ID: 1161094197

View in Genome Browser
Species Human (GRCh38)
Location 19:2379538-2379560
Sequence CTGTGAGAGGTGAGGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161094197_1161094201 2 Left 1161094197 19:2379538-2379560 CCTTCCTGCCTCACCTCTCACAG No data
Right 1161094201 19:2379563-2379585 CTCCTACCCCACCCCACACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161094197 Original CRISPR CTGTGAGAGGTGAGGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr