ID: 1161104084

View in Genome Browser
Species Human (GRCh38)
Location 19:2434660-2434682
Sequence GGGCATCGCTGGGCGCCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161104070_1161104084 15 Left 1161104070 19:2434622-2434644 CCAGGCCTGGGCATGGGGCGCAC 0: 1
1: 0
2: 3
3: 30
4: 263
Right 1161104084 19:2434660-2434682 GGGCATCGCTGGGCGCCCCGAGG 0: 1
1: 0
2: 0
3: 12
4: 173
1161104073_1161104084 10 Left 1161104073 19:2434627-2434649 CCTGGGCATGGGGCGCACGGGAG 0: 1
1: 0
2: 2
3: 18
4: 173
Right 1161104084 19:2434660-2434682 GGGCATCGCTGGGCGCCCCGAGG 0: 1
1: 0
2: 0
3: 12
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161104084 Original CRISPR GGGCATCGCTGGGCGCCCCG AGG Intronic
900100899 1:961567-961589 GGGCGGCGCTGGGGGCTCCGTGG + Intronic
900284059 1:1890892-1890914 GGGCCGCGCTGCGCGCTCCGCGG + Exonic
901762169 1:11478656-11478678 GGGCATCCCCGGGCGCCCTCCGG - Intergenic
901765923 1:11500044-11500066 GGGCAGGGCTGGGCAGCCCGAGG - Intronic
902374343 1:16023247-16023269 GGGCATTGCTGGGGACCCAGAGG + Intronic
903008541 1:20314472-20314494 GGGCAGCGTTGGGAGCTCCGAGG - Exonic
903448490 1:23437247-23437269 GGCCAGCGCTGGGCTCCCCGAGG + Exonic
903724340 1:25430120-25430142 GGGCAGCGCTGTGGGCCCCGCGG - Intronic
904583683 1:31566741-31566763 GGGCCTCCCTGGGCTCCCGGAGG - Intergenic
905536696 1:38728219-38728241 GGGCATGGCTGTGCCCCCCAAGG - Intergenic
905726695 1:40258282-40258304 GGGCATCGCTGGACGCTTTGTGG + Exonic
906492712 1:46280506-46280528 GGGGCTGGCTGGGCTCCCCGTGG + Exonic
906650405 1:47508637-47508659 GGGCTGCGCTGGGCACGCCGAGG + Intergenic
910676611 1:89821785-89821807 GGGCTGCGCTGGGAGCCCGGCGG + Intronic
915598134 1:156906815-156906837 GGGGATCGCAGGGTGCCCCATGG - Exonic
916802328 1:168226474-168226496 GGGTAGGGCTGGGGGCCCCGAGG + Intronic
919103591 1:193122366-193122388 GGGCAGAGTTGGGCGCCCCCAGG + Intronic
919972773 1:202591593-202591615 GGGGATCGCTGGTAGCCCTGAGG + Exonic
922546856 1:226464361-226464383 GGGCAGTGCTGGGGGACCCGGGG - Intergenic
923108829 1:230875022-230875044 GGGCATCCCTGGGAGGCCTGGGG + Intergenic
1063114907 10:3066846-3066868 GGGCGGCGCTGGGAGCCTCGGGG - Intronic
1065968133 10:30785208-30785230 GGGCGGCGCTGGGCGGCCCGGGG - Intergenic
1069636519 10:69928659-69928681 GGGCATCTCTGGTCGCCCTTTGG - Intronic
1072654303 10:97319656-97319678 GGGCGCCGCTGCGGGCCCCGGGG + Exonic
1076404008 10:130200666-130200688 GGCCAGCGCTGGGCTCCCCAGGG - Intergenic
1077369854 11:2176843-2176865 GGGCATCTCTGGGGACCCTGGGG - Intergenic
1078175086 11:8964308-8964330 CGCCATCGCTGGGGGCCCAGCGG + Exonic
1079129444 11:17738781-17738803 GGGAAAAGCTGGGCGCCCGGTGG + Intronic
1081871035 11:46382545-46382567 GGTCAGCGCTGCGCGGCCCGCGG - Intronic
1083225432 11:61281667-61281689 GGGCGTGGCTGGGCGCCGGGAGG + Intronic
1083560612 11:63670897-63670919 GGGCAGAGCCGGGCGCCCCAGGG - Intronic
1083781002 11:64917255-64917277 GGGCGTGGCTGGGCGTCCGGAGG - Intergenic
1084524070 11:69685034-69685056 GGGCATAGCTGGGGGCACCAAGG - Intergenic
1084573796 11:69975930-69975952 GGGCAGGGCTGGGGGCACCGAGG - Intergenic
1085455571 11:76663592-76663614 GGGCATCCCTGGGCCTCCTGAGG - Intronic
1085982831 11:81744865-81744887 GGGCGGCGCTGGGCGCTCCTGGG - Intergenic
1087672686 11:101127322-101127344 GCGCACCGCTGCGCTCCCCGGGG - Intronic
1088823320 11:113474764-113474786 GTGCTGCCCTGGGCGCCCCGCGG + Intronic
1090647451 11:128777227-128777249 GCGCAAGGCTGGGAGCCCCGAGG + Intronic
1092219051 12:6700562-6700584 GGGCAGGGCCGGGCTCCCCGCGG + Intronic
1094199288 12:27780314-27780336 CGACATGGCTGGGGGCCCCGGGG - Exonic
1094682649 12:32679590-32679612 GGGCCTTGCTGGGGGCCCCAGGG + Intronic
1097190242 12:57216334-57216356 GGGGATGGATGGGCGCCCCGCGG - Intergenic
1101144711 12:101830487-101830509 GGGCATCGCGGGGCACGGCGAGG + Intronic
1103294263 12:119872884-119872906 GGGCATCTCTGGGGCCCCGGAGG - Intronic
1103916902 12:124380443-124380465 GGGCATCCCTGTGGGCCCTGTGG - Intronic
1104013337 12:124947294-124947316 GGGCCTGGCTGGGGGCCCCCAGG - Exonic
1104568261 12:129903829-129903851 CGGGCTCGCTGGGCGGCCCGGGG + Intergenic
1104685313 12:130780988-130781010 GGGGATCGGTGGACGCTCCGTGG - Intergenic
1108662592 13:52600276-52600298 GGCCATCCCTGGGCGGCGCGCGG + Intergenic
1108662641 13:52600445-52600467 GGGCTGGGCTGGGCGCGCCGCGG - Intergenic
1114636331 14:24188875-24188897 GGGCGTTGCTGCACGCCCCGCGG + Exonic
1119432656 14:74578567-74578589 GGGCAGTGCTGGGTGCCCTGAGG - Intronic
1121546929 14:94769681-94769703 GAGCACTGCTGGGCGCCCAGCGG + Exonic
1122961073 14:105093799-105093821 GGGCTTGGTTGGGCGTCCCGGGG + Intergenic
1123045564 14:105511986-105512008 GGGAGTCTCGGGGCGCCCCGCGG - Intergenic
1123473024 15:20568830-20568852 GGGCACTGCTGGGGGCTCCGGGG - Intergenic
1123644982 15:22431523-22431545 GGGCACTGCTGGGGGCTCCGGGG + Intergenic
1123666274 15:22611299-22611321 GGGCACTGCTGGGGGCTCCGGGG + Intergenic
1123733322 15:23163841-23163863 GGGCACTGCTGGGGGCTCCGGGG - Intergenic
1123751456 15:23361233-23361255 GGGCACTGCTGGGGGCTCCGGGG - Exonic
1124283825 15:28385137-28385159 GGGCACTGCTGGGGGCTCCGGGG - Exonic
1124298872 15:28526477-28526499 GGGCACTGCTGGGGGCTCCGGGG + Exonic
1124320095 15:28705705-28705727 GGGCACTGCTGGGGGCTCCGGGG + Exonic
1124482417 15:30089712-30089734 GGGCACTGCTGGGGGCTCCGGGG - Exonic
1124488876 15:30141814-30141836 GGGCACTGCTGGGGGCTCCGGGG - Exonic
1124521160 15:30407497-30407519 GGGCACTGCTGGGGGCTCCGGGG + Exonic
1124537502 15:30558723-30558745 GGGCACTGCTGGGGGCTCCGGGG - Exonic
1124543960 15:30610778-30610800 GGGCACTGCTGGGGGCTCCGGGG - Exonic
1124754654 15:32396509-32396531 GGGCACTGCTGGGGGCTCCGGGG + Exonic
1124761154 15:32448864-32448886 GGGCACTGCTGGGGGCTCCGGGG + Exonic
1124777480 15:32600199-32600221 GGGCACTGCTGGGGGCTCCGGGG - Exonic
1129832829 15:78681838-78681860 GGGCCTCCCTGGGTGCACCGGGG + Intronic
1132203716 15:99972392-99972414 GGGCATATCTGGAGGCCCCGGGG + Exonic
1132414420 15:101610376-101610398 GGGCAACGCTGGGCGCTGCGCGG + Intergenic
1132945924 16:2531495-2531517 GGGCAGGGCTGGGAGCCCAGCGG - Intergenic
1134163840 16:11915188-11915210 GGCCTTCGCGGGGCGGCCCGCGG - Intronic
1136016485 16:27404163-27404185 GGGCATCGCTGAGCCCACGGTGG - Intronic
1137261136 16:46830996-46831018 GGGCCTCGCCGGGCTCCCGGAGG - Intronic
1139468909 16:67167885-67167907 GGGCATTCCTGGGCCCCTCGGGG - Exonic
1141657753 16:85425092-85425114 GGCCCTCCCTGGGCGCCCTGGGG + Intergenic
1141695947 16:85619499-85619521 GGGCATCGCTTGGCACCCCCGGG - Intronic
1142752621 17:1997986-1998008 GGACATCGCTGCCCGCCCCCAGG - Intronic
1142752795 17:1998505-1998527 GGGCAGCGGTGGCCGGCCCGGGG - Intronic
1142847894 17:2690971-2690993 GGGCAGCGAGGGGAGCCCCGAGG - Intronic
1143880560 17:10026535-10026557 GGGCATGGCTGGGCACGCCTGGG + Intronic
1145050305 17:19654512-19654534 TGGCATTGCTGGGGGACCCGGGG + Intronic
1151819503 17:76490029-76490051 GGGCACCGCTGGGGACCCCCAGG - Intronic
1152623889 17:81379662-81379684 GGGCATTGCTGGGCGCCGGAGGG - Intergenic
1152689380 17:81711152-81711174 GGGCATCGCTGGATGCGCAGAGG + Intergenic
1152833509 17:82513894-82513916 GGGCATGGCTGGGCGCGCCTGGG - Intergenic
1159943405 18:74426075-74426097 GGGCATGGCTGGGCCCAGCGAGG - Intergenic
1160826164 19:1081498-1081520 GCGCTGAGCTGGGCGCCCCGGGG + Intronic
1160855178 19:1214070-1214092 GGGCATCGCCAGCCGCTCCGAGG - Intronic
1160858525 19:1227907-1227929 GGACGGCGCTGGGCGCCCTGCGG - Exonic
1160943326 19:1630114-1630136 GGGCATTGCTGGCCGGGCCGTGG + Intronic
1160978470 19:1805854-1805876 TGGCATCGCTGGGGACCCTGGGG - Intronic
1161104084 19:2434660-2434682 GGGCATCGCTGGGCGCCCCGAGG + Intronic
1161456018 19:4370073-4370095 CGGCAGAGCTGGGCGCCACGGGG + Intronic
1162042271 19:7978085-7978107 GGGCACAACTGGGCTCCCCGAGG + Intronic
1163256752 19:16160682-16160704 GGGCATAGATGGGGGCCCTGGGG + Intergenic
1163662752 19:18588650-18588672 GGGCTTGACTGGGCGGCCCGCGG + Intronic
1164693113 19:30225693-30225715 GGGGATCGCGGGGCGCGGCGCGG + Intergenic
1165058605 19:33194378-33194400 GCGCAGCGCGGGGCGGCCCGGGG + Intronic
1165887005 19:39085341-39085363 GGGCAGCGCTGGGAGCCCCCAGG - Exonic
1165955790 19:39501332-39501354 GGACATCCCAGGGAGCCCCGTGG + Intronic
1166231191 19:41426645-41426667 GGGCTTGGCGGGGTGCCCCGAGG + Exonic
1166786530 19:45370456-45370478 GGTCATCGGTGGGCGCGCCTGGG - Intronic
1168315778 19:55484223-55484245 GGGCCCCGCGGGGCTCCCCGGGG + Exonic
1168689648 19:58368917-58368939 TGGCATCGCGGGGCGCCCGCTGG - Exonic
926801761 2:16665684-16665706 GGGCACCGCGGGGCACCGCGAGG - Intronic
927445456 2:23157025-23157047 GGGCATCACTGAGCACCACGAGG + Intergenic
927644775 2:24870666-24870688 GGTCATCCCTGGGTGCCCCAGGG - Intronic
929501241 2:42493496-42493518 GGTCATGGCTGGCCGCCCGGGGG + Exonic
932297725 2:70641104-70641126 AGCCATCGCTGGGAGCCCCAGGG - Intronic
932496252 2:72147308-72147330 GCGCCTCGCTAGGCGCCCCCGGG + Intronic
934538943 2:95159169-95159191 GCGCCGCGCTGGGCGCACCGGGG - Intronic
939153697 2:138501214-138501236 AGGCATCCCTGGCCGCCCCTCGG + Intergenic
948843703 2:240672859-240672881 GGGCGTGGCTGGGCGCGCTGGGG + Intergenic
948890100 2:240903355-240903377 GAGCCTGGCTGGGCCCCCCGGGG - Intergenic
1171406319 20:24914597-24914619 GGGCATCGCTGGGGGCTGCAGGG - Intergenic
1171520204 20:25770094-25770116 TGGCATGGCTGGGAGCCCTGGGG - Intronic
1171810374 20:29741849-29741871 GGGAATCCCTGGGCGCCCATGGG - Intergenic
1175509752 20:59515858-59515880 GGGCTTCTCTGGGAGCCCCTAGG - Intergenic
1175859741 20:62143753-62143775 CGGCTGCGCTGGGCGGCCCGAGG - Intergenic
1175862338 20:62157075-62157097 GGGCAGCACTGGGTGGCCCGCGG - Intronic
1175873634 20:62219669-62219691 CGGCCACGCTGGGCGCCCCTGGG + Intronic
1178351088 21:31873495-31873517 GCGCCTCGCTGGGCGGCGCGGGG + Exonic
1179712067 21:43269093-43269115 GTGCATCCCTGGGCTCCCCCGGG + Intergenic
1179885452 21:44312381-44312403 AGGGATCCCTGGGTGCCCCGAGG + Intronic
1184478940 22:44736188-44736210 GGGCCTCGCTGGCCGCTGCGTGG - Intronic
1184653683 22:45930792-45930814 GGGCTTGGCTGGGGACCCCGTGG - Intronic
949336271 3:2978749-2978771 GGGCATCGCTGATGGCCCCTGGG + Intronic
950339874 3:12233812-12233834 GGGCAGCGATGGGAGCTCCGTGG - Intergenic
952889241 3:38029770-38029792 GGGCAGAGCTGGGGGCCCGGAGG + Intergenic
954152296 3:48663554-48663576 GGGCAACGCCGGGCTCCACGTGG - Intergenic
961123541 3:124395320-124395342 TGGCCTCGCTGGGCTCCCCGAGG - Exonic
968427641 4:534192-534214 GGGCCTCGCCGGGCTCCCCAGGG + Intronic
968454154 4:688779-688801 GAGCAGGGCTGGGTGCCCCGGGG - Intronic
968508483 4:983523-983545 GGGCCTCGCTGGGCTCCCCCAGG + Intronic
968662425 4:1804265-1804287 GGGCATCCATGGGAGCCCCGTGG + Intronic
969411831 4:7033584-7033606 GGGCATCGCTCCGCTTCCCGAGG + Intergenic
985646582 5:1087639-1087661 GGGCATCGCTTGGTGCTCAGCGG - Intronic
986332722 5:6729557-6729579 GGGCAGCTCTGGGTGCTCCGAGG - Intronic
993901133 5:93584887-93584909 GGGGCCCGCCGGGCGCCCCGGGG - Exonic
997231916 5:132251580-132251602 GGGCAGTGCTGGGCACCACGGGG + Intronic
997520972 5:134524675-134524697 GGGCAGCGCTAGGCGCCAGGAGG + Intronic
1006383386 6:33714487-33714509 GGGCTGTGCTGGGTGCCCCGAGG + Intergenic
1006406021 6:33845485-33845507 GGGCATCTTTGGGGGCCCCCAGG + Intergenic
1007664169 6:43504928-43504950 AGGCAGCGCCGGGCGCCCCTTGG + Exonic
1012829626 6:104188034-104188056 GGGCATTGCTGGGCTCACTGGGG + Intergenic
1018726265 6:166615541-166615563 GGGCATCTCTGGGGCCCCAGGGG - Intronic
1019287346 7:230312-230334 GGGCAGGGCTGAGCTCCCCGTGG - Intronic
1019344486 7:522682-522704 GGGAGTCCGTGGGCGCCCCGAGG + Intergenic
1021176718 7:17458499-17458521 GGGCATCACTGGGGGCCTGGAGG - Intergenic
1022697933 7:32728421-32728443 GGCCGCCGCTCGGCGCCCCGAGG - Intergenic
1024988220 7:55213996-55214018 GGGCAGGGCTGGCCTCCCCGGGG - Intronic
1026477481 7:70749339-70749361 GGGCAGGGCTGGGCGGCACGGGG + Intronic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1030927629 7:115477550-115477572 GGGCTTCGCTGCGCGCCTCCAGG - Intergenic
1032236861 7:130132201-130132223 GGGCAGCGCTGGTCCTCCCGGGG + Exonic
1034578946 7:152025985-152026007 GGGCAGCGCCTGGCTCCCCGCGG + Intronic
1034968323 7:155404736-155404758 GGGCCCCGCTGGGGGGCCCGTGG - Intergenic
1035472556 7:159119664-159119686 GGGCATGGCTGGGCACCCACTGG - Intronic
1045098704 8:98825251-98825273 GGGCAGCGCCGGGCTCCCTGCGG - Intronic
1047956956 8:129983769-129983791 GCGCATCGCCGGGCTCCGCGAGG + Intronic
1049108086 8:140625994-140626016 GGGCCTTGCTGGGCGCACCTTGG - Intronic
1049176319 8:141194705-141194727 AGGCCTCGCTGGAGGCCCCGGGG - Exonic
1049507104 8:143008677-143008699 GGGCAGCTCTGGGTGCCCTGGGG - Intergenic
1049606999 8:143534422-143534444 GGGCCTTGCTCGGCGCCCCCCGG - Intronic
1049614336 8:143569522-143569544 GTGCAGCGCTGGGCGCCCTGAGG - Exonic
1049850187 8:144826712-144826734 GGGCTTCGCCGGGAGCCACGCGG + Intergenic
1052195472 9:25708321-25708343 GAGAATCGCTGGGAGCCCGGAGG - Intergenic
1055397495 9:75890924-75890946 GAGCATCGCCGAGCGCCCCACGG + Exonic
1057704114 9:97385788-97385810 GGGCACAGCTGGGCCCCCCAGGG - Intergenic
1060661577 9:125408094-125408116 GGGACTCACGGGGCGCCCCGGGG + Intergenic
1060665951 9:125432240-125432262 TGGCATCCCTGGGGGACCCGAGG - Intergenic
1061140668 9:128764326-128764348 GGACACTGCTGGGCGCCCAGTGG + Intronic
1062392558 9:136339754-136339776 GGCCTGCGCTGGGCGCCCCATGG - Exonic
1062543955 9:137053565-137053587 GGGCATCGCTGGGCTATCCCGGG + Intronic
1187464467 X:19515204-19515226 GGGACTCGCTCGCCGCCCCGAGG + Exonic
1192510855 X:71719610-71719632 GGGCAACCCTGGGCTCCCAGGGG - Intergenic
1192515842 X:71761943-71761965 GGGCAACCCTGGGCTCCCAGGGG + Intergenic
1196134002 X:112187444-112187466 AGGCATAGCTGGGGGCACCGTGG + Intergenic
1199794088 X:151178410-151178432 GGGCTTCGCAGGTCGCCCCCAGG - Intronic
1200316382 X:155137125-155137147 GCTCATCGGTGGTCGCCCCGAGG - Intronic