ID: 1161105549

View in Genome Browser
Species Human (GRCh38)
Location 19:2442017-2442039
Sequence AGACCCGTTTCCTAAGCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161105537_1161105549 29 Left 1161105537 19:2441965-2441987 CCGCAGGACTGCAGGGCACACCC No data
Right 1161105549 19:2442017-2442039 AGACCCGTTTCCTAAGCGCCAGG No data
1161105543_1161105549 9 Left 1161105543 19:2441985-2442007 CCCAGAAGGCAGGGTGCGGGCTC No data
Right 1161105549 19:2442017-2442039 AGACCCGTTTCCTAAGCGCCAGG No data
1161105544_1161105549 8 Left 1161105544 19:2441986-2442008 CCAGAAGGCAGGGTGCGGGCTCC No data
Right 1161105549 19:2442017-2442039 AGACCCGTTTCCTAAGCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161105549 Original CRISPR AGACCCGTTTCCTAAGCGCC AGG Intronic