ID: 1161104027

View in Genome Browser
Species Human (GRCh38)
Location 19:2434486-2434508
Sequence CTCCCGAATGCGATCTTCAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 36}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161104023_1161104027 -7 Left 1161104023 19:2434470-2434492 CCATGGCCTCCTCCAGCTCCCGA 0: 1
1: 0
2: 4
3: 50
4: 533
Right 1161104027 19:2434486-2434508 CTCCCGAATGCGATCTTCAGCGG 0: 1
1: 0
2: 0
3: 0
4: 36
1161104015_1161104027 16 Left 1161104015 19:2434447-2434469 CCGGAACTTGTCCCGCTCCCCGG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1161104027 19:2434486-2434508 CTCCCGAATGCGATCTTCAGCGG 0: 1
1: 0
2: 0
3: 0
4: 36
1161104014_1161104027 26 Left 1161104014 19:2434437-2434459 CCAGCATCTTCCGGAACTTGTCC 0: 1
1: 0
2: 2
3: 7
4: 119
Right 1161104027 19:2434486-2434508 CTCCCGAATGCGATCTTCAGCGG 0: 1
1: 0
2: 0
3: 0
4: 36
1161104018_1161104027 5 Left 1161104018 19:2434458-2434480 CCCGCTCCCCGGCCATGGCCTCC 0: 1
1: 0
2: 3
3: 68
4: 605
Right 1161104027 19:2434486-2434508 CTCCCGAATGCGATCTTCAGCGG 0: 1
1: 0
2: 0
3: 0
4: 36
1161104021_1161104027 -2 Left 1161104021 19:2434465-2434487 CCCGGCCATGGCCTCCTCCAGCT 0: 1
1: 1
2: 1
3: 50
4: 486
Right 1161104027 19:2434486-2434508 CTCCCGAATGCGATCTTCAGCGG 0: 1
1: 0
2: 0
3: 0
4: 36
1161104020_1161104027 -1 Left 1161104020 19:2434464-2434486 CCCCGGCCATGGCCTCCTCCAGC 0: 1
1: 1
2: 8
3: 44
4: 479
Right 1161104027 19:2434486-2434508 CTCCCGAATGCGATCTTCAGCGG 0: 1
1: 0
2: 0
3: 0
4: 36
1161104022_1161104027 -3 Left 1161104022 19:2434466-2434488 CCGGCCATGGCCTCCTCCAGCTC 0: 1
1: 0
2: 5
3: 85
4: 1058
Right 1161104027 19:2434486-2434508 CTCCCGAATGCGATCTTCAGCGG 0: 1
1: 0
2: 0
3: 0
4: 36
1161104019_1161104027 4 Left 1161104019 19:2434459-2434481 CCGCTCCCCGGCCATGGCCTCCT 0: 1
1: 0
2: 7
3: 71
4: 733
Right 1161104027 19:2434486-2434508 CTCCCGAATGCGATCTTCAGCGG 0: 1
1: 0
2: 0
3: 0
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161104027 Original CRISPR CTCCCGAATGCGATCTTCAG CGG Exonic
908050750 1:60227299-60227321 CTCACAAATGCAATCTCCAGTGG + Intergenic
923978235 1:239289264-239289286 TTCCTGAATGCATTCTTCAGAGG - Intergenic
1066236652 10:33491362-33491384 ATCCCTAGTGCGATATTCAGTGG + Intergenic
1070484759 10:76919378-76919400 CTCCCCACTCCAATCTTCAGTGG + Intronic
1073951735 10:108816993-108817015 CTCCAGAATATTATCTTCAGGGG + Intergenic
1075404001 10:122182325-122182347 CTCCTGAATGAGGCCTTCAGAGG - Intronic
1085201524 11:74705088-74705110 CTGCCTGATGCCATCTTCAGAGG - Intronic
1090089533 11:123682790-123682812 CTCCCCAATTCTATGTTCAGGGG - Intergenic
1119089248 14:71765331-71765353 CTCCCAAATGGGATCTTTATAGG + Intergenic
1121717820 14:96088764-96088786 CTCCCGACTGCCATCTCCATGGG - Exonic
1121795482 14:96731821-96731843 CTCACTAATGCGATCATCACTGG - Intergenic
1122151193 14:99727024-99727046 CTCCCTAAAGCCCTCTTCAGGGG + Exonic
1128603802 15:69019214-69019236 CTCCCGACTGGGATGGTCAGAGG + Intronic
1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG + Intronic
1141460548 16:84176437-84176459 CTCAGGAATGGGACCTTCAGAGG - Intronic
1141677158 16:85523951-85523973 CTCCCCAAGGCGTTCCTCAGTGG - Intergenic
1148793923 17:50188290-50188312 CTCCCCACTGCAATCTTCACGGG + Intronic
1151897334 17:76989299-76989321 CTCCAAAATATGATCTTCAGAGG + Intergenic
1161104027 19:2434486-2434508 CTCCCGAATGCGATCTTCAGCGG + Exonic
1164853404 19:31502679-31502701 CTCCAGAAGGTGATCTGCAGTGG - Intergenic
928417402 2:31107476-31107498 CTCCGAAATGCCATTTTCAGTGG - Intronic
934103472 2:88675238-88675260 CTCCAGCATGCTATTTTCAGGGG - Intergenic
935822472 2:106908083-106908105 CTCCCTAATAGGGTCTTCAGAGG - Intergenic
947789960 2:232859803-232859825 CTCCGGAATGGCAGCTTCAGAGG + Intronic
947793448 2:232880366-232880388 CTCCCAAATGAGACCTGCAGAGG - Intronic
948371795 2:237494289-237494311 CTCCCTCCTGCCATCTTCAGCGG - Intronic
1170810421 20:19669926-19669948 CTACAGAATGGGATCCTCAGAGG + Intronic
1171555730 20:26081423-26081445 CTGCCGAGGGCGATCTTCTGGGG + Intergenic
1171813309 20:29762677-29762699 CCCCCCACTGCGTTCTTCAGTGG + Intergenic
1173199887 20:40946482-40946504 ATCTTGAATGAGATCTTCAGGGG - Intergenic
960321830 3:116246271-116246293 TTCCTGAATGCAATCTTCTGAGG + Intronic
972554850 4:40171556-40171578 CTCCTGAATGTGATCTTAATTGG + Intergenic
993764930 5:91844473-91844495 CTCACTAATGCCATCTTCAAAGG - Intergenic
999255379 5:150207003-150207025 CTCAGGAATGCCAGCTTCAGAGG + Intronic
1031950953 7:127891648-127891670 CTCACTAATGAGATCTGCAGAGG - Intronic
1048001113 8:130380242-130380264 CTCCCGAAGGTCACCTTCAGTGG - Intronic
1051952718 9:22656263-22656285 CTCCCGAATGCAATCCACTGTGG + Intergenic