ID: 1161079567

View in Genome Browser
Species Human (GRCh38)
Location 19:2303790-2303812
Sequence CTGTGGCCAATGATGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 280}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161079564_1161079567 -10 Left 1161079564 19:2303777-2303799 CCCACACGCAGAGCTGTGGCCAA No data
Right 1161079567 19:2303790-2303812 CTGTGGCCAATGATGGAGCATGG 0: 1
1: 0
2: 0
3: 23
4: 280
1161079558_1161079567 7 Left 1161079558 19:2303760-2303782 CCCTCTCCACCCGGTTACCCACA 0: 1
1: 0
2: 3
3: 13
4: 142
Right 1161079567 19:2303790-2303812 CTGTGGCCAATGATGGAGCATGG 0: 1
1: 0
2: 0
3: 23
4: 280
1161079559_1161079567 6 Left 1161079559 19:2303761-2303783 CCTCTCCACCCGGTTACCCACAC 0: 1
1: 1
2: 1
3: 10
4: 197
Right 1161079567 19:2303790-2303812 CTGTGGCCAATGATGGAGCATGG 0: 1
1: 0
2: 0
3: 23
4: 280
1161079560_1161079567 1 Left 1161079560 19:2303766-2303788 CCACCCGGTTACCCACACGCAGA 0: 1
1: 0
2: 0
3: 9
4: 61
Right 1161079567 19:2303790-2303812 CTGTGGCCAATGATGGAGCATGG 0: 1
1: 0
2: 0
3: 23
4: 280
1161079561_1161079567 -2 Left 1161079561 19:2303769-2303791 CCCGGTTACCCACACGCAGAGCT 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1161079567 19:2303790-2303812 CTGTGGCCAATGATGGAGCATGG 0: 1
1: 0
2: 0
3: 23
4: 280
1161079562_1161079567 -3 Left 1161079562 19:2303770-2303792 CCGGTTACCCACACGCAGAGCTG 0: 1
1: 0
2: 0
3: 16
4: 136
Right 1161079567 19:2303790-2303812 CTGTGGCCAATGATGGAGCATGG 0: 1
1: 0
2: 0
3: 23
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161079567 Original CRISPR CTGTGGCCAATGATGGAGCA TGG Intronic
900531647 1:3156742-3156764 CTGTGGCCACTGCTTGAGCCGGG - Intronic
900946467 1:5833955-5833977 CTGTGGTCAGTGGCGGAGCAGGG - Intergenic
902088256 1:13879861-13879883 CTGTCGCCCAGGCTGGAGCACGG - Intergenic
902907316 1:19567920-19567942 CTGTTGCCCAGGGTGGAGCATGG - Intergenic
903735872 1:25529761-25529783 CTGAGGCCCATGGTGGAGCCAGG - Intergenic
904494349 1:30878284-30878306 CTGTGGCCAATGGTGGGGTTAGG - Intronic
905600780 1:39248762-39248784 CTGTCGCCTATGCTGGAGTATGG + Intronic
905802599 1:40854778-40854800 GTGTGGCCAGGGATGGAGCAGGG + Intergenic
907433581 1:54429608-54429630 CTGTTGCCCAGGCTGGAGCATGG + Intergenic
907525815 1:55053387-55053409 CTGTGGCCAGACATTGAGCAAGG + Intronic
907617986 1:55944220-55944242 CTGTAGCCAAAAATGGAGAAAGG + Intergenic
907715732 1:56924273-56924295 CAATGGCCAATGATGGATGAAGG + Intergenic
907797086 1:57728555-57728577 CTGTGGCCCAGGCTGGAGTACGG - Intronic
908618466 1:65949331-65949353 CTGTAGCAAATGATGGAGGAAGG - Intronic
909764151 1:79333893-79333915 AGGTAGCCAATGATGTAGCAGGG + Intergenic
910202558 1:84714339-84714361 GTGATGCCAATGAGGGAGCAAGG + Intergenic
911475352 1:98366751-98366773 TCGTGGCCCATGATGTAGCAAGG + Intergenic
913196715 1:116462856-116462878 CTGTGGCCAGGGATGGGTCATGG - Intergenic
916529631 1:165644019-165644041 CTGTTGCCAAGGCTGGAGTATGG - Intronic
916626651 1:166565335-166565357 CTATGGAGAAAGATGGAGCAGGG - Intergenic
917982052 1:180275834-180275856 CTCTGGCCAGTGGTGGTGCAGGG + Exonic
919984636 1:202664336-202664358 ATGAGGCCAATGATGGAGACTGG - Intronic
923211717 1:231809296-231809318 CTCTGGCCAGTGAGGGAGCCTGG + Intronic
924394380 1:243603537-243603559 CAGTGGCCAAGGATGGTGCCTGG - Intronic
924446838 1:244140671-244140693 AAGTGGACAATGATGGAGGATGG - Intergenic
924528296 1:244871324-244871346 CTGTGGCCCAGGCTGGAGTACGG - Intergenic
1062769621 10:88452-88474 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1063477195 10:6339685-6339707 CAGTGTCCACTGATGGAGAATGG + Intergenic
1063970418 10:11377895-11377917 CTGTGGCCCAGGCTGGAGTACGG + Intergenic
1064086888 10:12351671-12351693 CTGTGGCTCCTGCTGGAGCATGG + Intronic
1066389066 10:34964304-34964326 GTGTGGCTAAAGAGGGAGCAAGG + Intergenic
1068200097 10:53773427-53773449 CTGTCGCCCAGGCTGGAGCACGG + Intergenic
1071119854 10:82264659-82264681 ATGTTGCCAATGAAGGAGCAGGG + Intronic
1073576609 10:104631238-104631260 CCAGGGCCAATGATGGGGCAGGG - Intergenic
1075751052 10:124771525-124771547 CTGTAGCCCGTGATGGATCAAGG - Intronic
1076301802 10:129433806-129433828 CTGTGGCCAAAAGTGGAGGAGGG - Intergenic
1076579013 10:131494500-131494522 GTGTGCCCAGTGTTGGAGCAGGG + Intergenic
1076849857 10:133087426-133087448 CTGTGGCCCAGGATGCAGGAGGG + Intronic
1077169654 11:1160533-1160555 CTGCGGCCACAGATGCAGCATGG - Intronic
1077533630 11:3108538-3108560 CTGTGGGCAGCGGTGGAGCAGGG + Intronic
1080688304 11:34534271-34534293 CACTGGCCAATGATGGTGCTAGG - Intergenic
1083108125 11:60378017-60378039 ATGAGGCCAAAGATGGAGAATGG + Intronic
1083702325 11:64487558-64487580 CTGTGGCCATTCGTGGACCAGGG - Intergenic
1084272189 11:68035030-68035052 CTGTGGCCCAGGATGGAGTATGG - Intronic
1084690032 11:70719753-70719775 CCGTGTCAAATGCTGGAGCAGGG - Intronic
1084970863 11:72771391-72771413 CTGAGTCCAAAGATGGGGCAAGG - Intronic
1085664259 11:78399421-78399443 CTGGGGCCAATGTTTGAGAATGG - Intronic
1085689361 11:78652911-78652933 GTGTGCCCAGTGGTGGAGCAAGG + Exonic
1087335817 11:96843004-96843026 CTGAAGTCAATGAGGGAGCATGG - Intergenic
1089340596 11:117754766-117754788 CTATGGCCAAAGAGGCAGCACGG - Intronic
1090026367 11:123170824-123170846 CTGTGACCAAGGAGGCAGCAGGG - Intronic
1090479855 11:127058629-127058651 ATGTGGCCAAAGAGGGAGCAGGG - Intergenic
1090766462 11:129880331-129880353 CTGTGGGGAATGAAGGAGAATGG - Intronic
1091934164 12:4422324-4422346 TTCTGGCAAAAGATGGAGCAGGG + Intergenic
1092189034 12:6504427-6504449 CTGTGGCCCAGGATGGAGTGTGG + Intronic
1093225582 12:16479568-16479590 CTGTGGCCCATGCTGGAGTAAGG + Intronic
1093276313 12:17132495-17132517 CTGTGGGCCATGACGGAGGAGGG + Intergenic
1095489266 12:42716185-42716207 CACTGGCAAATGATGGAGCCAGG - Intergenic
1096883077 12:54688344-54688366 CAGTGTCCAGTGAGGGAGCAAGG + Intergenic
1101528025 12:105549336-105549358 CTGAGTCCAGTGATGGACCATGG + Intergenic
1103637212 12:122317443-122317465 CGTGGGCCAATGATGGAGCCAGG - Intronic
1103706490 12:122876910-122876932 CTGTGGCCAATGCTGGGTCAAGG + Intronic
1106125791 13:26899042-26899064 CTGAGACTAAGGATGGAGCATGG + Intergenic
1107464410 13:40636176-40636198 CTGTGGCCCAGGTTGGAGTAGGG - Intronic
1109599837 13:64611095-64611117 CTGTTGCCCAGGATGGAGCACGG + Intergenic
1111731300 13:92080206-92080228 CTGTGGAGAACGATGGTGCAGGG - Intronic
1114618165 14:24079479-24079501 CAGTGGCCAATGGTGGGGAAGGG + Intergenic
1115645518 14:35366387-35366409 CTGTGGCCCATGATGGAGTCAGG + Intergenic
1118367631 14:65109228-65109250 CTGTGGCTACTGGTGGAGAATGG - Intergenic
1118590404 14:67396670-67396692 ATGTGGGCAAAGATGGAACAAGG - Intronic
1118862766 14:69677508-69677530 CTGTGGCCCAGGCTGGAGCGCGG - Intronic
1119323325 14:73744290-73744312 CTGTGGCCACTGTGGGACCAGGG + Intronic
1119615207 14:76094432-76094454 CAGTGGCCCATGCCGGAGCAAGG + Intergenic
1120052379 14:79882250-79882272 CTTTGGCCAAGGATGCAACATGG + Intergenic
1120052607 14:79884623-79884645 CTCTGGCCTATTATGAAGCAAGG + Intergenic
1121236302 14:92393580-92393602 CTGTCGCCCAGGATGGAGTATGG + Intronic
1121799239 14:96759680-96759702 CAGTGGTCAATTATGTAGCATGG - Intergenic
1122889386 14:104725385-104725407 CTGCTGCCAATAATGGAACAAGG + Intronic
1202843258 14_GL000009v2_random:143766-143788 CTGTTGCCCAGGATGGAGCATGG - Intergenic
1202912656 14_GL000194v1_random:134017-134039 CTGTTGCCCAGGATGGAGTATGG - Intergenic
1202879982 14_KI270722v1_random:48647-48669 CTGTTGCCCAGGATGGAGTATGG + Intergenic
1124634063 15:31353764-31353786 CTGTGGCCAAGCCTGGGGCAGGG + Intronic
1125583048 15:40800919-40800941 CTGTCGCCCAGGCTGGAGCATGG - Intronic
1126489936 15:49225712-49225734 CTGTAGCCAGTGCTAGAGCAGGG - Intronic
1126967333 15:54069867-54069889 CTGTGGCCAAGGAAAGAGAAAGG - Intronic
1127962299 15:63898840-63898862 TTTTGGCCAGTGATTGAGCATGG - Intergenic
1127974706 15:63988539-63988561 CTGTTGCCCAGGATGGAGTACGG + Intronic
1128084053 15:64873836-64873858 CTGTGGCCCAGGCTGGAGCCAGG + Intronic
1129858862 15:78844645-78844667 CTGTGGCCAGTGAATGAGGATGG - Intronic
1129964103 15:79718449-79718471 ATGTGGTTAATGGTGGAGCAAGG + Intergenic
1130194777 15:81769041-81769063 CTTTAGGCAATGATGGAACATGG - Intergenic
1132071449 15:98780062-98780084 TTGTGGCCAAGAATGGAGCCAGG + Intronic
1132080661 15:98862209-98862231 CTGTAGCAGATGATAGAGCAGGG + Intronic
1132458753 16:38998-39020 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1134428275 16:14174644-14174666 CTGTGGCCCAGGATGGAGTGTGG - Intronic
1135687300 16:24508057-24508079 CTGTGGCCCAGGCTGGAGTACGG - Intergenic
1136990647 16:35149397-35149419 CTATAGACAATGAAGGAGCAGGG - Intergenic
1139352863 16:66348169-66348191 CCATGTCCAATGAAGGAGCAAGG + Intergenic
1139592727 16:67942497-67942519 CTGTGGCCAATGAGGAAGACAGG + Exonic
1142037305 16:87869875-87869897 CTGAGGCCAAGGATGGAGTTTGG + Intergenic
1142413552 16:89928559-89928581 CTGTTGCCCAGGCTGGAGCACGG + Intronic
1142734205 17:1884636-1884658 CTGTTGACAATGATGGATAAGGG - Intronic
1143211995 17:5195219-5195241 CTGTGGCCCACGCTGGAGTATGG + Intergenic
1143224310 17:5287560-5287582 CTGTTGCCCAGGCTGGAGCACGG - Intronic
1144534733 17:16077365-16077387 CTGTTGCCCAGGCTGGAGCATGG - Intronic
1144823025 17:18088641-18088663 CTGTGTACTAAGATGGAGCAGGG - Intronic
1145231162 17:21174376-21174398 CTGTGGCTAAAGCTGGAGGAAGG - Intronic
1145816591 17:27799192-27799214 CTGTGGCCAGTGATGAAGCCTGG - Intronic
1146409140 17:32566984-32567006 CTGTGAACATGGATGGAGCACGG - Intronic
1146506601 17:33411105-33411127 CTGTGGCCATTCATGCATCATGG - Intronic
1147036141 17:37682572-37682594 CTGTGGCCCAGGCTGGAGTACGG - Intergenic
1147767685 17:42847815-42847837 CTGTTGCCCAGGCTGGAGCACGG + Intronic
1148642828 17:49201123-49201145 CTGTGGGAAATGAGGGAGAAGGG + Intergenic
1149928977 17:60730939-60730961 CTGTGGCCACTCATGTAGCTAGG + Intronic
1150865264 17:68842514-68842536 CTGTGGTCAATGATAGAGGTAGG + Intergenic
1151405926 17:73886153-73886175 GTGTGGCCTGAGATGGAGCATGG - Intergenic
1152451520 17:80384261-80384283 CTGTCCACAATGCTGGAGCATGG + Intronic
1152687963 17:81703805-81703827 CTGAGGCCAAGGGAGGAGCAGGG - Intronic
1152962686 18:89242-89264 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1157172714 18:45422700-45422722 CTGGCTCCATTGATGGAGCAGGG - Intronic
1157863211 18:51160093-51160115 CTGTGGCCAGTGAGAAAGCACGG + Intergenic
1159592531 18:70350996-70351018 CTGTTGCCCAGGCTGGAGCATGG + Intronic
1159914881 18:74180056-74180078 CTGTGGCCAGTGCTGGATTAGGG - Intergenic
1161079567 19:2303790-2303812 CTGTGGCCAATGATGGAGCATGG + Intronic
1161663908 19:5563485-5563507 CTGTTCCCACTAATGGAGCAGGG + Intergenic
1162339342 19:10082672-10082694 CTGTGTTCAATTATGGAGGAAGG - Intergenic
1162369029 19:10268078-10268100 ATGTGGCCCAGGATGGAGTAGGG + Intergenic
1162522715 19:11191471-11191493 CTGTGGCCTTTGAGGGAGGAAGG - Intronic
1162853722 19:13451886-13451908 CTGTTGCCCAGGCTGGAGCACGG + Intronic
1163706967 19:18820243-18820265 CTGTTGCCCAGGCTGGAGCACGG + Intergenic
1163726728 19:18927336-18927358 CTGTCGCCCATGCTGGAGCGTGG - Intronic
1164714267 19:30379998-30380020 AGCTGGCCAGTGATGGAGCAGGG + Intronic
1164770880 19:30808032-30808054 GTGAGGCCAATGATGGAGAAGGG - Intergenic
1164983324 19:32630357-32630379 CTGTGGCCAGTGTCTGAGCAGGG + Intronic
1165569021 19:36759436-36759458 CTGTTGCCCATGCTGGAGTACGG - Intronic
1166144154 19:40822874-40822896 CTGTGCCCAAGAATGGAGAATGG - Intronic
1166286959 19:41837042-41837064 CTGTGGTCCATGAGAGAGCAGGG - Intergenic
1168009439 19:53518896-53518918 CTGTGGCCATAAAAGGAGCAAGG - Intergenic
1168504375 19:56920926-56920948 CTGGGGCCTATGGTGGAGGATGG + Intergenic
1202655600 1_KI270708v1_random:17738-17760 CTGTTGCCCAGGATGGAGTATGG + Intergenic
925059008 2:876612-876634 CTGAGGCCCATCAAGGAGCAGGG - Intergenic
926299502 2:11592447-11592469 GTGTGGCCAAAGAGTGAGCAAGG + Intronic
928298716 2:30107299-30107321 CTGTTGCCCAGGCTGGAGCATGG - Intergenic
930418674 2:51121543-51121565 CTGTAGCCAATGTTTGATCAGGG + Intergenic
930440982 2:51405598-51405620 CTGTGGCCTAGGCTGGAGTATGG + Intergenic
930865913 2:56121702-56121724 CTGTTGTCAAGGATGGAACAAGG + Intergenic
930951121 2:57145557-57145579 CAGTGGCCAATGGTGGTGGATGG - Intergenic
932542029 2:72664979-72665001 CTGTGGCCAATCCTTGAGCAGGG + Intronic
935443972 2:103137207-103137229 CTCTGGCCAATGAGGCAGAAGGG - Intergenic
935607841 2:104988404-104988426 CTGTGGACAAGGATGGCACATGG + Intergenic
937452365 2:122012219-122012241 ATGTGGCCACTGGTGGAGCTGGG + Intergenic
937859743 2:126698305-126698327 CTGGGCCCAATGAGGGAGAAAGG - Intergenic
937983663 2:127629023-127629045 CTGTGGGCTATGGGGGAGCATGG + Intronic
939566421 2:143791016-143791038 CTGGGGCCAATGATGGATTGAGG + Intergenic
939616202 2:144364457-144364479 CTGTTGCCCAGGTTGGAGCATGG + Intergenic
941828137 2:169922247-169922269 CTGTGGCCCAGGGTGGAGTATGG - Intronic
942068614 2:172295306-172295328 CTTTGACCAATGAGGAAGCAGGG + Intergenic
947635638 2:231679545-231679567 CTGTCGCCCAGGCTGGAGCACGG + Intergenic
947753031 2:232542579-232542601 CTGTGGTCAAGGCTGGACCAAGG + Intronic
948547804 2:238745295-238745317 GTGTGGGCAATGATGGAGGGTGG - Intergenic
948571445 2:238920295-238920317 CTGAGGCCACTGTGGGAGCATGG - Intergenic
1169123410 20:3110630-3110652 AGGTGGCCAAGGCTGGAGCAAGG + Intronic
1169142229 20:3233166-3233188 GTGTGGCCCAGGAAGGAGCAGGG + Intronic
1169342248 20:4805354-4805376 CTGTGGACGAAGATGGAGGAAGG + Intronic
1173013122 20:39200413-39200435 GAGTGGCCACTGATGGAGTACGG + Intergenic
1175190289 20:57207362-57207384 CTGTAGTCACTGATGGAGCTAGG - Intronic
1176204971 20:63883337-63883359 CTGGGGCCAAGGAGTGAGCAGGG + Intronic
1176632016 21:9148689-9148711 CTGTTGCCCAGGATGGAGTATGG - Intergenic
1176641286 21:9306169-9306191 CTGTTGCCCAGGATGGAGTATGG + Intergenic
1178285335 21:31321113-31321135 CTGTGGCCCAGGCTGGAGCGCGG - Intronic
1178679440 21:34660152-34660174 CAGGTGCCAATGATGGGGCAGGG - Intergenic
1180350305 22:11795526-11795548 CTGTTGCCCAGGATGGAGTATGG + Intergenic
1180374593 22:12078962-12078984 CTGTTGCCCAGGATGGAGTATGG + Intergenic
1180387909 22:12196541-12196563 CTGTTGCCCAGGATGGAGTATGG - Intergenic
1180785887 22:18547564-18547586 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1181045682 22:20213199-20213221 CTGTGGCCAATGGTGGACTTTGG - Intergenic
1181131173 22:20733289-20733311 CTGTGGGCAGTGAGGGAGGAGGG - Intronic
1181242812 22:21487118-21487140 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1181552336 22:23647705-23647727 CTGTTGCCTAGGCTGGAGCACGG + Intergenic
1181830378 22:25555715-25555737 TTGGGGCCAGTGTTGGAGCATGG - Intergenic
1181969058 22:26676484-26676506 CTGTGGCCTATGAAGCAGAAGGG + Intergenic
1182849637 22:33461249-33461271 CTGTGGCCCAGGCTGGAGCATGG - Intronic
1183050974 22:35260903-35260925 CTGTGGACAATACTGAAGCATGG - Intronic
1183231263 22:36583628-36583650 GGGTGGCCACTGATGGGGCATGG - Intronic
1183378067 22:37476600-37476622 CAGTGGCCAATGGTGTAGTAAGG - Intronic
1185146660 22:49140898-49140920 CTGTGGCTGATGGAGGAGCATGG + Intergenic
949630124 3:5917287-5917309 CTGTGGCAAATTATGGCCCATGG + Intergenic
950017721 3:9765970-9765992 CTGTGACCACTGCTGGACCAAGG + Exonic
950294567 3:11817679-11817701 CTGTGGCCAATGAAGGAGATAGG + Intronic
951186970 3:19724393-19724415 CTGTGTCCTATAATGGAGAAGGG + Intergenic
951612234 3:24503297-24503319 ATGTGGTAAATCATGGAGCAGGG - Intergenic
953332450 3:42065213-42065235 CTGTGGCCCAGGATGGAGTGCGG - Intronic
953697800 3:45173279-45173301 ATGTGGCCAGTGATGGAGGCTGG + Intergenic
953909075 3:46882825-46882847 CTCTGGCCAAGGATGGGGAAGGG + Intronic
954385826 3:50243279-50243301 CTGTGGCCAAAGAAGGGGCCTGG - Intronic
956519520 3:70088300-70088322 CTATGCCCAACCATGGAGCAGGG + Intergenic
956849549 3:73216452-73216474 CTGTGGCCAGTAATAGAGCTGGG + Intergenic
957922203 3:86760184-86760206 CCGTGGCCCATGCTGGAGCCTGG + Intergenic
958707861 3:97678449-97678471 CTGTGGTGAATGACAGAGCAGGG + Intronic
959156821 3:102676867-102676889 TTGTTGCAAATGTTGGAGCAAGG + Intergenic
959273807 3:104250204-104250226 GTGTGGAAATTGATGGAGCAAGG - Intergenic
959805936 3:110553774-110553796 CTGTGGCCAAGATTGGAGCGGGG - Intergenic
959979695 3:112502283-112502305 TTGCATCCAATGATGGAGCAAGG + Intergenic
960797916 3:121507888-121507910 CTGTCACCAAGGCTGGAGCATGG + Intronic
962159471 3:132983828-132983850 CTGTCGCCCAGGCTGGAGCACGG + Intergenic
963152916 3:142065546-142065568 CTGTCGCCTAGGCTGGAGCAGGG + Intronic
965259789 3:166467400-166467422 CTGTGGCCAATGATTGGGTCGGG + Intergenic
966707397 3:182931318-182931340 CTGTTGCCCAGGCTGGAGCACGG - Intergenic
967295356 3:187958897-187958919 CTGTGGCCTTTGATGGAGCCAGG + Intergenic
967890541 3:194361385-194361407 CCGTGGCCAATGATGGAGACTGG - Intronic
968215738 3:196888545-196888567 CTGTCGCCCAGGCTGGAGCACGG - Intronic
1202745609 3_GL000221v1_random:98853-98875 CTGTTGCCCAGGATGGAGTATGG - Intergenic
968602824 4:1518404-1518426 CTGTGGCCAGTGAAGGAGGCCGG + Intergenic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
970959354 4:21855001-21855023 CAGGGGCAAATGATAGAGCAGGG - Intronic
971210812 4:24614364-24614386 CTGTTGCCCAGGCTGGAGCATGG - Intergenic
973027661 4:45293166-45293188 CTGTGGGCAGTGTTGGTGCAAGG + Intergenic
973061918 4:45737227-45737249 CTGTTGCCCATGATGGAGTGCGG + Intergenic
973720801 4:53721471-53721493 CTGTGGTCAATGCTGGATTAAGG + Intronic
973816596 4:54625156-54625178 CTGTTGCCCAGGCTGGAGCATGG + Intergenic
978434152 4:108665482-108665504 CTGTTGCCCAGGCTGGAGCACGG + Intronic
981392144 4:144203496-144203518 CTTTGGCCTATGATGTAGCTGGG + Intergenic
982234745 4:153242026-153242048 CTGAGGCCCATTATGGAACAGGG + Intronic
1202756178 4_GL000008v2_random:64404-64426 CTGTTGCCCAGGATGGAGTATGG + Intergenic
986532069 5:8747999-8748021 CTCTGGAGAATGGTGGAGCAGGG + Intergenic
986910561 5:12550355-12550377 CTGTTGCCCATGCTGGAGTACGG + Intergenic
987209812 5:15669435-15669457 GCGTGGCCAATGATTGATCATGG + Intronic
988889451 5:35599016-35599038 CTGTGGCCACTGAGGGGGAAGGG - Intergenic
989112758 5:37923221-37923243 CTGTGGCAAAGTATGGAGAATGG - Intergenic
990714273 5:58619245-58619267 CTTTGGGGAATGATGGAGCAGGG - Intronic
991771600 5:70046148-70046170 CTGTTGCCCAGGCTGGAGCACGG + Intergenic
991850892 5:70921566-70921588 CTGTTGCCCAGGCTGGAGCACGG + Intergenic
995797125 5:115953378-115953400 CACTGGCCAATGATGTAGCTTGG - Intergenic
995837201 5:116410696-116410718 CTGTGGCCAATGCTGGTGAGAGG - Intronic
998190151 5:140016849-140016871 CTGTGGCCAAGGGTGGAGTGTGG + Intronic
999389611 5:151180613-151180635 CTGTGGCCAGGGAGGGAGCTAGG - Intergenic
1000586951 5:163112212-163112234 CTGAGGCCAATGACTGAACACGG + Intergenic
1001392967 5:171395141-171395163 CTGTTGCCCAGGATGGAACACGG - Intronic
1001520294 5:172386665-172386687 CTGTGGCCCAGGCTGTAGCACGG + Intronic
1001527026 5:172436393-172436415 CTGTGGCCGGTGAAGGAGCCCGG - Intronic
1002886413 6:1299285-1299307 CTGGGGCTAAGGATGGGGCAGGG + Intergenic
1003864164 6:10348408-10348430 CTGTGGCAAATGAAGCAGAAGGG + Intergenic
1008588260 6:52968615-52968637 CTGTGGGAAATGAAGAAGCAGGG + Intergenic
1009412914 6:63387062-63387084 CTGTTGCCCAGGCTGGAGCACGG - Intergenic
1011750235 6:90448027-90448049 CTGTGGCCCAGGCTGGATCATGG + Intergenic
1014000769 6:116363930-116363952 TTTTGGCCAATGATTCAGCAAGG + Intronic
1014031029 6:116704623-116704645 CTGTTGCCCAAGGTGGAGCAAGG + Intronic
1015399666 6:132774872-132774894 CTGTTGCCCAGGATGGAGTACGG - Intronic
1016295024 6:142564780-142564802 CTGTGGCCAGGGATGGCTCAAGG - Intergenic
1018088926 6:160329126-160329148 CAGTGGCCAATGCTGGAGCTGGG + Intergenic
1019275449 7:173269-173291 CTGTGTCCACAGATGGGGCAGGG + Intergenic
1019699644 7:2468443-2468465 CTGTGGCCAATGTCAGTGCAGGG - Intergenic
1020098264 7:5380407-5380429 CTGTGGCCTAGGCTGGAGTATGG - Intronic
1021614910 7:22492280-22492302 CTGTTGCCCATGCTGGAGTATGG - Intronic
1022469027 7:30670629-30670651 CTGTGGCCAATGAGGGCACTGGG + Intronic
1026476325 7:70739060-70739082 CTGTTGCCCAGGCTGGAGCACGG + Intronic
1026480122 7:70771526-70771548 CTGTGGCCAAAGACGGAGAGGGG - Intronic
1026853220 7:73737602-73737624 CTGTGGCCAACGACGACGCAGGG + Exonic
1027523942 7:79244399-79244421 AGGTGGCCAATGCTGGAGGATGG - Intronic
1027578599 7:79962953-79962975 CTGTGGTAAATGTTGGAGCCAGG - Intergenic
1029442753 7:100596240-100596262 CTGTGGCCCAGGCTGGAGTAGGG - Intronic
1029820880 7:103145729-103145751 CTCTGGCTGATGATGGAGCCTGG + Intronic
1030187729 7:106779972-106779994 CTGTGGGAAAAGAGGGAGCATGG - Intergenic
1034061627 7:148097019-148097041 CTGTGCCCATTCCTGGAGCATGG - Intronic
1034319790 7:150169344-150169366 CTGTTGCCCAGGCTGGAGCACGG - Intergenic
1036625047 8:10463639-10463661 CTGAGGCCAATGCTGGTGCCAGG - Intergenic
1039187738 8:34935498-34935520 CTGTTGCCCAGGCTGGAGCACGG - Intergenic
1039811104 8:41049102-41049124 CTGTTGCTATTGAAGGAGCATGG + Intergenic
1042182833 8:66109131-66109153 CTCTGGCCAATGACTGAGCAAGG + Intergenic
1045282130 8:100758366-100758388 CTGTGTCTGGTGATGGAGCAAGG - Intergenic
1047706800 8:127507160-127507182 CTGTTGCCTAAGCTGGAGCATGG - Intergenic
1048438994 8:134445903-134445925 CTGTGGCTAATGATGAGGGAAGG + Intergenic
1049468997 8:142766989-142767011 CTGTTGCCAAAGGTGGAGAAGGG + Intronic
1049621565 8:143600593-143600615 CTGTGGCTGATGAGGAAGCAGGG - Exonic
1051872046 9:21749290-21749312 CTCTGGCCAAAAATTGAGCAAGG - Intergenic
1053318928 9:37078449-37078471 CTGTCACCCAGGATGGAGCACGG + Intergenic
1055912038 9:81364094-81364116 CTGTGGGCTATGTGGGAGCAGGG + Intergenic
1056658373 9:88527051-88527073 CTGCTGCCAATGCTGGAGCAGGG + Intergenic
1057228025 9:93302667-93302689 CTGTGCCCAGGGATAGAGCAGGG + Intronic
1057602182 9:96468117-96468139 CTGTTGCCCATGCTGGAGTATGG + Intronic
1059152028 9:111957521-111957543 CTGTAGTCAATGACTGAGCACGG + Intergenic
1060955236 9:127634132-127634154 TTGGGGCCAAAGATCGAGCACGG - Intronic
1061129067 9:128697620-128697642 CTGTGGCCCAGGCTGAAGCACGG - Intergenic
1061347114 9:130035302-130035324 CTCTGGCCAATGATAAAGGAAGG + Intronic
1062356861 9:136169201-136169223 CTGTGGCCAAGGAGGGGGCAAGG + Intergenic
1062735454 9:138134875-138134897 CTGTGGCCAAGGATGGGGGAAGG + Intergenic
1203687777 Un_GL000214v1:11455-11477 CTGTTGCCCAGGATGGAGTATGG + Intergenic
1203754842 Un_GL000218v1:116300-116322 CTGTTGCCCAGGATGGAGTATGG - Intergenic
1203355573 Un_KI270442v1:136711-136733 TTGTGGCCTATGATGGAAAAGGG - Intergenic
1203374901 Un_KI270442v1:361504-361526 TTGTGGCCAATGGTGGAAAAGGG + Intergenic
1203714229 Un_KI270742v1:128803-128825 CTGTTGCCCAGGATGGAGTATGG - Intergenic
1203536981 Un_KI270743v1:49260-49282 CTGTTGCCCAGGATGGAGTATGG + Intergenic
1203648498 Un_KI270751v1:92598-92620 CTGTTGCCCAGGATGGAGTATGG - Intergenic
1187480091 X:19647638-19647660 CTATGGCCCATGAAGGAGAAGGG - Intronic
1187627124 X:21128103-21128125 CTGTTGCCCAGGATGGAGTATGG + Intergenic
1188530125 X:31130923-31130945 CTGTGGGCAATTATCTAGCAGGG + Intronic
1190341933 X:49303853-49303875 CTGTGGCCTCTGAGGGAGAAGGG + Intronic
1195577700 X:106468899-106468921 CTGTGTCTAATGAGTGAGCAAGG + Intergenic
1195993278 X:110704664-110704686 CTGGGGACAGTGATTGAGCAGGG + Intronic
1197868851 X:131046776-131046798 CTGAGGCCATTGATGGGGGAAGG + Intergenic
1200397671 X:156000723-156000745 CTGTGGTCAAGGATGGGGGAAGG + Intronic
1200788943 Y:7282782-7282804 CTGTTGCCCAGGCTGGAGCACGG - Intergenic
1201168470 Y:11233914-11233936 CTGTTGCCCAGGATGGAGTATGG - Intergenic
1202588237 Y:26454879-26454901 CTGTCGCCCATGATGGAGTGCGG + Intergenic