ID: 1161101507

View in Genome Browser
Species Human (GRCh38)
Location 19:2424171-2424193
Sequence GTTCCCGGCGCCGCAGCCAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 139}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161101507_1161101519 25 Left 1161101507 19:2424171-2424193 CCTGTGGCTGCGGCGCCGGGAAC 0: 1
1: 0
2: 0
3: 7
4: 139
Right 1161101519 19:2424219-2424241 AGAGAGGTGGCTGCTGTCGGCGG 0: 1
1: 0
2: 0
3: 26
4: 269
1161101507_1161101515 9 Left 1161101507 19:2424171-2424193 CCTGTGGCTGCGGCGCCGGGAAC 0: 1
1: 0
2: 0
3: 7
4: 139
Right 1161101515 19:2424203-2424225 GGGCCGTGCTGGTGGCAGAGAGG 0: 1
1: 0
2: 3
3: 24
4: 413
1161101507_1161101518 22 Left 1161101507 19:2424171-2424193 CCTGTGGCTGCGGCGCCGGGAAC 0: 1
1: 0
2: 0
3: 7
4: 139
Right 1161101518 19:2424216-2424238 GGCAGAGAGGTGGCTGCTGTCGG 0: 1
1: 0
2: 8
3: 59
4: 519
1161101507_1161101514 1 Left 1161101507 19:2424171-2424193 CCTGTGGCTGCGGCGCCGGGAAC 0: 1
1: 0
2: 0
3: 7
4: 139
Right 1161101514 19:2424195-2424217 CCGTTGCGGGGCCGTGCTGGTGG 0: 1
1: 0
2: 0
3: 5
4: 101
1161101507_1161101512 -2 Left 1161101507 19:2424171-2424193 CCTGTGGCTGCGGCGCCGGGAAC 0: 1
1: 0
2: 0
3: 7
4: 139
Right 1161101512 19:2424192-2424214 ACACCGTTGCGGGGCCGTGCTGG 0: 1
1: 0
2: 1
3: 2
4: 31
1161101507_1161101517 12 Left 1161101507 19:2424171-2424193 CCTGTGGCTGCGGCGCCGGGAAC 0: 1
1: 0
2: 0
3: 7
4: 139
Right 1161101517 19:2424206-2424228 CCGTGCTGGTGGCAGAGAGGTGG 0: 1
1: 0
2: 2
3: 31
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161101507 Original CRISPR GTTCCCGGCGCCGCAGCCAC AGG (reversed) Exonic
900154594 1:1198870-1198892 CTGCCCTGCTCCGCAGCCACGGG + Intergenic
900462500 1:2808448-2808470 GTTCCTGAGGACGCAGCCACAGG + Intergenic
900562269 1:3313167-3313189 GTTTCCGCCGCCTCATCCACAGG + Intronic
900596058 1:3480713-3480735 GAGCCCGGCACCACAGCCACAGG - Exonic
901744254 1:11362133-11362155 TTTCCAGGTGCTGCAGCCACAGG - Intergenic
901886836 1:12229698-12229720 GTTCCCCACTTCGCAGCCACAGG - Intergenic
902813580 1:18903129-18903151 ATTCCAGGGGCCGCAGCCCCCGG - Intronic
904215384 1:28914747-28914769 GAGCCCGGCCCCGGAGCCACCGG + Intronic
905328068 1:37171983-37172005 GTTCCAGGCGCTGCAGCCTGAGG - Intergenic
905763571 1:40581379-40581401 GTTCCCAGTCCCCCAGCCACAGG + Intergenic
910188890 1:84574631-84574653 CCTCTCGGCGCCGCAGACACTGG - Intergenic
911078968 1:93909370-93909392 GGAGCCGGAGCCGCAGCCACCGG - Exonic
918349771 1:183642951-183642973 GTTCCCTGCTCCCCAGCCCCTGG + Intronic
1064553116 10:16521722-16521744 GTGCCCGCCGCCGCCGCCGCTGG - Exonic
1069631194 10:69898006-69898028 CTTCCAGGCCCCGCAGCCCCAGG + Intronic
1069875903 10:71562681-71562703 GGTCCCAGCACCGCAGCCATGGG + Intronic
1071966591 10:90858106-90858128 GTCCCCGCCGCCGCCGCCTCCGG + Intergenic
1076614842 10:131748413-131748435 GGGCCCGGCACAGCAGCCACGGG + Intergenic
1076618439 10:131771775-131771797 GTCCCCTGGGCCGGAGCCACTGG + Intergenic
1082991433 11:59210755-59210777 GTTCCAGGCACTGCAGCAACTGG - Exonic
1083000565 11:59287379-59287401 GTTCCAGGCACTGCAGCAACTGG - Intergenic
1084128768 11:67118441-67118463 GGCCCCGGCGCCGCCGCCACGGG - Intergenic
1084193280 11:67508597-67508619 GCTGCCGTCGCCGCTGCCACCGG + Exonic
1089842104 11:121427321-121427343 GGTCCCGGCCCCGCAGCGCCCGG + Intergenic
1089981893 11:122779565-122779587 GTTCTCGGCCCCGCTGCCCCTGG + Exonic
1091284066 11:134398344-134398366 GTTCCAGGATCCGAAGCCACTGG - Intronic
1092860736 12:12717302-12717324 GCTCCCGCCGCCGCAACCAATGG + Exonic
1094841702 12:34345066-34345088 GTTCCCGCCGCCGGAGCTGCTGG - Intergenic
1103595346 12:122021795-122021817 CCTCCGGGCGCCGCGGCCACCGG - Exonic
1103775505 12:123364305-123364327 GGTCCCGGACCCGCAGCCCCCGG + Intronic
1106322965 13:28659274-28659296 GCTGCCGCCGCCGCCGCCACCGG - Intronic
1108063431 13:46553978-46554000 TTCCCTGGCGCGGCAGCCACAGG - Intronic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1121007770 14:90501193-90501215 CTTCCCGGCCCTGCAGCCCCAGG + Intergenic
1121622536 14:95360477-95360499 AGTCCCGGCGCCGCGGCCAAGGG - Intergenic
1122940759 14:104980362-104980384 GTTAGCCGCGCTGCAGCCACCGG + Intergenic
1130348017 15:83066898-83066920 GGTCGCGGCGCCGCCGCCGCTGG - Exonic
1132605344 16:791378-791400 GTTCCCGGCGGCACAGCCAGCGG - Intronic
1133218413 16:4307456-4307478 GTTCCAGGCGCAAGAGCCACAGG - Intergenic
1136500955 16:30669502-30669524 GTTCCCGGGGCCGCAGCAGGTGG - Exonic
1143625984 17:8110360-8110382 GAGCCCGGCGCCGCCGCCCCGGG - Intronic
1144547943 17:16215274-16215296 GCTCCCGGGGCAGCAGCCGCTGG - Intronic
1145058691 17:19718997-19719019 GCTCCCCCCGCCCCAGCCACAGG - Intergenic
1147535042 17:41315381-41315403 GCACCCGGAGCCGCAGCAACTGG + Exonic
1148325647 17:46782061-46782083 TTTCCCTGGGCCGCAGCCCCTGG - Intronic
1148406869 17:47423689-47423711 GGTCCCGGCGCCCCAACCGCCGG - Intronic
1149461541 17:56833696-56833718 GATGCCGGCGCCGCCGCCGCCGG - Exonic
1149996376 17:61408156-61408178 GCTGCCGCCGCCGCAGCCGCCGG + Exonic
1152650046 17:81488477-81488499 GTTTCCGGCGCCGCTGCCCTCGG + Intergenic
1152727915 17:81956747-81956769 GTACCTGGAGCCACAGCCACAGG + Exonic
1153923261 18:9809979-9810001 GTTCCCGTCTCCCCTGCCACAGG + Intronic
1158653564 18:59308640-59308662 GTTCCTAGCGCCGCGGCCACTGG - Intronic
1160486827 18:79300588-79300610 GTCCACGGCCCCGCAGCCCCGGG - Intronic
1160684513 19:427338-427360 GTTCCCGGCTCAGCATGCACTGG + Intronic
1160831989 19:1108474-1108496 TTTCCCGGCGCCGCTGTCCCTGG - Exonic
1161101507 19:2424171-2424193 GTTCCCGGCGCCGCAGCCACAGG - Exonic
1161527950 19:4769115-4769137 GTCCCCGCCTCGGCAGCCACGGG + Intergenic
1161650246 19:5479977-5479999 GGTCCCAGAGCCCCAGCCACCGG + Intergenic
1162124220 19:8490565-8490587 GCGCCCGGCCCCGCAGCCCCGGG - Intronic
1162311989 19:9913403-9913425 GCTGCCGCCGCCGCAGCCCCCGG - Intronic
1163586950 19:18169342-18169364 GCTCCCGCCGCCGCAGCCTCCGG - Exonic
1165807924 19:38593114-38593136 GTTCTCTGCACTGCAGCCACGGG - Intronic
1168401117 19:56086874-56086896 GTCCCCGGAGCGGCAGCCGCCGG + Intergenic
1168689713 19:58369120-58369142 GCTCCCGGGGCTGCAGCCTCGGG - Exonic
1168692714 19:58386546-58386568 GCTCCCGCCGCCGCAACCCCGGG + Intronic
926090495 2:10045738-10045760 GGTCAGGGCGCCGCGGCCACTGG + Intronic
927963528 2:27255326-27255348 GTTCCTGGCAGCGCAGGCACTGG + Exonic
928166513 2:28976491-28976513 GCTCCCTGCCCCACAGCCACAGG - Intronic
929107251 2:38377197-38377219 GTCGCCGGCGCCACAGCCCCTGG + Exonic
931517830 2:63059937-63059959 GTTCCCGCCGCCGCTGCCCAGGG - Intergenic
934657405 2:96123410-96123432 GTTCCCAGGGTCCCAGCCACAGG + Intergenic
935109205 2:100076531-100076553 GTTCCCGGGGCTGGAGCCATAGG - Intronic
937218327 2:120326897-120326919 GTTCCCTGAGGCGCAACCACAGG + Intergenic
945793368 2:214332387-214332409 GTTCCTGGCACCACAGCTACTGG + Intronic
946688198 2:222292177-222292199 CTTCCCGGCGCAGCAGCTATTGG + Intronic
1172155394 20:32820301-32820323 GGTCCCTGCGCTGCAGCGACTGG + Intronic
1172587265 20:36093469-36093491 GGTCCAGGCGCCGCCGCCGCTGG + Intronic
1173730554 20:45325492-45325514 GTTCCCCTCACCGCAGCCACTGG + Exonic
1174102401 20:48137625-48137647 GCTCCTGGCGCAGCAGTCACTGG + Intergenic
1175837451 20:62005158-62005180 GTTCCCTGCGCCGCAGGGCCTGG - Intronic
1175899060 20:62352911-62352933 ATTCCTGGCGCCACAGCCCCTGG + Intronic
1176164211 20:63664391-63664413 GTCCCAGGCCCAGCAGCCACCGG - Intronic
1176426635 21:6552614-6552636 GTTCCCGTCGAGGCAGCCAATGG + Intergenic
1176548989 21:8213477-8213499 AACCCCGGCGCCGCGGCCACGGG - Intergenic
1176556882 21:8257689-8257711 AACCCCGGCGCCGCGGCCACGGG - Intergenic
1176567918 21:8396507-8396529 AACCCCGGCGCCGCGGCCACGGG - Intergenic
1176575822 21:8440726-8440748 AACCCCGGCGCCGCGGCCACGGG - Intergenic
1179253716 21:39697066-39697088 GTTCCGGGGGCCTCAGCGACGGG - Intergenic
1179656969 21:42851710-42851732 CTTCCTGCAGCCGCAGCCACGGG + Intronic
1179702126 21:43160936-43160958 GTTCCCGTCGAGGCAGCCAATGG + Intronic
1180086920 21:45511866-45511888 GTTCCTAGCGAGGCAGCCACAGG + Intronic
1182364207 22:29766957-29766979 GAGCCCGGAGCTGCAGCCACCGG - Exonic
1183531378 22:38355514-38355536 GTTCCTGGCTCCGCCACCACCGG - Intronic
1183913082 22:41092915-41092937 GGTCCCCGCGCCGCACCCAGGGG - Exonic
1184403673 22:44287902-44287924 GTTCCCATGGCAGCAGCCACGGG + Intronic
1203253873 22_KI270733v1_random:129784-129806 AACCCCGGCGCCGCGGCCACGGG - Intergenic
1203261929 22_KI270733v1_random:174863-174885 AACCCCGGCGCCGCGGCCACGGG - Intergenic
950211586 3:11127216-11127238 GTTCTCTGCACCGCAGCCAGAGG - Intergenic
952867192 3:37862004-37862026 GCTCCCGCCGCCGCCGCCGCTGG - Intronic
954634600 3:52064743-52064765 GTTCCCTGCTCCAAAGCCACGGG + Intergenic
956420213 3:69079951-69079973 GATCCCCGCCCCGCAGCCCCGGG - Intronic
963744203 3:149109686-149109708 GTCCCCTGCTCCACAGCCACCGG + Intergenic
968484439 4:852163-852185 GTTCCCGTCGCCCCAGCACCTGG - Intronic
968487734 4:872021-872043 GTTCCTGGCCCTGCAGACACTGG - Intronic
968601880 4:1513373-1513395 GTGCGCGGCGCCGGAGCCGCTGG + Intergenic
972574001 4:40335240-40335262 GTTCCCGGCTTCTCAGCCACTGG + Intergenic
973613596 4:52659014-52659036 GCCCCCGCCGCCCCAGCCACCGG + Intronic
976765360 4:88592698-88592720 GCCCCCGCCGCCGGAGCCACGGG - Intronic
982198198 4:152936514-152936536 CTTCTCGGCGCCTCAGCCTCGGG - Intronic
985781893 5:1875910-1875932 ATTCCTGGCGCCCCAGCCTCGGG + Intergenic
997583978 5:135034036-135034058 CCGCCCGGCGCCGCAGCCCCGGG - Exonic
1001094617 5:168766623-168766645 TTTACTGGCCCCGCAGCCACAGG - Intronic
1006421253 6:33935533-33935555 GCTCCCGCCCCTGCAGCCACTGG - Intergenic
1008132627 6:47736298-47736320 GTTCGTGGCGCCTCAGCCAGAGG - Intergenic
1013155803 6:107490254-107490276 GCTCCCGCCGCCGCCGCCGCCGG - Exonic
1013359540 6:109381965-109381987 GGCCCCAGCCCCGCAGCCACTGG + Intronic
1016800573 6:148164841-148164863 GCTCCCAGAGCCACAGCCACCGG - Intergenic
1019153278 6:170023211-170023233 GTTCCCGGCGCGCTAGCCTCGGG - Intergenic
1019175441 6:170157128-170157150 GTTCCCAGGCCGGCAGCCACAGG + Intergenic
1021992595 7:26152436-26152458 GGTCCCGGCGCCCCAGCCGCCGG - Exonic
1023016341 7:35971602-35971624 GTTCCCTGCGCCGCCGCCTTCGG + Intergenic
1026732647 7:72925128-72925150 GCTCCAGCCGCCGCAGCCGCCGG - Intronic
1027111417 7:75442691-75442713 GCTCCAGCCGCCGCAGCCGCCGG + Intronic
1027283646 7:76627224-76627246 GCTCCAGCCGCCGCAGCCGCCGG + Exonic
1034355912 7:150450759-150450781 GGCCCCGGCGCCCCAGCCCCTGG + Exonic
1035464182 7:159064253-159064275 GTCCCCTGCCCCGGAGCCACTGG + Intronic
1037928847 8:22865548-22865570 GGTGCCGGTGCCGCAGCCGCCGG + Intronic
1039665526 8:39522814-39522836 GTAGCCGGCGGCCCAGCCACAGG + Intergenic
1039949009 8:42153263-42153285 CTTCCCGGCGCCGCGGCTGCGGG + Intronic
1042040080 8:64580922-64580944 GTCCCTGGCGCCGCCGCCTCGGG + Exonic
1043502898 8:80874118-80874140 GTCCCCGGCCCTGCGGCCACCGG - Intronic
1049532154 8:143160076-143160098 GTTCCCGGCCCCCCAGCCCAGGG - Intronic
1049762201 8:144336655-144336677 GGGCCCGGCGCCGCCGCCCCCGG - Intergenic
1050878999 9:10675665-10675687 GTTGCTGGAGCTGCAGCCACTGG + Intergenic
1052809420 9:33044263-33044285 GTTCGCGCAGCCGCTGCCACCGG + Exonic
1060209099 9:121699481-121699503 GTCCCCCGCGCCGCCGCCCCGGG + Intronic
1061857437 9:133449906-133449928 GTTCCGGGCGAGGCAGCCCCTGG - Exonic
1062279548 9:135745823-135745845 GCTCCCGGCCCGGCAGCCAGAGG - Intronic
1203470273 Un_GL000220v1:112928-112950 AACCCCGGCGCCGCGGCCACGGG - Intergenic
1203478094 Un_GL000220v1:156900-156922 AACCCCGGCGCCGCGGCCACGGG - Intergenic
1187564418 X:20434303-20434325 GTTCCTGGAGCAGCAGCCAAAGG + Intergenic
1192507328 X:71696606-71696628 TTTCCCTGCCCCGCAGCCTCTGG - Intergenic
1192519368 X:71784946-71784968 TTTCCCTGCCCCGCAGCCTCTGG + Intergenic
1194666821 X:96685068-96685090 GCTCCCGACGCCGCCGCCCCGGG - Exonic
1195938018 X:110143672-110143694 GTTACAGGCTCCCCAGCCACAGG - Intronic
1196245348 X:113392535-113392557 GTTGCCAGAGCTGCAGCCACTGG + Intergenic
1201486006 Y:14495333-14495355 GTTCCCTGGGCTGCAGACACTGG - Intergenic