-143341466 ATGGTGTGTGCTCTCTGTTCTGG - Intronic
1049598786 8:143497675-143497697 CAGGTGTGACATCTGTGTTCAGG - Intronic
1055621137 9:78126149-78126171 AGGGAGTGAGCCCTGTGGTCAGG - Intergenic
1060440414 9:123633309-123633331 CGTGTGTGTGTTGTGTGTTCTGG - Intronic
1060780314 9:126407378-126407400 CGAGTGGGAGCTCTGTGTGCTGG + Intronic
1062078118 9:134603138-134603160 AGGGGGTCAGCTCCGTGTTCTGG + Intergenic
1189460905 X:41242154-41242176 GGCGTGTGAGCTCTGTGTTCTGG + Intergenic
1193135036 X:77961540-77961562 CAAGTCTGAGTTCTGTGTTCTGG + Intronic
1193723777 X:85017383-85017405 CAGGTCTGAGCTCTGTGCACAGG - Intronic
1200918308 Y:8590817-8590839 CGGGTCTGAGCTATGAGCTCTGG + Intergenic