ID: 1161081554

View in Genome Browser
Species Human (GRCh38)
Location 19:2312979-2313001
Sequence CTCCCACCCCACCGCCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 337}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161081547_1161081554 13 Left 1161081547 19:2312943-2312965 CCCATCACAGGTGGTCGTAACCT 0: 1
1: 0
2: 2
3: 1
4: 35
Right 1161081554 19:2312979-2313001 CTCCCACCCCACCGCCTGGGAGG 0: 1
1: 0
2: 1
3: 29
4: 337
1161081544_1161081554 25 Left 1161081544 19:2312931-2312953 CCATGGCAACGTCCCATCACAGG 0: 1
1: 0
2: 0
3: 12
4: 88
Right 1161081554 19:2312979-2313001 CTCCCACCCCACCGCCTGGGAGG 0: 1
1: 0
2: 1
3: 29
4: 337
1161081550_1161081554 -7 Left 1161081550 19:2312963-2312985 CCTTAGCAACCAGGTGCTCCCAC 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1161081554 19:2312979-2313001 CTCCCACCCCACCGCCTGGGAGG 0: 1
1: 0
2: 1
3: 29
4: 337
1161081548_1161081554 12 Left 1161081548 19:2312944-2312966 CCATCACAGGTGGTCGTAACCTT 0: 1
1: 0
2: 1
3: 2
4: 51
Right 1161081554 19:2312979-2313001 CTCCCACCCCACCGCCTGGGAGG 0: 1
1: 0
2: 1
3: 29
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161081554 Original CRISPR CTCCCACCCCACCGCCTGGG AGG Intronic
900509737 1:3052887-3052909 CCCCCACCCCACCTCGAGGGAGG + Intergenic
901701553 1:11047159-11047181 CTCCCACCCCACACCCTGCAGGG + Intronic
901702766 1:11054303-11054325 CACCCACCCCACTGCCCTGGGGG + Intergenic
902747006 1:18481111-18481133 TTCCCACCCCACCGCTGGGCTGG - Exonic
903304994 1:22407024-22407046 CATCCACCCCAAAGCCTGGGAGG - Intergenic
903338628 1:22641001-22641023 CTCCCAGCCCCCAGCCTGGGCGG - Intergenic
904748977 1:32729088-32729110 ACCCCACCCCCCAGCCTGGGAGG - Intergenic
905189706 1:36224210-36224232 GTCCCCTCCCCCCGCCTGGGTGG - Intergenic
905259948 1:36710088-36710110 CTCACACCCCCCCGCCAGTGAGG - Intergenic
906208650 1:44000283-44000305 CACCCACCTCACTGCCTGGAAGG + Intronic
906325487 1:44843043-44843065 CTCCCACGCCCGCGCCTTGGCGG - Exonic
906590935 1:47023712-47023734 CGCCCACCCCACCGCCTCTCTGG - Exonic
907473894 1:54692575-54692597 CTCCCACCCCAACCCCAAGGTGG - Intronic
907708399 1:56852928-56852950 CTCCCACCCCACCCCCAGCACGG - Intergenic
910168013 1:84348360-84348382 CTCCCACACCATCCCCAGGGCGG - Intronic
911304267 1:96214010-96214032 CTTCCACCCCTCCTCCTTGGGGG - Intergenic
911524432 1:98966774-98966796 CTGCCATCCCACCCACTGGGTGG + Intronic
912537742 1:110388260-110388282 CTCACACCTCAACCCCTGGGAGG + Intronic
912716843 1:111989393-111989415 CTCCCACTCCCGCGCCCGGGTGG - Intergenic
914916842 1:151824268-151824290 CTCCTACTTCCCCGCCTGGGTGG + Intronic
915213191 1:154324970-154324992 CCCCCACCACGCCCCCTGGGTGG - Exonic
916484918 1:165250070-165250092 CCCCCACCCCACCCCCTGACAGG - Intronic
917846643 1:179025876-179025898 CACCCACCCCCCCGCCTCCGAGG - Exonic
919850443 1:201668634-201668656 CCCCCACCCCACTGCTTGGAAGG + Intronic
920093666 1:203471950-203471972 GTCCCACCCTCCAGCCTGGGGGG - Intergenic
921291918 1:213666063-213666085 CTCCCACCCCACTGCCGAGAGGG - Intergenic
1062996838 10:1874092-1874114 CTCTCTCCCCACCCCATGGGAGG - Intergenic
1063403767 10:5773155-5773177 CCCCCACCCCACCACCCAGGAGG + Intronic
1064444849 10:15384066-15384088 CTCCCATCCTCCCTCCTGGGTGG - Intergenic
1067167913 10:43879954-43879976 CTCCCGCCCCACAGCCAGCGGGG + Intergenic
1067877841 10:50020457-50020479 CTGCCACCCCAGTGCCGGGGTGG + Intergenic
1067937256 10:50623244-50623266 CTCCACCCCCACAGCCTAGGTGG - Intronic
1068363805 10:56016730-56016752 CCCCCACCCCACCTCCTGACAGG - Intergenic
1068938314 10:62657443-62657465 CTCCCTCCCCACCAACTTGGTGG - Intronic
1069892062 10:71658074-71658096 CTCCCACCCCAGCCCCTCTGAGG - Intronic
1070132237 10:73663944-73663966 CTGCCACCCCAGTGCCAGGGTGG - Intergenic
1070780178 10:79132976-79132998 CCCCCACCCCAGAGCCTGCGAGG - Intronic
1071087694 10:81882259-81882281 CTGCCACCACACTGCCTGGCAGG - Intronic
1071609445 10:87020131-87020153 CTGCCACCCCAGTGCCAGGGTGG + Intergenic
1073556650 10:104459602-104459624 CCCCCACCCCACCCCCTGACAGG + Intergenic
1076071091 10:127490243-127490265 CTCCCTCCCCAGCTCGTGGGTGG - Intergenic
1076120460 10:127932904-127932926 CCCCCAGCCCACAGCCTGTGTGG - Intronic
1076642340 10:131927281-131927303 CTCACACCCCACTCCCCGGGGGG - Intronic
1076726070 10:132413891-132413913 CTCCCACCCCACTGTCTCTGAGG - Intronic
1076898988 10:133327875-133327897 CACCCACCCCACCCACTGTGGGG - Intronic
1077408010 11:2391263-2391285 CACCCACCCCTCAGCCTGTGAGG - Intronic
1077411467 11:2405815-2405837 CTCCCACCCTGCCACTTGGGAGG - Intronic
1080463421 11:32475374-32475396 CTCCCAGCACACTGCCTGTGGGG - Intergenic
1080770458 11:35336158-35336180 CACCCACCCCACCCCCTGAGAGG - Intronic
1081445437 11:43127170-43127192 CTACCACCCCACCCCCTGACAGG - Intergenic
1081467278 11:43332815-43332837 GTCCAACCCCACCTCCAGGGAGG - Intronic
1081871089 11:46382793-46382815 CCCCCCCCCCCCCGCCTGTGAGG + Intronic
1083036774 11:59645300-59645322 CTGCCACCACCCCGTCTGGGAGG - Intronic
1083427858 11:62598180-62598202 CTCCCTCCCCGCCGCCTATGTGG - Intronic
1083538667 11:63495378-63495400 CTCACCCCCCACCGCCAGAGAGG - Intergenic
1084303964 11:68269770-68269792 CACCAGCCCCACCGGCTGGGAGG - Intronic
1084680292 11:70662861-70662883 CTCCACCCCCACCTTCTGGGTGG + Intronic
1084769286 11:71332169-71332191 TTCCCAGCCCACATCCTGGGAGG + Intergenic
1084782891 11:71422691-71422713 CCCCCACCCCACCCCCTGACAGG - Intergenic
1085395151 11:76203438-76203460 CTCTCACCCCACCGCTTCCGTGG + Intronic
1089254565 11:117187511-117187533 CTCCCACTTTACCGCCTCGGAGG - Intronic
1089557083 11:119320695-119320717 CTCTCCCCCCACCCCCTGGCAGG - Intronic
1089744247 11:120605914-120605936 CTCCCCAGCCACCGCCTGTGCGG - Intronic
1089830481 11:121323180-121323202 TGCCCACCCCACCGCCAGGGTGG - Intergenic
1090114627 11:123955484-123955506 CTCCCACCCAACCCCCTGACAGG - Intergenic
1090224009 11:125057823-125057845 CCCCCCGCCCACCGCCTGGCTGG - Intergenic
1090421176 11:126575993-126576015 TTCCCACCTCACAGTCTGGGAGG - Intronic
1091397738 12:163952-163974 CTCAGACCCCAGGGCCTGGGAGG + Intronic
1091622714 12:2101447-2101469 CTCCCACAGCCCCACCTGGGAGG - Intronic
1092147255 12:6223216-6223238 CTTCCACCCCAACCCCAGGGAGG - Intronic
1092245089 12:6859598-6859620 CTCCTCCCTGACCGCCTGGGGGG + Intronic
1092325041 12:7522046-7522068 CCCCCACCCCACTGCCTGACAGG + Intergenic
1094722458 12:33078293-33078315 CCCCCACCCCACCTCCTGACAGG + Intergenic
1095571333 12:43685804-43685826 CGGCCACCACACCGTCTGGGAGG + Intergenic
1095884796 12:47177598-47177620 CCCCCACCCCACCACCAGGCTGG - Intronic
1096082648 12:48842772-48842794 CGCCCACCACCCCGTCTGGGAGG + Intronic
1096195512 12:49646786-49646808 CTCCCACCCCACCCCCCATGAGG - Intronic
1096503991 12:52081520-52081542 CCCCCACTCCACCCCCTAGGAGG + Intergenic
1097178954 12:57160012-57160034 CTCCCACCCCAAGGCCTGGGAGG - Intronic
1102101163 12:110280576-110280598 CTCCCTCCCCCCCGCGAGGGGGG + Intergenic
1102589208 12:113944682-113944704 CTCCCACCTCACCTCCCGAGTGG - Intronic
1103126131 12:118424129-118424151 CTCCCACCCCAGGCCCTGAGTGG - Intergenic
1103758917 12:123233669-123233691 GCCCCACCCCACCGCCAGCGCGG - Intronic
1103877739 12:124141676-124141698 CTCTCACCCCACCTGTTGGGAGG + Intronic
1104941171 12:132396084-132396106 TGCCCACCCCACCTGCTGGGAGG + Intergenic
1105344197 13:19559447-19559469 CTCCCACCCAGCCTCCTCGGGGG - Intergenic
1107033599 13:35878392-35878414 CTCCCATCCTACTGCCTGTGGGG + Intronic
1109908944 13:68885321-68885343 CCCCCACCCCACCCCCTGCATGG + Intergenic
1111535705 13:89600009-89600031 CTCCCACCTCAGCCTCTGGGAGG - Intergenic
1112602781 13:100873126-100873148 CTCCCACTCAGCAGCCTGGGAGG - Intergenic
1113946973 13:114049917-114049939 CTCCGACCCCGCGGCATGGGTGG - Intronic
1114393140 14:22331697-22331719 CTCCCACCCCACTGCTGGGAGGG - Intergenic
1114553918 14:23550878-23550900 CTCCCATCCCACAGCCGGCGGGG + Intronic
1117222197 14:53617292-53617314 CTCCCACCCCACCCCCTCAGGGG - Intergenic
1119430782 14:74566977-74566999 CTCCCCACCCACAGCCTGGCAGG - Intronic
1119749690 14:77068367-77068389 CTCCCACCGCACCTTCTGGCGGG - Intergenic
1120216263 14:81683525-81683547 CACCCACCCCACCCCGCGGGGGG - Intergenic
1121089578 14:91171735-91171757 CCCCCACCCCACCTCCTGAATGG - Intronic
1121557436 14:94849045-94849067 CTCCCTCCCCAGCACCTGGGCGG - Intergenic
1121681337 14:95795071-95795093 CTCCCACCCCACTCCCCAGGAGG - Intergenic
1121828936 14:97033435-97033457 CTCCCGCCCCAGCTCCTGGCCGG + Intergenic
1122283575 14:100638358-100638380 TTCCCACCCCATGGGCTGGGTGG + Intergenic
1122389380 14:101369870-101369892 CATCCTCACCACCGCCTGGGAGG - Intergenic
1122417384 14:101556916-101556938 CTCCCACCCCATCCCCTGCAGGG + Intergenic
1122736550 14:103847125-103847147 CCCCCACCTGCCCGCCTGGGGGG + Intronic
1123062303 14:105599805-105599827 CTCCCACCGCCTCTCCTGGGGGG + Intergenic
1123062319 14:105599847-105599869 CTCCCACTGCCCCTCCTGGGGGG + Intergenic
1123087045 14:105721533-105721555 CTCCCACCACCTCTCCTGGGGGG + Intergenic
1123087061 14:105721575-105721597 CTCCCACTGCCCCTCCTGGGGGG + Intergenic
1124623717 15:31295953-31295975 CTGCCATCCCACCTCCTAGGGGG - Intergenic
1126099750 15:45111999-45112021 CGCCCTCCCCACGGCCAGGGCGG + Intronic
1127259773 15:57319485-57319507 TTCCTACCCCTCCGCCGGGGTGG + Intergenic
1128100886 15:64998935-64998957 CTGCCACCCCACATTCTGGGTGG - Intergenic
1128681796 15:69657804-69657826 CTCCCTCCCCTCCGGCTGTGAGG - Intergenic
1128734900 15:70047944-70047966 CTCCCATCCAAGCGCCAGGGAGG - Exonic
1128800663 15:70494863-70494885 CCCCCACAACACCCCCTGGGAGG + Intergenic
1130018291 15:80203823-80203845 CTCCCACCCCCATGCCAGGGAGG - Intergenic
1132585555 16:704620-704642 CTCCCAGCCCACCCCCTCTGTGG - Intronic
1132783507 16:1641815-1641837 TCCCCACGCCACAGCCTGGGGGG + Intronic
1133018348 16:2955145-2955167 CCCCCACCCCCCCGCAGGGGTGG - Intergenic
1133864861 16:9633042-9633064 CTCCCAGCACACTGCCTGTGGGG + Intergenic
1134619559 16:15677252-15677274 CTCCCACCACACTCCCTGGGTGG - Intronic
1135592248 16:23712969-23712991 CTCCCTCCCTCACGCCTGGGTGG - Intronic
1136365614 16:29807850-29807872 CTCCCTCCCCACGGCCTAGCGGG - Intronic
1136390584 16:29961951-29961973 CTCGCAGCTCACCGCCAGGGTGG - Intronic
1136453993 16:30370199-30370221 CTCACATCCCCCCGCCGGGGAGG + Exonic
1137389205 16:48067492-48067514 CTCCCACACCACCCTTTGGGTGG + Intergenic
1137613689 16:49835113-49835135 CTCCCACCCCCTGGCCTTGGGGG + Intronic
1137673280 16:50291605-50291627 CTCCCTCGCCACCCCCTGCGTGG - Intronic
1138490251 16:57372410-57372432 CTCCCACCCTCCTGCCTGCGGGG + Intergenic
1138526721 16:57612742-57612764 CCCCCACCCCACTCCCAGGGAGG - Intronic
1138561562 16:57803573-57803595 CTGGCAGCCCAGCGCCTGGGCGG - Intronic
1138595070 16:58025540-58025562 CTCCCAACCCAGCGCCTAGGGGG - Intergenic
1141064478 16:80902766-80902788 CTCCCACCCAGCCTCCTGGAGGG + Intergenic
1141180095 16:81746516-81746538 CTCTCACCCCAGCGCCGGGAGGG + Intronic
1141300867 16:82814391-82814413 CATCCACCCCACCTCCAGGGAGG + Intronic
1142374479 16:89700182-89700204 CCCCCGCCCCGCCCCCTGGGAGG + Intronic
1142395685 16:89829892-89829914 GTCTCACCCCACCCTCTGGGCGG - Intronic
1142644456 17:1302927-1302949 CTCCCATCCCACAATCTGGGAGG + Intergenic
1143012822 17:3875636-3875658 CAGCCACCCCACTGCCAGGGAGG - Intronic
1144432464 17:15206764-15206786 CTCCCACCCCACCCCCTGACAGG - Intergenic
1144780739 17:17807237-17807259 CGCCCCCCCCACCGCCTGGCTGG - Intronic
1146638841 17:34525458-34525480 CTCCCACCTCACTTCCTGGCTGG - Intergenic
1146654327 17:34626355-34626377 CTCCCGCGCCACCACCTGGCTGG - Exonic
1147412627 17:40264706-40264728 CTCCCCCACCACCCCCAGGGCGG + Exonic
1147741103 17:42671350-42671372 CTCCCACACCACGGCGGGGGAGG - Exonic
1147753221 17:42750157-42750179 CTCCAACCCCACAGCTAGGGTGG + Intergenic
1148615683 17:48998173-48998195 CTTCCTCCCCACCGACGGGGCGG + Intronic
1148617862 17:49013987-49014009 CTCCCACCCCGGCCTCTGGGTGG - Intronic
1149436628 17:56639012-56639034 CCCCCACCCCACCCTCTGGCAGG - Intergenic
1150229477 17:63542219-63542241 CTCCCACCCCTCTGGCTGGCAGG + Exonic
1150866182 17:68852671-68852693 CTCCCACCCCACTCCCTGACAGG - Intergenic
1151597517 17:75087636-75087658 TCCCCACCCCACTTCCTGGGAGG + Intergenic
1152472189 17:80495899-80495921 CTCCCTCCCCAGCGTCTGTGTGG + Intergenic
1152779168 17:82218844-82218866 TGCCCACCCCAGCGCCTGGATGG - Intergenic
1156503407 18:37574266-37574288 CCCCCACCTCCCCGCCAGGGAGG + Intergenic
1159364165 18:67444882-67444904 CTCCCACCCCAACCCCTGACAGG + Intergenic
1159866021 18:73706016-73706038 CTCTGACCCCACACCCTGGGAGG - Intergenic
1160863827 19:1248784-1248806 CTCCCACCCCGCACCCCGGGGGG - Intronic
1160895131 19:1398960-1398982 CTGCAACCTCACCTCCTGGGGGG - Exonic
1161048976 19:2151975-2151997 CTCCAAACCCAACTCCTGGGTGG + Intronic
1161081554 19:2312979-2313001 CTCCCACCCCACCGCCTGGGAGG + Intronic
1161157349 19:2739576-2739598 CGCCCAGCTCACCGCCGGGGGGG - Intronic
1161283885 19:3459173-3459195 CTCCTCCCCCAAAGCCTGGGTGG + Intronic
1161320230 19:3637677-3637699 CTCCCACCCGACCACGGGGGTGG - Intronic
1161454189 19:4361964-4361986 CTCCCATCCTCCCTCCTGGGTGG - Intronic
1161605184 19:5210910-5210932 CTACCACCCCACTGCCTGCCAGG + Intronic
1162572088 19:11479877-11479899 CTCCCACCCCATCTCCCGGGGGG + Intronic
1164669587 19:30064951-30064973 CTGCCATCCCCCCTCCTGGGGGG - Intergenic
1166247117 19:41537187-41537209 CCCCCACTCCACCTCCTGTGAGG + Intergenic
1166544487 19:43625955-43625977 CTCCCTCACCACAGCTTGGGAGG + Exonic
1166701679 19:44885923-44885945 CTCCTACCCCACAGCCTGGAGGG + Exonic
1166862125 19:45816742-45816764 CGCCCACCGCACACCCTGGGTGG + Intronic
1167070847 19:47221354-47221376 CTTCCCCCCCTCCTCCTGGGAGG - Exonic
1167271465 19:48508913-48508935 CTCCTTCACCACCACCTGGGCGG + Exonic
1167589866 19:50398691-50398713 CTCCCACCCCACTGCCTGCAGGG + Intronic
1168314645 19:55479279-55479301 CCCCCACTCCATGGCCTGGGCGG - Intronic
1168350864 19:55674919-55674941 CTCCCACCCCGCCGACAGGAGGG + Intergenic
925847552 2:8047474-8047496 CACCCACCCCTCAGTCTGGGTGG + Intergenic
926320312 2:11744738-11744760 CTCCCCTCCCACCTCCAGGGAGG - Intronic
926406165 2:12555113-12555135 CTCCCACACCACTGCCAGGCAGG - Intergenic
927440421 2:23112308-23112330 CCCCAACCCCACCCCCTGAGAGG + Intergenic
928010250 2:27600751-27600773 CTTCCTCCCCACTGCCTGGCAGG - Exonic
928253120 2:29699212-29699234 TTCCCACCCCTGCCCCTGGGTGG - Intronic
929546160 2:42856371-42856393 CTCACCTCCCACCTCCTGGGCGG + Intergenic
930762087 2:55049230-55049252 CTCCCTCCTCACCTCCTGGCTGG - Intronic
931300025 2:60970634-60970656 GTACCACCCCAGAGCCTGGGCGG + Intronic
932607962 2:73176972-73176994 CCCCCAACCCAGCCCCTGGGAGG + Intergenic
934563224 2:95323797-95323819 CTGCCACCCCAAGGCCTGCGGGG - Intronic
935622728 2:105143841-105143863 CTCTCACCCCGCCCCCCGGGGGG + Intergenic
936746227 2:115579971-115579993 CCCCCACTCCACCCCCTGGCAGG + Intronic
937061235 2:118981875-118981897 GTCCAACTCCACCCCCTGGGTGG - Intronic
937100537 2:119264801-119264823 CTGCCCCCCCCCCGCCAGGGAGG + Exonic
939636520 2:144589619-144589641 CTCCTTCCCCACCCCCTAGGAGG - Intergenic
941211969 2:162651362-162651384 CTCCCACCCCACCCCCAAGTAGG + Intronic
942218334 2:173744683-173744705 CTCCCAAACCACCACATGGGGGG - Intergenic
943331859 2:186569479-186569501 CCCCCACCCCACCCCCCGAGAGG - Intergenic
944722687 2:202440278-202440300 CTACCACCACCCCGTCTGGGAGG - Intronic
946313425 2:218895386-218895408 CTCTCACCCGCCCGCCTGTGGGG - Intronic
948368435 2:237473346-237473368 CTGCCACCACACTGCCCGGGTGG - Intergenic
948644295 2:239393979-239394001 CCCCAACCCCACCACCAGGGAGG + Intronic
948863469 2:240763957-240763979 CTCCCACCCCAGCACCCGGCTGG + Intronic
948915797 2:241034550-241034572 CCCCCACCCCACCCCCAGGCTGG + Exonic
948923975 2:241082146-241082168 CTCCCACCATCCCGCCTTGGAGG + Intronic
949023233 2:241752927-241752949 CCCCCACGCCACCCCCAGGGCGG + Intronic
1169115067 20:3059284-3059306 CTCCCACTCCACTGGCTGTGTGG + Intergenic
1169266037 20:4167865-4167887 CTCCCACCCCTCAACCAGGGAGG - Intronic
1171191028 20:23159580-23159602 CACCCACCCCACCCCCAGGCTGG - Intergenic
1171454442 20:25259604-25259626 ACCCCACCCCACCTCCGGGGCGG + Intronic
1173229630 20:41184021-41184043 CTCCCACCCCAGGGTCTGGCCGG - Exonic
1173659773 20:44725046-44725068 CCCCCACCCCACCCCCTAGGTGG - Intronic
1173946696 20:46957004-46957026 CTCCCACCCCATATCATGGGAGG - Intronic
1174296337 20:49547951-49547973 CTCCCACACCACCGCGTCGTAGG + Exonic
1174498586 20:50967365-50967387 CCCCCACCCCACCCCCCGGGAGG + Intergenic
1174880533 20:54274376-54274398 CCCCCACCCCACCCCCTGACAGG + Intergenic
1175138112 20:56840131-56840153 CTCCCCACACACTGCCTGGGGGG - Intergenic
1175339484 20:58219008-58219030 CTGCCATCCCACCGGCTGTGGGG + Intronic
1175429257 20:58890961-58890983 CGCCCACCCCAGCCCCTCGGCGG + Intronic
1176098042 20:63353193-63353215 CTCCCACCCTGCAGCCTGGCCGG + Intronic
1176155451 20:63617827-63617849 CTTCCACCCAGACGCCTGGGTGG + Intronic
1176348151 21:5770326-5770348 CTGCCACCACCCCGTCTGGGAGG - Intergenic
1176354965 21:5890910-5890932 CTGCCACCACCCCGTCTGGGAGG - Intergenic
1176496676 21:7554129-7554151 CTGCCACCACCCCGTCTGGGAGG + Intergenic
1176542472 21:8168396-8168418 CTGCCACCACCCCGTCTGGGAGG - Intergenic
1176546173 21:8201210-8201232 CCCCCCCACCACCGCCTTGGTGG + Intergenic
1176561423 21:8351441-8351463 CTGCCACCACCCCGTCTGGGAGG - Intergenic
1176565124 21:8384256-8384278 CCCCCCCACCACCGCCTTGGTGG + Intergenic
1179123361 21:38569168-38569190 CTCCCCCCCCACCCCCAGTGGGG + Intronic
1179370502 21:40802159-40802181 CTCCCACCCCAGTGTCTCGGAGG + Intronic
1180034355 21:45236122-45236144 CTCCCACCCCAGCTCCTTGGTGG + Intergenic
1180037073 21:45255590-45255612 CTCCCACCCCCAAGCCTGGCAGG - Intergenic
1180170570 21:46056064-46056086 CTCCCCTCCCACCGCCTGACAGG + Intergenic
1180171381 21:46060515-46060537 CTCCCAACCCACAGCCTTGGTGG + Intergenic
1181057553 22:20267379-20267401 CCCCCGCCCCACCGGCTGTGAGG - Intronic
1181474611 22:23160624-23160646 CTCCCACCCCACTGCCTGCTTGG - Intronic
1181570010 22:23763398-23763420 CTCCCCACCCACCGCAAGGGCGG - Intronic
1182127095 22:27824024-27824046 CTCCCACACCACCTCTTGAGAGG - Intergenic
1182715515 22:32353998-32354020 CACCCAACCCACCCCCTGCGCGG + Intergenic
1183353523 22:37346402-37346424 CTCCCAACCCAGGCCCTGGGTGG + Intergenic
1183642231 22:39099713-39099735 CTCCCATCCTCCCACCTGGGAGG - Intronic
1184537012 22:45094289-45094311 CTCCCACCCCACCACCATGAGGG + Intergenic
1185126302 22:49012589-49012611 CTCTCAGCCCAGAGCCTGGGAGG + Intergenic
1185383797 22:50522423-50522445 GCCCCACCCCACCCCCTGGCAGG - Intronic
1185414287 22:50701247-50701269 CTCCCACGGCACCTCCTGGCAGG + Intergenic
1203247411 22_KI270733v1_random:84814-84836 CTGCCACCACCCCGTCTGGGAGG - Intergenic
1203251045 22_KI270733v1_random:117447-117469 CCCCCCCACCACCGCCTTGGTGG + Intergenic
1203274448 22_KI270734v1_random:78122-78144 GTCCCACCCCACCGGCTCAGGGG + Intergenic
949534790 3:4987208-4987230 CTCCCTCCCCACCGCCGACGGGG - Intergenic
950479392 3:13235286-13235308 CTCAGACCCCAGCGCCGGGGAGG - Intergenic
950550213 3:13661745-13661767 CTCCCACCCCACTTCCTGCTTGG - Intergenic
952889419 3:38030430-38030452 CTCCCACCACAGACCCTGGGAGG + Intergenic
954627550 3:52030775-52030797 CCACCACCCCAGCCCCTGGGAGG + Intergenic
958719432 3:97825689-97825711 CTCCCTCCCACCCACCTGGGTGG - Intronic
959892422 3:111571047-111571069 CTCCTACCCCACAGCCTGGAGGG - Intronic
959941514 3:112086315-112086337 CTCACACTCCACCCACTGGGCGG - Exonic
960223732 3:115146920-115146942 CTCCCACCTCCCCGCCGGGTCGG + Intronic
960577530 3:119242775-119242797 CTGCCCCCCCACCTCCCGGGCGG - Intergenic
960940399 3:122929402-122929424 ATCCCACCCCAGGCCCTGGGTGG + Intronic
962940800 3:140123157-140123179 CCCCCACCCCCCCGCCCTGGAGG - Intronic
963415613 3:144992283-144992305 CTCCCACCCCACCTCCTGATAGG + Intergenic
963708740 3:148721590-148721612 GTCCCAGCCCACTGCCTGGAGGG + Intronic
963745132 3:149118166-149118188 CACCCACCCTACCCCCAGGGAGG + Intergenic
966966902 3:185003673-185003695 CGGCCACCACACCGTCTGGGAGG - Intronic
967873164 3:194249047-194249069 CTCCAACCCTTCCGCCTGGATGG - Intergenic
968258377 3:197298658-197298680 CGCCCTCCCCGCCCCCTGGGAGG - Intronic
968448280 4:663407-663429 CTTCCACCCCACCCCATGAGGGG - Intronic
968513506 4:1005388-1005410 GTCCCACCCCAGCACCTTGGAGG - Intergenic
968517528 4:1021156-1021178 ATCCCACCCCACCCCCTGTCTGG - Intronic
968660135 4:1795420-1795442 CGCCCACCCCTCCCCCGGGGCGG + Intronic
969131869 4:4996087-4996109 CTCCCCCTCCACAGCCTGGCTGG + Intergenic
969244092 4:5921337-5921359 CCCCCAGCCCACCGCCTGACTGG - Intronic
969471703 4:7392889-7392911 CCCCCCCCCCCCCGACTGGGAGG - Intronic
969876815 4:10141528-10141550 CCCCCACCCCTCCCCCAGGGAGG - Intergenic
971099657 4:23450865-23450887 CTCCCACCCCAACCCCTGACAGG + Intergenic
971409938 4:26359659-26359681 CTCCCACCCCGCCGACAGGAGGG + Intronic
971594736 4:28514714-28514736 CGCCCACCACCCCGTCTGGGAGG - Intergenic
972304819 4:37820764-37820786 CTGCCACCACCCCGTCTGGGAGG + Intergenic
976078391 4:81325155-81325177 CCCCCACCCCACCCCCTGACAGG - Intergenic
976765415 4:88592905-88592927 CTCCCGCCCTGCCGCCCGGGAGG + Intronic
980992544 4:139750360-139750382 CTCACGACCCACCGCCTAGGAGG - Intronic
985141573 4:186845403-186845425 CTCCCATGCCACAGCCTGTGTGG - Intergenic
985542314 5:492677-492699 CTGCCGCCCCACCGCCCGGCTGG + Intronic
986150873 5:5129593-5129615 CTTCCACACCAGGGCCTGGGTGG + Intergenic
987310083 5:16673681-16673703 CTCCCACACCACCGCTGGGGAGG - Exonic
988831720 5:34994319-34994341 CTCGCATCCCACTGCCTGTGGGG + Intergenic
989655877 5:43746119-43746141 CTGCCCCCCCACCTCCTGGATGG + Intergenic
989663489 5:43824677-43824699 CTGCCACCACCCCGTCTGGGAGG - Intergenic
990259790 5:54009917-54009939 CTCTCACCTCACCTCCAGGGTGG - Intronic
992311987 5:75511032-75511054 GCCCCACCCCACCGCCTCAGCGG + Intronic
992774558 5:80078041-80078063 CTCCCACTCCGTCGCCTGAGTGG - Exonic
994525542 5:100901342-100901364 CTCCTAGCCCACGGCCCGGGAGG + Intronic
997372244 5:133369518-133369540 CTCCCACCCAACCCCCTGCCAGG - Intronic
999546347 5:152632709-152632731 TTCCCACCCCACCACCTGGAAGG - Intergenic
1002105952 5:176879535-176879557 CACCCACCCCGCCGCCGGGCAGG - Intronic
1002305059 5:178278308-178278330 GGCCCACCCCACAGCCTAGGGGG - Intronic
1002971179 6:2021825-2021847 TTGCCACCCCACCAGCTGGGTGG - Intronic
1003621407 6:7704369-7704391 CTTCCACCCCACACCCTGTGGGG - Intergenic
1006257232 6:32841494-32841516 CTCCCACCACCATGCCTGGGAGG - Intronic
1006456500 6:34134949-34134971 CTCCCTCCCCACCACTTAGGAGG + Intronic
1007391122 6:41549850-41549872 TTCCTACCCCACTGCCTTGGCGG + Intronic
1007721162 6:43886239-43886261 CCCCCATCCCACCCCCTGGGCGG + Intergenic
1007784827 6:44273570-44273592 CTCCCTCCCCACCTCCCTGGGGG + Intronic
1007927361 6:45661482-45661504 CTCCCACCTCACTTCCTGAGTGG + Intronic
1010467688 6:76188308-76188330 CTCCCACCTCAGCCTCTGGGTGG - Intergenic
1011297419 6:85839158-85839180 CTGCCACCACCCCGTCTGGGAGG + Intergenic
1013272891 6:108559726-108559748 CGCCCAGCCCTCCCCCTGGGCGG + Intergenic
1014143017 6:117965614-117965636 TTCCCACCCCACAGCTGGGGTGG + Intronic
1015533459 6:134244120-134244142 CTCCCACCCCACCCCCTGACAGG + Intronic
1015897848 6:138034450-138034472 CACCCACCCCACCGGCTCAGTGG + Intergenic
1016516000 6:144893532-144893554 CTTCCACCCCACCTCTCGGGGGG + Intergenic
1019346219 7:532000-532022 CTCCCACCCCAACGCCCGTCAGG + Intergenic
1019352664 7:562239-562261 CCCCCACCTCCCCGCCTGGCAGG - Intronic
1019522814 7:1468296-1468318 CCCCCACCCCGCAGCCTGGCTGG + Intergenic
1022099639 7:27161517-27161539 CCCCCACCCCGCCGCCAGGTTGG - Intergenic
1022404815 7:30078877-30078899 CTCCAACCCCTTCACCTGGGGGG + Exonic
1024230487 7:47359985-47360007 TTCCCACCCTACCACCTTGGTGG - Intronic
1025821569 7:64968148-64968170 CCCCCACCTCACCTCCTGGACGG + Intergenic
1026245090 7:68612492-68612514 CCCCCACCCTACCCCCTGGCAGG + Intergenic
1026841377 7:73671435-73671457 CTCCTCCCCCACTGCCTGGGTGG + Exonic
1029576905 7:101409510-101409532 CTGCCATGCCACCGACTGGGTGG + Intronic
1032196596 7:129792908-129792930 TTCCCAGCCCCCCGCCGGGGAGG + Intergenic
1033157342 7:138968181-138968203 CTCCCACCCCACCTACCGAGAGG - Intronic
1034562537 7:151890506-151890528 CTCCCACCTCACTGCGTGGGCGG + Intergenic
1035606773 8:934551-934573 CTTCCTCTCCACCCCCTGGGAGG - Intergenic
1035667442 8:1389324-1389346 CACCCTCCCCACTGACTGGGAGG - Intergenic
1035911564 8:3572186-3572208 CTCCCACCGCCCTTCCTGGGTGG - Intronic
1036633212 8:10529837-10529859 CACCCACCCCCCAGCCTGTGGGG + Intronic
1041036594 8:53797627-53797649 CACCCACCCCACCTTATGGGTGG + Intronic
1041839243 8:62249256-62249278 CACCCTCCCCACCGCCTGGCTGG + Intronic
1042523493 8:69740240-69740262 CTCCCACCCCAACTCCTGGAGGG - Intronic
1044792795 8:95864944-95864966 TTCCCACCCCACCCTCTGTGTGG - Intergenic
1045304827 8:100950645-100950667 CCCCCCCCCCACGGCTTGGGCGG - Intronic
1048296623 8:133219368-133219390 CTCCTCCCCCAACCCCTGGGCGG + Intronic
1049539761 8:143202938-143202960 CTCCCAACTCACCACCTGGCTGG + Intergenic
1051663641 9:19448115-19448137 CTCCCACCTCACCCCCTGCAGGG + Intronic
1052274908 9:26664614-26664636 CTCCCACCCCCCAGACGGGGCGG - Intergenic
1053003924 9:34592101-34592123 AGCCCTCCCCACCGCCTTGGGGG + Intergenic
1053266405 9:36717542-36717564 CACCCACCTCACGGCCTGGCTGG + Intergenic
1053393360 9:37751859-37751881 CTCCCTCCCCACCTCCCGGCAGG - Intronic
1056706823 9:88959221-88959243 CGGCCACCACCCCGCCTGGGAGG - Intergenic
1061480661 9:130896363-130896385 CTCCCACCGCATACCCTGGGTGG + Intergenic
1061937481 9:133866150-133866172 CTCCCCACCCACCCCCTGGGGGG - Intronic
1061958123 9:133974158-133974180 CTCCCTCCACACTGCCTGTGTGG + Intronic
1062177893 9:135174452-135174474 CTCCCTGCCCACCTCCTGGCCGG + Intergenic
1062178981 9:135180554-135180576 CTCCCAACCTCCTGCCTGGGGGG - Intergenic
1062317410 9:135974918-135974940 CTTCCACCACACCGCATCGGGGG + Intergenic
1062323754 9:136003059-136003081 CTCCCTCCCCTCCAGCTGGGAGG - Intergenic
1062402243 9:136377819-136377841 CTCGCCCCCCACCACCAGGGAGG + Exonic
1062499940 9:136847969-136847991 CGCCCTGCCCACCGCCTCGGCGG - Exonic
1062502024 9:136855750-136855772 CTCCCAGCCCCCAGCCTCGGGGG - Exonic
1062567017 9:137167973-137167995 CGCCCACCCCGCTGCCTGGCGGG + Exonic
1062599490 9:137313493-137313515 CTCCCACCCCACCTTCTCAGGGG - Intronic
1062721584 9:138047058-138047080 CTCCCCCGCCACAGCCTGGCGGG - Intronic
1203463743 Un_GL000220v1:67874-67896 CTGCCACCACCCCGTCTGGGAGG - Intergenic
1203467450 Un_GL000220v1:100714-100736 CCCCCCCACCACCGCCTTGGTGG + Intergenic
1185935877 X:4256972-4256994 CTCCCACCCCACCAACTCGGAGG - Intergenic
1189145777 X:38653300-38653322 TGCTCACCCCACAGCCTGGGAGG - Intronic
1190188287 X:48255023-48255045 ATCCCTCCCCACCTCCTCGGTGG - Intronic
1190630523 X:52381244-52381266 CTCACACTACACCTCCTGGGGGG - Intergenic
1191651663 X:63544925-63544947 CCCCCACCCCACCCTCTGGCAGG - Intergenic
1192118593 X:68433940-68433962 TCCCCACCACCCCGCCTGGGAGG + Intergenic
1192208458 X:69111269-69111291 CTCCCACCCCTCTTCCTGGCAGG - Intergenic
1193601033 X:83508648-83508670 TAACCACCCCAACGCCTGGGGGG + Exonic
1196960369 X:120993875-120993897 CTCCCTCTCCACTGCCAGGGTGG - Intergenic
1198600774 X:138282722-138282744 CTGCCCCCCCACCTCCTGGATGG + Intergenic
1200039544 X:153355504-153355526 CCCTGACCCCACAGCCTGGGAGG + Intronic
1200078030 X:153561506-153561528 CTCACACCCCACCTCCTGCCTGG - Intronic
1200284280 X:154805490-154805512 CTCCCGGCGCACCGCCTGCGGGG - Exonic