ID: 1161091387

View in Genome Browser
Species Human (GRCh38)
Location 19:2361451-2361473
Sequence TTACTCAGAAGCGGCTCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161091387_1161091393 5 Left 1161091387 19:2361451-2361473 CCCTCGGAGCCGCTTCTGAGTAA No data
Right 1161091393 19:2361479-2361501 CACTGGGATGTAACAATTGGAGG No data
1161091387_1161091398 26 Left 1161091387 19:2361451-2361473 CCCTCGGAGCCGCTTCTGAGTAA No data
Right 1161091398 19:2361500-2361522 GGTGGGTGAAGGGCCTGAGATGG No data
1161091387_1161091399 27 Left 1161091387 19:2361451-2361473 CCCTCGGAGCCGCTTCTGAGTAA No data
Right 1161091399 19:2361501-2361523 GTGGGTGAAGGGCCTGAGATGGG No data
1161091387_1161091395 9 Left 1161091387 19:2361451-2361473 CCCTCGGAGCCGCTTCTGAGTAA No data
Right 1161091395 19:2361483-2361505 GGGATGTAACAATTGGAGGTGGG No data
1161091387_1161091394 8 Left 1161091387 19:2361451-2361473 CCCTCGGAGCCGCTTCTGAGTAA No data
Right 1161091394 19:2361482-2361504 TGGGATGTAACAATTGGAGGTGG No data
1161091387_1161091397 16 Left 1161091387 19:2361451-2361473 CCCTCGGAGCCGCTTCTGAGTAA No data
Right 1161091397 19:2361490-2361512 AACAATTGGAGGTGGGTGAAGGG No data
1161091387_1161091396 15 Left 1161091387 19:2361451-2361473 CCCTCGGAGCCGCTTCTGAGTAA No data
Right 1161091396 19:2361489-2361511 TAACAATTGGAGGTGGGTGAAGG No data
1161091387_1161091392 2 Left 1161091387 19:2361451-2361473 CCCTCGGAGCCGCTTCTGAGTAA No data
Right 1161091392 19:2361476-2361498 ACACACTGGGATGTAACAATTGG No data
1161091387_1161091400 28 Left 1161091387 19:2361451-2361473 CCCTCGGAGCCGCTTCTGAGTAA No data
Right 1161091400 19:2361502-2361524 TGGGTGAAGGGCCTGAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161091387 Original CRISPR TTACTCAGAAGCGGCTCCGA GGG (reversed) Intergenic
No off target data available for this crispr