ID: 1161101674

View in Genome Browser
Species Human (GRCh38)
Location 19:2424720-2424742
Sequence CTGCAGGGCTGGAGGTCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161101670_1161101674 -9 Left 1161101670 19:2424706-2424728 CCCAGCTCTGGGCTCTGCAGGGC 0: 1
1: 1
2: 3
3: 62
4: 485
Right 1161101674 19:2424720-2424742 CTGCAGGGCTGGAGGTCAGAAGG No data
1161101664_1161101674 11 Left 1161101664 19:2424686-2424708 CCGGTTTTCCAGAGGGGACACCC 0: 1
1: 0
2: 2
3: 10
4: 152
Right 1161101674 19:2424720-2424742 CTGCAGGGCTGGAGGTCAGAAGG No data
1161101671_1161101674 -10 Left 1161101671 19:2424707-2424729 CCAGCTCTGGGCTCTGCAGGGCT 0: 1
1: 0
2: 8
3: 76
4: 544
Right 1161101674 19:2424720-2424742 CTGCAGGGCTGGAGGTCAGAAGG No data
1161101660_1161101674 28 Left 1161101660 19:2424669-2424691 CCTGGCAGTCGAGGGGTCCGGTT 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1161101674 19:2424720-2424742 CTGCAGGGCTGGAGGTCAGAAGG No data
1161101659_1161101674 29 Left 1161101659 19:2424668-2424690 CCCTGGCAGTCGAGGGGTCCGGT 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1161101674 19:2424720-2424742 CTGCAGGGCTGGAGGTCAGAAGG No data
1161101665_1161101674 3 Left 1161101665 19:2424694-2424716 CCAGAGGGGACACCCAGCTCTGG 0: 1
1: 0
2: 1
3: 30
4: 237
Right 1161101674 19:2424720-2424742 CTGCAGGGCTGGAGGTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161101674 Original CRISPR CTGCAGGGCTGGAGGTCAGA AGG Intronic
No off target data available for this crispr