ID: 1161087458

View in Genome Browser
Species Human (GRCh38)
Location 19:2341583-2341605
Sequence CGACAGCGGTGGGGACCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161087458_1161087465 -9 Left 1161087458 19:2341583-2341605 CCGCCCGGTCCCCACCGCTGTCG 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1161087465 19:2341597-2341619 CCGCTGTCGCTGATACCATCTGG 0: 1
1: 0
2: 0
3: 2
4: 29
1161087458_1161087467 15 Left 1161087458 19:2341583-2341605 CCGCCCGGTCCCCACCGCTGTCG 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1161087467 19:2341621-2341643 ACTTCCTCCCAGCCTTCCTGAGG 0: 1
1: 0
2: 5
3: 52
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161087458 Original CRISPR CGACAGCGGTGGGGACCGGG CGG (reversed) Intronic
900189951 1:1349151-1349173 CGAGAGCGGTGCGGGCCGGGCGG - Intronic
900519572 1:3099053-3099075 CCAGAGCGGTGGGGGCCGTGTGG + Intronic
901024692 1:6272949-6272971 TGACAGCAGTGGGGACAGAGAGG + Intronic
901551255 1:9997560-9997582 AGACGGCCGTGGGGACAGGGGGG - Intronic
904822761 1:33256262-33256284 CGAGAGGGGAGGGGGCCGGGCGG - Intergenic
905416578 1:37808299-37808321 GGAGACCGGTGGGGACGGGGCGG + Exonic
907487461 1:54787696-54787718 CCACCGAGGTGGGGACCCGGGGG - Exonic
915325659 1:155080226-155080248 CCCCAGGGGAGGGGACCGGGAGG + Intronic
915835327 1:159171620-159171642 GGGCCGAGGTGGGGACCGGGAGG - Exonic
918487479 1:185045283-185045305 GGACCGCGGTGGGCGCCGGGGGG + Intergenic
920031190 1:203038380-203038402 TGACAGCTGTGGGGAGCAGGGGG + Intronic
1070257632 10:74825528-74825550 CGGCGGCGGTGGGTCCCGGGCGG + Intergenic
1072190504 10:93073518-93073540 GGGCAGCGGGTGGGACCGGGCGG + Intronic
1072805746 10:98423284-98423306 CACGAGGGGTGGGGACCGGGGGG - Intronic
1073214533 10:101829285-101829307 CGGCATCGGATGGGACCGGGGGG - Intronic
1073391022 10:103176351-103176373 CTGCAGGGGTGGGGACAGGGAGG - Intronic
1075645210 10:124092451-124092473 GGACAGCAGTGGGGGCGGGGCGG + Intronic
1075712897 10:124540291-124540313 CCACAGCCGTGTGGACCTGGAGG - Intronic
1075766725 10:124899160-124899182 GGACAGCAGTGGTGACTGGGCGG + Intergenic
1076416691 10:130295866-130295888 CGAAAGCGGTGGGGGGAGGGGGG + Intergenic
1076495164 10:130892499-130892521 TGACAGCGGAGGAGACAGGGAGG - Intergenic
1076747825 10:132523208-132523230 CCACAGCAGAGGGGACAGGGTGG - Intergenic
1076878956 10:133230795-133230817 CGTGCGCGTTGGGGACCGGGCGG - Exonic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1080387579 11:31818966-31818988 TGACAGTGGTGGGGCCCGGAGGG + Intronic
1081699987 11:45146839-45146861 CGGCAGCCGCGGGGCCCGGGCGG - Intronic
1083261996 11:61528232-61528254 AGCCAGCGGTGGGGACATGGGGG - Intronic
1084665322 11:70573265-70573287 CTGCAGCGGTGGGGGCGGGGGGG + Intronic
1084981119 11:72829288-72829310 CGGCAGCGCTGGGGAAAGGGAGG - Exonic
1085207445 11:74744631-74744653 CAACAGCAGTGGGGCCCTGGTGG - Intergenic
1088315013 11:108498416-108498438 CGGCAGCGCCGCGGACCGGGCGG + Exonic
1092899385 12:13044463-13044485 CAACACCGGCGGGGACTGGGTGG - Intronic
1096983754 12:55743429-55743451 CGGCAGCGGCGGGGGTCGGGGGG + Exonic
1097324797 12:58264279-58264301 CGACAGGGGTGGGGGTCGGGGGG - Intergenic
1098320709 12:69240143-69240165 CGGCAGCGGCGGGGAAGGGGCGG - Intronic
1102258030 12:111427511-111427533 CGACAGCAGTGGGGGCCCTGGGG + Intronic
1102461731 12:113104130-113104152 CCACCGCGATGGGGAGCGGGGGG - Intronic
1104787297 12:131457862-131457884 TGGCGGCGGTGGGGGCCGGGGGG - Intergenic
1105005113 12:132716822-132716844 GGACAGCTCTGGGGACTGGGGGG - Intronic
1105628624 13:22138665-22138687 GGACAGAAGTGGGGACAGGGTGG + Intergenic
1105943551 13:25171217-25171239 CGACAGCGGCGGGGGCGGCGGGG - Exonic
1113616982 13:111687128-111687150 TGACAGGGGTGGCCACCGGGCGG - Intergenic
1113622512 13:111772399-111772421 TGACAGGGGTGGCCACCGGGCGG - Intergenic
1113741770 13:112716313-112716335 CGACAGCTGTGGGAACCCGTGGG + Intronic
1114534894 14:23416606-23416628 AGGCAGAGGTGGGAACCGGGAGG + Intronic
1124089484 15:26584800-26584822 TGACAGTGGTGGGGAAAGGGTGG - Intronic
1128269213 15:66293819-66293841 CGCCAGCGGCGGGGACACGGAGG + Intronic
1129540407 15:76343069-76343091 AGACAGAGGCGGGGGCCGGGCGG + Intergenic
1131750697 15:95505055-95505077 GTACAGAGGTGGGGACCAGGAGG - Intergenic
1132370589 15:101295186-101295208 CCACAGCGCGGGGGAACGGGAGG - Exonic
1132519820 16:381945-381967 CGACGGCGGCGGGGACCGGCCGG - Exonic
1132752734 16:1466269-1466291 GGACGGCGTTGGGGGCCGGGAGG - Intronic
1132763663 16:1523796-1523818 GGCCACCGGTGGGGACCTGGGGG - Intronic
1134548131 16:15125816-15125838 CGACAGCAGTGGTCAGCGGGCGG + Intronic
1136053604 16:27671630-27671652 CAGCAGAGGTGGGGACAGGGAGG - Intronic
1136284183 16:29231570-29231592 GGACAGCACTGGGGACCTGGGGG - Intergenic
1136519674 16:30787298-30787320 GGACAGCGGTGGGAGCAGGGAGG + Intergenic
1139446370 16:67001028-67001050 CCAGAGCGGCGGGGACTGGGTGG + Intronic
1141116772 16:81315560-81315582 CCGCGGCGGTGGGAACCGGGAGG - Intronic
1141608576 16:85169240-85169262 CGGCGGCGGCGGGGCCCGGGCGG - Intergenic
1145932740 17:28697712-28697734 CTGCAGCGGTGGGGACCGCAAGG + Exonic
1146752448 17:35393932-35393954 CTACAGAAGTGGGGAACGGGAGG + Intergenic
1147261449 17:39211725-39211747 TGACAGAGGTGGAGACCAGGAGG + Exonic
1148085005 17:44988562-44988584 GGACAGCTGTGGGGACGGGCCGG - Intergenic
1148553608 17:48564785-48564807 GGACAGGAGTGGGGACAGGGAGG + Intronic
1148777954 17:50106081-50106103 CCACAGCGGCGGGGAGCGGGCGG + Intronic
1149891342 17:60392422-60392444 CGCCAGCGGAGGCGCCCGGGCGG - Intronic
1152921361 17:83068150-83068172 CGACAGCGGGGGCGACAGCGGGG + Intergenic
1152921539 17:83068627-83068649 CGACAGCGGGGGCGACAGCGGGG + Intergenic
1160992209 19:1864418-1864440 CGCCCGCGGCGGGGCCCGGGAGG + Intergenic
1161087458 19:2341583-2341605 CGACAGCGGTGGGGACCGGGCGG - Intronic
1161315312 19:3614759-3614781 CCACAGCGGAGGGGAGGGGGTGG + Intronic
1163607471 19:18282800-18282822 AGACAGAGGTGGGGAGCTGGAGG - Intergenic
1166219136 19:41353913-41353935 CGGCGGCGGCGGGGACCGGCTGG + Intronic
1166232515 19:41433432-41433454 GGACTGCGGTGGGGAGAGGGTGG + Exonic
1166858003 19:45792765-45792787 CGGCAGTGGCGGGGCCCGGGGGG - Exonic
1168144953 19:54415630-54415652 CGAAAACGCTGGGCACCGGGCGG - Exonic
1168317458 19:55490367-55490389 CGTCAGCAGAGGGGCCCGGGTGG - Exonic
926284978 2:11481933-11481955 CGGCGGCGGTGGGGAGAGGGCGG + Intergenic
927510780 2:23642645-23642667 CCACAGCGGTGGGTCCTGGGCGG - Exonic
927713835 2:25340945-25340967 GGCCCGCGGTGGGGACAGGGAGG + Intronic
928029438 2:27766171-27766193 TGACAGGGGTGGGGAGAGGGTGG - Intergenic
928140484 2:28724182-28724204 GGACAGCAGTGGGGGCTGGGAGG + Intergenic
933731078 2:85456672-85456694 TGACAGAGCTGGGGACTGGGCGG - Intergenic
934941481 2:98506169-98506191 AGACATGGGTGGGGACAGGGCGG + Intronic
935106119 2:100045146-100045168 CAACAGAGGTGGGGAAGGGGAGG + Intronic
935354695 2:102187576-102187598 CGGCGGCGGTGGGGACCGCGTGG - Intronic
943624295 2:190181047-190181069 GGACAGCCGTGGGGTCCCGGAGG - Exonic
946159376 2:217826731-217826753 CGGGAGAGGTGGGGACAGGGAGG + Intronic
948459446 2:238122081-238122103 CGACAGCGGTCGGGGCCGTGGGG + Intronic
948797703 2:240413143-240413165 GGACACCAGTGGGGACTGGGGGG + Intergenic
948903527 2:240967519-240967541 CGGCAGCAGTGGGGACATGGTGG - Intronic
1168965484 20:1895535-1895557 GTGCAGCGGTGGGGAGCGGGGGG - Intronic
1171771274 20:29325049-29325071 GGACGGGGGTTGGGACCGGGTGG + Intergenic
1171958317 20:31475971-31475993 AGAGAGCGGTGGGGAAGGGGAGG + Intronic
1172098727 20:32473363-32473385 CCACGGGGGTGGGGACCGGCGGG - Intronic
1172618656 20:36306286-36306308 CGAGAGCGGCGGGGAGGGGGCGG - Intergenic
1174379635 20:50148358-50148380 AGACTGAGGTGGGGACAGGGAGG + Intronic
1176027964 20:62995716-62995738 CGACTGTGGTGGGGGCCGTGTGG + Intergenic
1176129217 20:63489185-63489207 CATCGGCGGTGGGCACCGGGAGG + Intronic
1176157239 20:63627815-63627837 GGACAGCGGTGGGATCGGGGTGG - Intergenic
1176380780 21:6111280-6111302 CGGCAGCGGCGGGCTCCGGGCGG + Intronic
1178961893 21:37073252-37073274 CGACGGCGGGAGGGAGCGGGTGG - Intronic
1178992735 21:37368004-37368026 CCACACTGGTGGGGACCGAGAGG - Intronic
1179657795 21:42855956-42855978 GGACAACGGTGGGGAACGGAAGG + Intronic
1179742692 21:43426960-43426982 CGGCAGCGGCGGGCTCCGGGCGG - Intronic
1181060706 22:20280858-20280880 AGACAGCGCAGGAGACCGGGAGG + Intronic
1181387639 22:22557643-22557665 GGGCGGCGGTGGGGACCGGGGGG + Intronic
1182547794 22:31085678-31085700 ACACAGCGGTGGGGCCTGGGCGG + Intronic
1183379361 22:37483252-37483274 CGACAGTGGCGGGGACTAGGTGG - Intronic
1183515880 22:38265815-38265837 CGCTAGAGGTGGGGACCAGGAGG + Intronic
1183677395 22:39307175-39307197 GGACTCTGGTGGGGACCGGGTGG + Intergenic
1184285924 22:43471458-43471480 CCACAGCCGTGGGGCCTGGGTGG + Intronic
1184303322 22:43577001-43577023 GGACAGGGGTGGGGTCAGGGTGG - Intronic
1185148295 22:49150936-49150958 AGACAGCGCTGGGAACCAGGAGG + Intergenic
1185263338 22:49883818-49883840 AGACAGCGGTGGGGAGCGAGCGG + Exonic
1185424179 22:50755441-50755463 CCACAGCGCGGGGGAACGGGAGG - Intergenic
950412440 3:12847909-12847931 AGCCAGCAGTGGGGACAGGGAGG - Intronic
953012394 3:39039688-39039710 TGGCAGCGGTGGGTACCAGGTGG - Intergenic
953460210 3:43076103-43076125 CACCAGTGGTGGGGACTGGGAGG + Intergenic
954634011 3:52061830-52061852 AGCTAGCGGTGGGGACAGGGAGG - Intergenic
954708950 3:52495538-52495560 GGCCAGCGGTGGGAACAGGGAGG + Intronic
961332681 3:126152193-126152215 TGACAGAGGTGGGGACAGGCAGG + Intronic
966861817 3:184234734-184234756 GGACAGTGATGGGGACCGGCAGG + Exonic
966866522 3:184261482-184261504 CGGCGGTGGCGGGGACCGGGCGG + Intronic
968514267 4:1009806-1009828 GGACAGGGGCGGGGACGGGGAGG - Intergenic
968942609 4:3646601-3646623 CGCCAGTGCTGGGGACCAGGTGG + Intergenic
976690566 4:87863748-87863770 CCACGGCGGTGGGGGGCGGGAGG + Intergenic
980711388 4:136573146-136573168 CGAGAGCGGTGGGGTCGGGATGG - Intergenic
988609226 5:32710165-32710187 CAGCAGCGGTGGAGACCGGAGGG - Intronic
995048124 5:107672278-107672300 CGACAGCGGCGGCGACCCAGTGG + Intergenic
996690918 5:126338946-126338968 CGGCAGCGGTGGCGGCTGGGAGG - Intergenic
998335766 5:141371018-141371040 CCACAGCTGTGAGGACCAGGTGG - Exonic
999185026 5:149700859-149700881 CCACACCAGTGGGGACAGGGAGG - Intergenic
1000037538 5:157460365-157460387 CGGCAGGGCTGGGGACCAGGCGG + Intronic
1002071306 5:176680314-176680336 CGACAGCGGCGGCTCCCGGGAGG - Intergenic
1006547603 6:34792459-34792481 CGACAACGGTGGGCGCCGGCGGG - Intronic
1014978274 6:127916340-127916362 GGACAGTGGTGGGGACTGGGTGG - Intronic
1015309850 6:131754806-131754828 ATACAGGGGTGGGGACGGGGCGG - Intergenic
1018893202 6:167996788-167996810 TGACAGCGGGGGGGACAGCGGGG + Intronic
1018926345 6:168209519-168209541 CGAGAGCAGTGGGGCCAGGGAGG - Intergenic
1019713232 7:2526819-2526841 CGTCACCTGTGGGGAGCGGGCGG - Exonic
1022018451 7:26376236-26376258 CGCCAGCGGAGCGGCCCGGGCGG - Intergenic
1025078706 7:55964564-55964586 CGTCAGCGGCGGCGCCCGGGCGG + Exonic
1035701448 8:1641970-1641992 TGACACAGGTGGGGACCGGCGGG - Intronic
1035701505 8:1642156-1642178 TGACACAGGTGGGGACCGGCGGG - Intronic
1035701593 8:1642435-1642457 TGACACAGGTGAGGACCGGGGGG - Intronic
1035701604 8:1642466-1642488 TGACACAGGTGAGGACCGGGGGG - Intronic
1035701642 8:1642590-1642612 TGACACAGGTGAGGACCGGGGGG - Intronic
1035701736 8:1642901-1642923 TGACACAGGTGAGGACCGGGGGG - Intronic
1035701747 8:1642932-1642954 TGACACAGGTGAGGACCGGGGGG - Intronic
1038035483 8:23682920-23682942 TGAAAGCGGTGCGGGCCGGGCGG - Exonic
1038824791 8:30988865-30988887 TGCCAGCGGTGGGGGCTGGGGGG + Intergenic
1041919831 8:63168975-63168997 CGGCAGCGGCGGCGACGGGGAGG - Intronic
1044988542 8:97775781-97775803 CTGCAGCGGCGGGGACGGGGAGG - Exonic
1048346020 8:133575185-133575207 GGGCAGCGGTGGGGGTCGGGAGG - Intergenic
1048554026 8:135457764-135457786 CCCCAGCGGCGGGGACCCGGGGG - Exonic
1049067484 8:140328894-140328916 TGACGGCTTTGGGGACCGGGTGG + Intronic
1053195026 9:36110793-36110815 GGAGAGGGGTGGGGGCCGGGTGG + Intronic
1057804685 9:98211729-98211751 CAACAGAGGTGGGCACCAGGTGG - Intronic
1060209095 9:121699474-121699496 CGGCGGCGCGGGGGACCGGGCGG - Intronic
1060292875 9:122320398-122320420 GGACAGGGATGGGGACTGGGAGG - Intronic
1060551595 9:124488043-124488065 CTGCAGGGGTGGGGACGGGGTGG - Intronic
1061855580 9:133440338-133440360 CGACAGCGGTGAGGATCGGAGGG + Exonic
1062142009 9:134964430-134964452 CCAGAGCGGTGGGCACCCGGAGG - Intergenic
1062610494 9:137371368-137371390 CGCCAGGGGTGGGGCCCGCGCGG + Intronic
1187143883 X:16620085-16620107 GGACAGGGGTGGGGAGTGGGGGG - Intronic
1199473347 X:148219532-148219554 CGACAGGGGTGGGGAGTGAGGGG + Intergenic
1200142986 X:153910907-153910929 CGAGAGAGGTGGGGACGGGCAGG - Exonic