ID: 1161079811

View in Genome Browser
Species Human (GRCh38)
Location 19:2305182-2305204
Sequence CCTTCTGGGGCGTGGAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 272}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161079802_1161079811 -5 Left 1161079802 19:2305164-2305186 CCCGGATCTGTGCACCTGCCTTC 0: 1
1: 0
2: 0
3: 24
4: 303
Right 1161079811 19:2305182-2305204 CCTTCTGGGGCGTGGAAGGCAGG 0: 1
1: 0
2: 1
3: 30
4: 272
1161079803_1161079811 -6 Left 1161079803 19:2305165-2305187 CCGGATCTGTGCACCTGCCTTCT 0: 1
1: 0
2: 2
3: 31
4: 280
Right 1161079811 19:2305182-2305204 CCTTCTGGGGCGTGGAAGGCAGG 0: 1
1: 0
2: 1
3: 30
4: 272
1161079801_1161079811 -2 Left 1161079801 19:2305161-2305183 CCTCCCGGATCTGTGCACCTGCC 0: 1
1: 0
2: 0
3: 6
4: 167
Right 1161079811 19:2305182-2305204 CCTTCTGGGGCGTGGAAGGCAGG 0: 1
1: 0
2: 1
3: 30
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161079811 Original CRISPR CCTTCTGGGGCGTGGAAGGC AGG Intronic
900255478 1:1696082-1696104 CCTTCTGGGGAGAGGAAGAGAGG - Intronic
900264040 1:1748313-1748335 CCTTCTGGGGAGAGGAAGAGAGG - Intergenic
901221857 1:7587935-7587957 CCATCTGGGCCGAGGGAGGCGGG - Intronic
902361471 1:15944632-15944654 CTCGCTGGGGCGTGAAAGGCCGG + Intronic
902565459 1:17308327-17308349 CCTTCTGGGGTTTTGGAGGCAGG + Intronic
902773611 1:18660528-18660550 CATCTTGGGGCGTGGAAGGGAGG - Intronic
903758516 1:25681438-25681460 CCTTCTGGAGTGTGGAATGCTGG - Intronic
904909146 1:33921171-33921193 CTTTCTGGGGCCTGGGAAGCTGG - Intronic
905024170 1:34838406-34838428 CCTTCTGTGGCTTGCAAGCCAGG + Intronic
905064910 1:35172276-35172298 CCATCTTGGGCGGGGGAGGCGGG - Intergenic
905238267 1:36565349-36565371 CCTTCCTGGGGGTGGCAGGCAGG + Intergenic
905258135 1:36698626-36698648 CCTTCTTTGGGGTGGAAGCCTGG - Intergenic
905836807 1:41131701-41131723 CCTGCTGGGGGGTGGGAGGCTGG - Intronic
905923915 1:41736589-41736611 GCATCTGGGGCATGGAAGGGTGG - Intronic
906032349 1:42731820-42731842 CCTTCTGGGGTGGGGGGGGCGGG + Intergenic
906545738 1:46618024-46618046 CCTGCTTGGGAGTGGAGGGCGGG + Intergenic
907406898 1:54259161-54259183 TCTTCTGGGGCGGGGTAGGGGGG - Intronic
911028910 1:93465351-93465373 CCTGTTGGGGGGTGGGAGGCTGG - Intronic
911506678 1:98761579-98761601 CTTTCTGGGGAGAGCAAGGCTGG - Intergenic
915019938 1:152769640-152769662 TCTTCTGGGGTGTGGGAGTCAGG + Intronic
917356450 1:174131298-174131320 CCTGCTGGGGCCAGGAAGGCTGG - Intergenic
917532879 1:175852878-175852900 CCTCCTGGGACATGGAAAGCCGG + Intergenic
918168719 1:181975116-181975138 CCTGCTGGAGCCAGGAAGGCTGG + Intergenic
918346293 1:183610176-183610198 TCTTCTGGGGGGTGGAGGGGAGG + Intergenic
918487710 1:185046156-185046178 CCTTCTGGGGGGTCGGAGTCGGG + Intronic
921736434 1:218633682-218633704 GCTCCTGGGGCGGGGAAGGGTGG - Intergenic
921792157 1:219302426-219302448 GCTTCTGGGCTGTGGAAAGCAGG - Intergenic
922391463 1:225147785-225147807 CCTACTGGAGGGTGGAAGGTGGG - Intronic
923474276 1:234318187-234318209 ATTTCAGGGGCTTGGAAGGCTGG - Intronic
923507850 1:234621720-234621742 CTTTCTGGAGAGTGGAAGACTGG + Intergenic
923551040 1:234963592-234963614 CCTCCAGGGGAGGGGAAGGCTGG - Intergenic
1063597948 10:7454211-7454233 CCTATTGGAGAGTGGAAGGCTGG + Intergenic
1064622678 10:17230402-17230424 CCCTCGGGGGCGGGGATGGCGGG + Intronic
1064791290 10:18959993-18960015 CCTTCTGCTGCGAGGAAGCCTGG + Intergenic
1064841720 10:19599948-19599970 CCATCTGGGCCCTGGAAGGCTGG - Intronic
1072039126 10:91590830-91590852 CTTTCTTGGGCCTGGAAGGCTGG + Intergenic
1075574278 10:123567292-123567314 TCATCTGCGGTGTGGAAGGCAGG + Intergenic
1077239691 11:1504055-1504077 GCTTCTGGTGACTGGAAGGCAGG - Intergenic
1077526337 11:3067903-3067925 CCTTCTGGGGAGGGGTAGGATGG + Intergenic
1077662204 11:4079750-4079772 CCTACTGGGAAGTGGAAGTCAGG + Intronic
1078446537 11:11409143-11409165 CCTGCTGAGGCGTGGGAGGCTGG + Intronic
1080349797 11:31370092-31370114 TCTTCTGGAGCGTGGAAGACTGG + Intronic
1080503585 11:32892568-32892590 CCTTCCGGGCTGCGGAAGGCGGG + Intergenic
1080682350 11:34488692-34488714 CCTTTTGTCGTGTGGAAGGCAGG + Intronic
1080781400 11:35433078-35433100 CTTTCTAGGGCCTGGAAGGTGGG + Intronic
1082661072 11:55912055-55912077 CCTTTTGGAGCGTGGAGGGTGGG + Intergenic
1082996950 11:59262440-59262462 CCTGCTCGGGCTTGGAAGGAGGG - Intergenic
1083642694 11:64153930-64153952 GCTGCAGGGGCGTGGAATGCGGG - Intronic
1084180634 11:67443827-67443849 CCGTCGGGGGCCGGGAAGGCGGG - Intergenic
1084422254 11:69066271-69066293 CCTTCCGAGGCCTGGAGGGCAGG - Intronic
1084836685 11:71807138-71807160 TCTGCAGGGGTGTGGAAGGCTGG - Intergenic
1085322635 11:75583998-75584020 CTTTCTGGGTAGTGGAGGGCTGG + Intergenic
1086086605 11:82961839-82961861 CCTATTGGGGGGTGGAAGGTGGG - Intronic
1088905817 11:114154982-114155004 CATTCTGGGACTTGGAAGGGTGG + Intronic
1088940575 11:114451224-114451246 ACTTCAGTGGCTTGGAAGGCAGG + Intergenic
1089352365 11:117828818-117828840 CCCTCTGAGGTGTGGCAGGCAGG - Intronic
1089457734 11:118635081-118635103 CCTTCTGGGGCGTGGCCCGCGGG - Intronic
1089538282 11:119173900-119173922 CCTTCAGGGGCGTGTAGCGCTGG - Exonic
1090120165 11:124018349-124018371 CCTTTTGGGGGGTGGGGGGCTGG - Intergenic
1091460697 12:642012-642034 CCCCTTGGGGCGTGGAAGGCGGG + Intronic
1091978974 12:4850379-4850401 CCTTCTGGGGCCTGGAAGTCAGG + Intronic
1092137378 12:6159419-6159441 CTTTCTGGGCCGGCGAAGGCCGG + Intergenic
1097374084 12:58819562-58819584 CCTTCTGGGGCCTTGAGGTCAGG + Intergenic
1098685094 12:73409866-73409888 CCTTTTGGGGGGTGAAGGGCTGG - Intergenic
1101252588 12:102950664-102950686 CCGGCTGGGGCGAGGAATGCAGG - Intronic
1101447010 12:104743763-104743785 CCTTTTGGAGGGTGGAAGGTGGG - Intronic
1102454846 12:113065076-113065098 CCCACTGGGGCCTGGCAGGCTGG + Intronic
1103128021 12:118441426-118441448 CCTGCTGGGGCTTAGATGGCTGG + Intergenic
1104626679 12:130362224-130362246 CCTACTTGGGGGTGGAAGGTGGG - Intronic
1107386277 13:39913361-39913383 CCTTCTGAGGAATGGAAGGGAGG + Intergenic
1108755730 13:53499784-53499806 CCTTCTGGGTGATGGAAGGCTGG + Intergenic
1109162831 13:58997356-58997378 CCTGCTGGGGGGTGGGAGGAGGG - Intergenic
1114460286 14:22882338-22882360 CCTTCTGGGCTATGCAAGGCAGG - Intergenic
1114665391 14:24374474-24374496 CCTGCTGGGGAGGGGAGGGCAGG + Intronic
1117527593 14:56625127-56625149 CCTTCTGGGGAGTCAAATGCGGG + Intronic
1124126409 15:26941653-26941675 ACTTCTGGAGGCTGGAAGGCTGG + Intronic
1125510117 15:40288274-40288296 CCTGATGGGGCCTGGAAGCCTGG + Exonic
1127612038 15:60646572-60646594 CATTCGGGGGCTTGGAAGTCTGG - Intronic
1127998620 15:64170615-64170637 CCCTCTGGCAGGTGGAAGGCAGG + Exonic
1129114664 15:73358513-73358535 CCTTCTGGGCCTAGTAAGGCAGG + Intronic
1131896150 15:97031990-97032012 CCTTCTGGAGGGTGGATGGTAGG + Intergenic
1133207524 16:4242245-4242267 CCTTCTGGGGCCTGGCAGCTGGG - Intergenic
1134232652 16:12440592-12440614 CCTTCTGGTGGGTGGAGGGTGGG - Intronic
1134451231 16:14364940-14364962 GCTTCTGGGCCAGGGAAGGCTGG + Intergenic
1136295769 16:29301317-29301339 CCTTCCGGGGCATTGATGGCGGG + Intergenic
1136730692 16:32409265-32409287 CCTGTTGGGGGGTGGAGGGCTGG - Intergenic
1137530526 16:49276182-49276204 CCCTCTGGGGCGTGGACGCCAGG + Intergenic
1137941850 16:52695735-52695757 CCCTCTGGAGCCTGCAAGGCAGG + Intergenic
1139420003 16:66844329-66844351 CCTGCTGGGGGGTGGGGGGCGGG + Intronic
1139432749 16:66919831-66919853 GCTTCTGGGGCCTGGGAGTCTGG + Intergenic
1139641851 16:68297342-68297364 CTTTCTGAGGCCTGGAAGGCAGG + Exonic
1140056083 16:71526856-71526878 TCTGCTGGGGAGTGGAAGACAGG + Intronic
1140648136 16:77056581-77056603 CCTACTGGAGGGTGGAAGGTGGG - Intergenic
1140781591 16:78301843-78301865 CCTTCTTGGGGTTGGAGGGCAGG + Intronic
1141081470 16:81056817-81056839 CCTTCTGGGATGTGGCAAGCTGG + Intronic
1142101687 16:88275504-88275526 CCTTCCGGGGCGTTGATGGCGGG + Intergenic
1142151006 16:88512549-88512571 CCTGCTGGGGCCTGGGGGGCAGG - Intronic
1142200918 16:88760762-88760784 CCTCCTGCTGCGTCGAAGGCGGG - Intronic
1202995705 16_KI270728v1_random:108004-108026 CCTGTTGGGGGGTGGAGGGCTGG + Intergenic
1203022392 16_KI270728v1_random:420346-420368 CCTGTTGGGGGGTGGAGGGCTGG + Intergenic
1142696862 17:1638714-1638736 CCTTGTGGGGTGGGGAGGGCTGG - Intronic
1143239641 17:5433245-5433267 CCTTTTGGGCCTTGGAAGGAAGG - Intronic
1143514298 17:7411657-7411679 CCTTGTGGGGGGCGGCAGGCAGG + Intronic
1144956040 17:19019401-19019423 CCTGCAGGCGAGTGGAAGGCAGG - Exonic
1146315763 17:31805699-31805721 CCAACTGGGGCATGGAAGGGAGG + Intergenic
1146675071 17:34767763-34767785 CCATCTGAGAAGTGGAAGGCTGG + Intergenic
1147138658 17:38449455-38449477 CCTGCTGGGGCTTGTCAGGCGGG + Intronic
1148047329 17:44752105-44752127 CCTTCTGCTGGGTGGAATGCAGG + Exonic
1148556289 17:48580757-48580779 CCGTCTGGGGCTAGGAAGGTGGG - Intronic
1148895268 17:50835827-50835849 CCTGCTGGGGTGGGGAGGGCAGG + Exonic
1150423751 17:65060061-65060083 CCTACTTGAGGGTGGAAGGCAGG + Intergenic
1150625488 17:66838472-66838494 CCTTGTGGGGAGGAGAAGGCTGG + Intronic
1151755976 17:76075442-76075464 CGTCCTGGGGCCTGGAAGCCTGG + Intronic
1152630078 17:81406957-81406979 CCTGCTGTGGCGAGGAAGGGAGG + Intronic
1153810092 18:8744854-8744876 ACTTCCGGGGGGTGGAGGGCAGG - Intronic
1153848177 18:9068554-9068576 CCTTCTGAGTCATAGAAGGCAGG - Intergenic
1153988438 18:10373920-10373942 CCTCCAGGGACCTGGAAGGCTGG + Intergenic
1155036624 18:22030016-22030038 TCTTCTGGGGCCTGGGAGACAGG + Intergenic
1158934100 18:62348816-62348838 CATTCTGGGGAGGGGAAGGTGGG + Intronic
1160039747 18:75334975-75334997 GCTCCTGGGGCCTGAAAGGCAGG - Intergenic
1160511353 18:79455361-79455383 CCAGCTGGGGCCTGGACGGCCGG + Intronic
1161079811 19:2305182-2305204 CCTTCTGGGGCGTGGAAGGCAGG + Intronic
1161159840 19:2755672-2755694 CTTTCTGGGGGCTGGAAGGGAGG + Exonic
1162853274 19:13448342-13448364 CCTTTTGGAGGGTGGAGGGCGGG + Intronic
1163699568 19:18780583-18780605 CCTGCTGGGGCTTGGATGTCAGG + Exonic
1164120505 19:22261621-22261643 CATCCTGGTGCCTGGAAGGCGGG + Intergenic
1165138510 19:33685681-33685703 CAGGCTGGGGCCTGGAAGGCTGG - Intronic
1165181174 19:33972144-33972166 CCTTTTGGGCTGTGGAATGCAGG - Intergenic
1165431497 19:35775855-35775877 CCATCCAGGGCGTGGAAGACGGG - Intronic
1165903506 19:39179571-39179593 CATTCTGGGGAGTGGCAGGCTGG - Intronic
1166329225 19:42069188-42069210 GGTTCTGGGTCCTGGAAGGCTGG - Intronic
1167160464 19:47764236-47764258 CCCTGTGAGGCGTGGACGGCAGG + Intergenic
1167851531 19:52206057-52206079 CCTGCTGGTGAGTGGAAGGCAGG + Exonic
1168151178 19:54449622-54449644 CTTTCTGGGGCGTGGTGCGCAGG + Intronic
925225451 2:2180210-2180232 CCTTGGGGGGCTTGGAAGGAGGG - Intronic
925800725 2:7597829-7597851 TCTTCTGGGGCATGGAAGGTGGG + Intergenic
926514589 2:13825919-13825941 CCTACTGGAGGGTGGAAGGTGGG + Intergenic
926718425 2:15941969-15941991 CCGTGGGGGGCGCGGAAGGCGGG - Exonic
927551424 2:24003537-24003559 CCTTCTGCCCCATGGAAGGCTGG - Exonic
927937696 2:27084791-27084813 CTGTCTGGGGTGTGAAAGGCTGG + Intronic
929896568 2:45966072-45966094 CCTTGGGAGGCGTGGATGGCTGG + Intronic
930103113 2:47618120-47618142 CCTTCTGGGGAAGGGAAGGGAGG + Intergenic
930710324 2:54544924-54544946 CCTACTGGGGAGTGGGGGGCTGG - Intronic
931576743 2:63725199-63725221 CCTGCTGGAGGGTGGAAGGGTGG - Intronic
932288302 2:70554376-70554398 ATCTCTGGGGCGGGGAAGGCTGG + Intergenic
934315027 2:91909984-91910006 CCTGTTGGGGGGTGGAGGGCTGG + Intergenic
936783072 2:116057491-116057513 CCATCTGGGTGGTGGAGGGCAGG + Intergenic
937047172 2:118857950-118857972 GCTTCTGGGGCGCAGAACGCTGG + Intergenic
937110827 2:119366341-119366363 CCATCTGGTGCGTTAAAGGCAGG - Intronic
939192404 2:138931836-138931858 CCTTCTGGAGCCAGAAAGGCTGG + Intergenic
941541030 2:166784654-166784676 CCCTCTGGGGGGTGGGGGGCGGG - Intergenic
944396083 2:199267746-199267768 CCTCCTGGGGCCTGGAAGTTAGG + Intergenic
946188450 2:217994745-217994767 CCCCCTGGGGCCTGGAGGGCAGG + Intronic
946246965 2:218393313-218393335 CCATCTGGGGGGTGGGAGGGGGG - Intronic
947779354 2:232743560-232743582 TCTACTTGGGGGTGGAAGGCAGG - Intronic
948698801 2:239747879-239747901 CCATGTGGGGTGTGGAAGGCAGG - Intergenic
948994755 2:241572690-241572712 CTTTCTGGGGCCAGGAAGTCAGG + Exonic
1169437099 20:5602340-5602362 CTTTCTGGGGAGTTGTAGGCAGG - Intronic
1169695777 20:8385363-8385385 TCTCCTGGGGCCAGGAAGGCTGG - Intronic
1170208228 20:13822570-13822592 CCTTCAGGAACGTGAAAGGCAGG - Intergenic
1172208642 20:33182102-33182124 CATTCTGGGGTGTGGATGGAGGG - Intergenic
1172771956 20:37387065-37387087 CCTTCACGGGTGTGGAAGGCAGG + Intronic
1173859612 20:46274271-46274293 CTTTCTGGGGCTGGGAAGGCTGG + Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1175437439 20:58963516-58963538 CCTTCTCCCGTGTGGAAGGCTGG - Intergenic
1176128188 20:63485279-63485301 CCTTCTGGGGTAATGAAGGCAGG - Intergenic
1176162925 20:63657721-63657743 CCTTCTGGGGCATGGGAGCTGGG + Intergenic
1176389945 21:6158289-6158311 CCTTCTGGGGCTGGGAGGTCAGG - Intergenic
1176925246 21:14741305-14741327 CCTTGTGGGGCTGGGAAGGGAGG - Intergenic
1178638055 21:34322533-34322555 CCTTCTGAGGCTTGGAAGGAGGG - Intergenic
1179571858 21:42283205-42283227 CCTTCTGAGGGGGGGATGGCGGG + Intronic
1179733521 21:43379951-43379973 CCTTCTGGGGCTGGGAGGTCAGG + Intergenic
1180085036 21:45504629-45504651 CCTTCGCGGGTGTCGAAGGCCGG - Intronic
1180093873 21:45545741-45545763 CATGCTGGGGCATGGCAGGCCGG - Intergenic
1180140160 21:45888450-45888472 CCTGCTGTGGCGTGGGAGGTGGG - Intronic
1180716069 22:17873276-17873298 CCTCCTGGACCGTGAAAGGCAGG - Intronic
1180788307 22:18559015-18559037 CCTTCTGAGGTGAGGAAGCCCGG + Intergenic
1181233431 22:21436303-21436325 CCTTCTGAGGTGAGGAAGCCCGG - Intronic
1181245219 22:21498540-21498562 CCTTCTGAGGTGAGGAAGCCCGG + Intergenic
1183508683 22:38222851-38222873 CCTCCTGGGGCCTGGCAGGGGGG + Intronic
1184836994 22:47029644-47029666 GCTTCTGGGGCGGGGATGGCAGG + Intronic
1184985141 22:48127196-48127218 CCTTTTGGGGGGTGGGGGGCAGG - Intergenic
1185013722 22:48331571-48331593 GCTTCTGGCACGGGGAAGGCAGG - Intergenic
1185274259 22:49943625-49943647 CCTGCAGGGGCCTGGAGGGCTGG - Intergenic
1185276871 22:49953675-49953697 CCTGCTGAGGCCTGGCAGGCAGG - Intergenic
1185334512 22:50265618-50265640 CCTTCTGGGGCATGGGGGGCAGG + Exonic
951016899 3:17742112-17742134 CCTCCTGGGGCAGGGAAAGCAGG + Intronic
957394730 3:79622490-79622512 CCTGCTGGAGCCAGGAAGGCTGG + Intronic
958122699 3:89312733-89312755 CCTTCTGGAGCATGGTAGGTGGG - Intronic
960736320 3:120784970-120784992 CCTTCTTGAGGGTGGAAGGTGGG - Intergenic
960814992 3:121663107-121663129 CATGCTGGGGGGTGGAAGGTGGG - Intergenic
961321243 3:126078038-126078060 CCTTCAGGGAGGTGGGAGGCAGG - Intronic
962491401 3:135897194-135897216 CTTTTTGGGGGGTGGGAGGCAGG - Intergenic
963243957 3:143042604-143042626 ACTTCTGGGACATGGAAGGATGG - Intronic
963400473 3:144791146-144791168 CCTCCTGGAGCGAGGGAGGCTGG - Intergenic
963823077 3:149921449-149921471 CCTGTTGGGGGGTGGAGGGCTGG - Intronic
967057111 3:185839087-185839109 CCTTTTGGAGGGTGGAAGGAGGG + Intergenic
968506365 4:973105-973127 CTTTCGGGGGAGTGGAGGGCGGG - Intronic
968601553 4:1512262-1512284 CCTGCAGGGGCGTGGATGGGAGG - Intergenic
968658766 4:1790070-1790092 CCTTCTGGGGCCTTTGAGGCAGG - Intergenic
968673425 4:1864329-1864351 CCACCTGGGGCCTGGGAGGCGGG + Intergenic
969227474 4:5808182-5808204 CATCCTGGGGGGAGGAAGGCAGG - Exonic
969348933 4:6586955-6586977 CCTGCTGGTGCCTGGAGGGCGGG - Intronic
969676645 4:8618075-8618097 CCCGCTGGGGCTGGGAAGGCAGG + Intronic
969778088 4:9374659-9374681 TCTGCAGGGGTGTGGAAGGCTGG - Intergenic
971786251 4:31106636-31106658 CCTTCTGGGGCCAGGAAGTATGG - Intronic
972553807 4:40160985-40161007 CCTTCTGGGGGTGGGAAGGAGGG - Intergenic
973827459 4:54723071-54723093 CCTTTTTGGGGGTGGAAGGGTGG - Intronic
973848489 4:54937287-54937309 CCTGCTGGGAAGTGGCAGGCTGG + Intergenic
973948251 4:55983323-55983345 CCTTCTGGGTTGTAGGAGGCAGG + Intronic
975525264 4:75341843-75341865 CCTGTTGGGGGGTGGAGGGCTGG - Intergenic
975640595 4:76496201-76496223 GCTTCTGGGGTGAGGAGGGCAGG + Intronic
977195063 4:94047939-94047961 CCTGTTGGGGGGTGGAGGGCTGG + Intergenic
980970308 4:139561026-139561048 CTTTCTGGGGCGGGGAGGGGAGG + Intronic
982024161 4:151235187-151235209 CCTACTGGAGGGTGGAGGGCGGG - Intronic
983811174 4:172064482-172064504 ACTTCTGAGACGTGGGAGGCAGG + Intronic
983935628 4:173500960-173500982 CCTTCCGGGGAGCAGAAGGCCGG + Intergenic
985619880 5:948641-948663 CCTTCTGAAGCGTGGGAGGCGGG + Intergenic
985794548 5:1952506-1952528 CCTGATGGGGCCTGGCAGGCCGG + Intergenic
986280295 5:6316780-6316802 CTTTCTGGGTCGAGGAAGGCAGG - Intergenic
986503415 5:8425687-8425709 CCTTCTGCGGGGTGGAGGGTTGG - Intergenic
987905074 5:24066330-24066352 CCTATTGGAGAGTGGAAGGCAGG - Intronic
988147301 5:27327001-27327023 CCTTTTGGAGGGTGGAAGGTGGG + Intergenic
989102972 5:37837880-37837902 CCTTCTTGTGCCTGGCAGGCTGG + Intronic
998430295 5:142064540-142064562 GCTTCTGGGGAGTAAAAGGCAGG + Intergenic
999429145 5:151511062-151511084 CCTGCTGGAAGGTGGAAGGCCGG + Intronic
999825956 5:155274105-155274127 CCCTCTGGGGAGGGGCAGGCGGG - Intergenic
1001080723 5:168665412-168665434 CCTTCTTGGAAGCGGAAGGCTGG - Intronic
1001382294 5:171312479-171312501 CCACCTGGGGGGTGGGAGGCAGG + Intergenic
1001839711 5:174864812-174864834 CCTGCTGGGGCAAGGGAGGCTGG - Intergenic
1007321022 6:41028732-41028754 CCTCCTGTGCCCTGGAAGGCAGG - Intronic
1007581974 6:42965247-42965269 CCTTCTGCGGCCTGGCAGGTGGG - Exonic
1008773664 6:55009228-55009250 CCTTCTGGAGCCAGGGAGGCTGG - Intergenic
1009184075 6:60552868-60552890 CCTTTTGGGGGGTGGGGGGCTGG + Intergenic
1010300099 6:74250398-74250420 CCTTCTGGGTTGTGGAAAGAGGG - Intergenic
1011624155 6:89269974-89269996 TCTTCTGGGTGGAGGAAGGCTGG + Intronic
1012693458 6:102347750-102347772 CCTACTGGAGGGTGGAAGGTGGG + Intergenic
1012741176 6:103018369-103018391 CCTGCTGGAGCAAGGAAGGCTGG - Intergenic
1013004025 6:106053826-106053848 CATTGTGGGGGGTGGAGGGCTGG - Intergenic
1015924055 6:138292064-138292086 GCTCCCGGGGCGTGGGAGGCCGG - Intronic
1018441381 6:163816615-163816637 TCTTCTGGGGCGGGGAGGGGGGG + Intergenic
1019212394 6:170417257-170417279 CCTTCTGGGGGCTGCAGGGCAGG + Intergenic
1019670624 7:2276232-2276254 CCTTCTGGGGCCTGGCAGCCTGG - Intronic
1019714079 7:2530395-2530417 CCTTCTGGGGGGTGGGGGGGCGG - Intergenic
1020633798 7:10672236-10672258 CCTGCTGGGGCCAGGGAGGCTGG - Intergenic
1022041854 7:26588698-26588720 CATTCTGGGGCGTGGCCTGCAGG - Intergenic
1022174756 7:27862354-27862376 ACCTCTGGGGCGGGGGAGGCGGG - Intronic
1022280147 7:28900016-28900038 ACTTCTGGGGCATGGTAGGCTGG - Intergenic
1022738931 7:33102880-33102902 CCCTCAGGGGCCTGGCAGGCAGG + Intronic
1026057282 7:66995678-66995700 CCTTTTTGGGCGTGGAAAGATGG - Intronic
1026401558 7:70019255-70019277 CCTTTTGGAGGGTGGAAGGTGGG + Intronic
1026720831 7:72829373-72829395 CCTTTTTGGGCGTGGAAAGATGG + Intergenic
1026944341 7:74306467-74306489 CATCCTGGGGCGAGGGAGGCAGG - Intronic
1029041448 7:97580382-97580404 CCTGCTGGAGCCAGGAAGGCTGG + Intergenic
1029475941 7:100784680-100784702 CCTGCTGGGACCTGGATGGCCGG + Exonic
1029746491 7:102517969-102517991 CCGTCTGGGGCGTGAGGGGCGGG + Intergenic
1029764428 7:102616948-102616970 CCGTCTGGGGCGTGAGGGGCGGG + Intronic
1031196476 7:118620899-118620921 CCTGTTGGGGAGTGGAGGGCTGG - Intergenic
1031260764 7:119517179-119517201 CCTATTGGGGGGTGGGAGGCTGG - Intergenic
1031529317 7:122856994-122857016 CCTTATGGGGAGAGGAGGGCTGG - Intronic
1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG + Intronic
1032334405 7:131011630-131011652 GCTGCTGGGGCCTGGGAGGCTGG - Intergenic
1033319567 7:140327327-140327349 CATTCTGGAGCCAGGAAGGCGGG - Intronic
1036345804 8:7961728-7961750 TCTGCAGGGGTGTGGAAGGCTGG + Intergenic
1036829248 8:12009548-12009570 AGTTCTGGGGCTAGGAAGGCAGG - Intergenic
1036841142 8:12122482-12122504 TCTGCAGGGGTGTGGAAGGCTGG + Intergenic
1036862939 8:12368734-12368756 TCTGCAGGGGTGTGGAAGGCTGG + Intergenic
1038087244 8:24212358-24212380 CCTACTGGAGGGTGGAAGGTGGG - Intergenic
1041466120 8:58159263-58159285 CCTTCTGGGAGGTGGAGGGCAGG - Intronic
1044166105 8:88985735-88985757 CCTACTTGGAGGTGGAAGGCTGG - Intergenic
1044315764 8:90748794-90748816 CCTGCTGGAGCCAGGAAGGCTGG + Intronic
1044356159 8:91225019-91225041 CCTGCTGGGGCCAGGGAGGCTGG - Intronic
1046145218 8:110149679-110149701 CCTTCTGGAGGCTGGAAGGTGGG - Intergenic
1049173438 8:141176451-141176473 CCTGCTGGCATGTGGAAGGCAGG - Intronic
1049414231 8:142488058-142488080 CCTTCTGGGCCATGGAGGGTGGG + Intronic
1049509751 8:143021610-143021632 CCTTCTGGGATGGGGCAGGCCGG - Exonic
1049838403 8:144754890-144754912 CCTCCTGGGTCGCGGGAGGCAGG + Intronic
1050596616 9:7210960-7210982 CCTTTTGGGAGGTGGGAGGCAGG - Intergenic
1050597845 9:7221968-7221990 CCTTTTGGGGGGTGGGGGGCTGG + Intergenic
1053941974 9:43260341-43260363 CTGTCAGGGGGGTGGAAGGCTGG - Intergenic
1056785925 9:89592473-89592495 CCTGCTGGAGTGTGGAAGGAGGG + Intergenic
1057896782 9:98915591-98915613 CCTTGTGGTGAGTGGAAGGACGG - Intergenic
1060172036 9:121469799-121469821 CCTCCTGGGGTGTGCAGGGCAGG - Intergenic
1061202864 9:129147507-129147529 ACTGCTGGGGTGGGGAAGGCAGG - Exonic
1061260753 9:129479716-129479738 CCTTGTGGGCAGTGGAAGGAAGG + Intergenic
1061679690 9:132236808-132236830 GATTCTGGGCAGTGGAAGGCAGG + Intronic
1062392123 9:136338057-136338079 CCTTCTGGGGAGGGGAGGGGAGG - Intronic
1203792167 EBV:157568-157590 CGTTCTGAGGCGTCGGAGGCGGG - Intergenic
1203435879 Un_GL000195v1:136751-136773 CCTTCTGGGGAGACTAAGGCAGG + Intergenic
1186902416 X:14071080-14071102 CCTTCTGGGGAGTGGAATTAAGG + Intergenic
1187661722 X:21554481-21554503 CCTTTTGGAGGGTGGAAGGTGGG - Intronic
1187948028 X:24445545-24445567 TCTTCTGGGGCATGGGAGGCTGG + Intergenic
1188950712 X:36370248-36370270 CCTGCTGGGGGGTGGGGGGCTGG - Intronic
1189840666 X:45073020-45073042 CCTGCTGTGGGGTGGAAGGCAGG - Intronic
1190325584 X:49205081-49205103 CCTGCTGGGGAGGGGAGGGCAGG + Exonic
1193270464 X:79523762-79523784 CCTACTTGAGAGTGGAAGGCAGG + Intergenic
1193449831 X:81652037-81652059 CCTTTTGGAGTGTGGAAGGTGGG + Intergenic
1196559101 X:117124642-117124664 CCTTCAGGAGCTTGCAAGGCAGG - Intergenic
1197573236 X:128176140-128176162 CCTGCTTGGGGGTGGAAGGTGGG + Intergenic
1198299793 X:135324073-135324095 CTTTCTGGGGAGAGGAGGGCAGG + Intronic
1199292969 X:146125177-146125199 CCTGCTGGGGTGTGGTGGGCTGG + Intergenic
1199715708 X:150506156-150506178 CCTTCTGCTGTGTGGCAGGCTGG + Intronic
1199840193 X:151638287-151638309 CCTTTTGGGGAGTGGGGGGCTGG + Intronic
1201145392 Y:11062320-11062342 CCTGCTGGGGAGTGGGTGGCAGG - Intergenic