ID: 1161105909

View in Genome Browser
Species Human (GRCh38)
Location 19:2443954-2443976
Sequence TCCCAGCTGTTGGGACGCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1880
Summary {0: 1, 1: 0, 2: 11, 3: 208, 4: 1660}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161105909_1161105917 11 Left 1161105909 19:2443954-2443976 CCCGAGCGTCCCAACAGCTGGGA 0: 1
1: 0
2: 11
3: 208
4: 1660
Right 1161105917 19:2443988-2444010 CACCAAGAACATCCAACCACAGG 0: 1
1: 0
2: 2
3: 11
4: 128
1161105909_1161105918 12 Left 1161105909 19:2443954-2443976 CCCGAGCGTCCCAACAGCTGGGA 0: 1
1: 0
2: 11
3: 208
4: 1660
Right 1161105918 19:2443989-2444011 ACCAAGAACATCCAACCACAGGG 0: 1
1: 0
2: 1
3: 18
4: 182
1161105909_1161105922 27 Left 1161105909 19:2443954-2443976 CCCGAGCGTCCCAACAGCTGGGA 0: 1
1: 0
2: 11
3: 208
4: 1660
Right 1161105922 19:2444004-2444026 CCACAGGGAAATGCCTACGATGG 0: 1
1: 0
2: 2
3: 8
4: 86
1161105909_1161105923 28 Left 1161105909 19:2443954-2443976 CCCGAGCGTCCCAACAGCTGGGA 0: 1
1: 0
2: 11
3: 208
4: 1660
Right 1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG 0: 1
1: 0
2: 0
3: 4
4: 66
1161105909_1161105924 29 Left 1161105909 19:2443954-2443976 CCCGAGCGTCCCAACAGCTGGGA 0: 1
1: 0
2: 11
3: 208
4: 1660
Right 1161105924 19:2444006-2444028 ACAGGGAAATGCCTACGATGGGG 0: 1
1: 0
2: 0
3: 5
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161105909 Original CRISPR TCCCAGCTGTTGGGACGCTC GGG (reversed) Intronic
900222502 1:1516826-1516848 TCCCAGCTGCTCGGAGGCTGAGG - Intronic
901032824 1:6318169-6318191 TCCCAGCTACTGGGAGGCTGAGG - Intronic
901062201 1:6476868-6476890 TCCCAGCTGCTCGGAGGCTGAGG - Intronic
901071098 1:6518957-6518979 TCCCAGCTCTCGGGAGGCTAAGG - Intronic
901099923 1:6712172-6712194 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
901108264 1:6774766-6774788 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
901163175 1:7195900-7195922 TCCCAGCTCTTAGGAGGCTGAGG + Intronic
901182811 1:7353063-7353085 ACCCAGCAGTTGGGAACCTCGGG + Intronic
901314606 1:8297774-8297796 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
901349877 1:8585030-8585052 TCCCAGCTACTGGGAGGCTGAGG + Intronic
901395965 1:8981730-8981752 TCCCAGCTCTTGGGAGGCCAAGG - Intergenic
901438014 1:9261367-9261389 TCTCAGCTGCAGGGACCCTCAGG - Intronic
901474911 1:9482889-9482911 AGCCAGCTGCTGGGACACTCGGG + Intergenic
901519347 1:9770875-9770897 TCCCAGCTAATGGGAGGCTGAGG + Intronic
901536816 1:9887938-9887960 TCCCAGCTATTAGGAGGCTGAGG - Intronic
901607860 1:10473537-10473559 TCCCAGCTCTTGGGAGGCTGAGG + Intronic
901680271 1:10909045-10909067 TCCCAGCATTTGGGAGGCTGAGG + Intergenic
902041572 1:13496421-13496443 TCCCAGCACTTGGGAGGCTGAGG - Intronic
902140877 1:14353338-14353360 TCCCAGCTATTGGGAGGCTGAGG - Intergenic
902403052 1:16168266-16168288 TCCCAGCTATTGGGAAACTGGGG - Intergenic
902428008 1:16340058-16340080 TCCCAGCTCTTGGGAGGCTGAGG + Intronic
902519526 1:17008256-17008278 TCCCAGCTATTTGGAGGCTGAGG - Intronic
902590136 1:17468080-17468102 TCCCAGCCCTTGGGAGGCTGAGG - Intergenic
903075757 1:20764757-20764779 TCCCAGCTATTCGGAGGCTGTGG + Intronic
903206730 1:21787968-21787990 TCCCAGCTATCGGGAGGCTGAGG + Intergenic
903237731 1:21961194-21961216 TCTCAGCTATTGGGAGGCTGAGG + Intergenic
903363039 1:22789003-22789025 TCCCAGCTTTAGGGAGGCTAAGG - Intronic
903454052 1:23474697-23474719 TCCCAGCTATTCGGAGGCTGAGG - Intronic
903595700 1:24492576-24492598 TCCCAGCTCTTAGGAGGCTGAGG - Intergenic
903647014 1:24901971-24901993 TCCCAGCTGGTGGGAGCCTCTGG - Exonic
903991669 1:27275500-27275522 TCCCAGCACTTGGGAGGCTGAGG + Intronic
904062557 1:27723299-27723321 TCCCAGATTTTGGGAGGCTGAGG + Intergenic
904524810 1:31125012-31125034 TCCCAGCTTTCGGGAGGCTGAGG + Intergenic
904529485 1:31158874-31158896 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
904530874 1:31168270-31168292 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
904548052 1:31292244-31292266 TCCCAGCTCTTGGGAGACTGAGG + Intronic
904628187 1:31820560-31820582 TCCCAGTTATTGGGAGGCTAAGG + Intergenic
904736519 1:32638439-32638461 TCCCAGCTTTTGGGAGGCTGAGG - Intronic
904741374 1:32678838-32678860 TCCCAGCACTTGGGAGGCTGAGG - Intronic
904763143 1:32819446-32819468 TCCCAGCTACTGGGAGGCTGTGG + Intronic
904791575 1:33026313-33026335 TCCCAGCTACTGGGAGGCTGAGG - Intronic
904812724 1:33173954-33173976 TCCCAGCTCTTGGGAGGCCAAGG - Intronic
904949346 1:34223720-34223742 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
905059085 1:35123933-35123955 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
905231534 1:36517553-36517575 TCCCAGCTGTGGGGACGCCATGG - Intergenic
905384322 1:37590356-37590378 TCCCAGCACTTGGGAGGCTCAGG - Intronic
905624641 1:39480358-39480380 TCCCAGCCTTTGGGAAGCTGTGG + Intronic
906162233 1:43658751-43658773 TCCCAGCACTTGGGAGGCCCAGG - Intronic
906269428 1:44463217-44463239 TCCCAGCTCTTGGGAGGCTGAGG + Intronic
906284779 1:44579912-44579934 TCCCAGCTACTGGGAGGCTAAGG + Intronic
906301958 1:44689176-44689198 TCCCAGCTCTTGGGAGGCTGAGG - Intronic
906437898 1:45812541-45812563 TCCCAGCTACTGGGAGGCTGAGG - Intronic
906703208 1:47874832-47874854 TCCCAGCACTTGGGAGGCTGTGG - Intronic
906813868 1:48857469-48857491 TCCCAGCATTTGGGAGGCTGAGG + Intronic
907193859 1:52670454-52670476 TCCCAGCTATTGGGAGGCTGAGG + Intergenic
907441104 1:54479005-54479027 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
907717674 1:56942586-56942608 TCCCAGCTTTTGGGAGGCTGAGG + Intronic
908129884 1:61064564-61064586 TCCCAGCTACTGGGAGGCTGAGG + Intronic
908245810 1:62227080-62227102 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
908274876 1:62459982-62460004 TCCCAGCTACTGGGAGGCTGAGG + Intronic
908545928 1:65162132-65162154 TCCCAGCTACTGGGAGGCTGAGG + Intronic
908706319 1:66959966-66959988 TCCCAGCACTTGGGAGGCTGAGG + Intronic
908816755 1:68043026-68043048 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
908835699 1:68227299-68227321 TCCCAGCTATCGGGAGGCTGAGG + Intronic
908947907 1:69522552-69522574 TCCCAGCTGCTCGGAGGCTGAGG - Intergenic
908998480 1:70188482-70188504 TCCCAGCACTTGGGAGGCTGAGG + Intronic
909013425 1:70358452-70358474 TCCCAGCACTTGGGAGGCTGAGG - Intronic
909287352 1:73836784-73836806 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
909426114 1:75526881-75526903 TCCCAGCATTTGGGAGGCTGAGG + Intronic
909636657 1:77824308-77824330 TCCCAGCACTTGGGAGGCTGAGG + Intronic
909655798 1:78031179-78031201 TCCCAGCTACTGGGAGGCTGAGG + Intronic
909666394 1:78138673-78138695 TCCCAGCTCTTGAGAGGCTGAGG - Intergenic
910048174 1:82943118-82943140 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
910277728 1:85466072-85466094 TCCCAGCTTTTAGGAAACTCTGG + Intronic
910416943 1:87011357-87011379 TCCCAGCTGTTGGGAGGCAGAGG - Intronic
910503956 1:87927839-87927861 TCCCTGTTGGTGGGAAGCTCTGG + Intergenic
910675878 1:89816099-89816121 TCCTAGCTCTTGGGAGGCTGAGG + Intronic
910885338 1:91957953-91957975 TCCCAGCTGCTTGGAGGCTGAGG - Intronic
910946390 1:92596242-92596264 TCCCAGCTACTTGGAGGCTCAGG + Intronic
910962247 1:92775309-92775331 TCCCAGCTACTGGGAGGCTCAGG + Intronic
911013754 1:93309546-93309568 TCCCAGCATTTGGGAGGCTGAGG + Intergenic
911116323 1:94249633-94249655 TCCCAGCTCTTGGGAGGCGGAGG + Intronic
911116502 1:94251284-94251306 TCCCAGCTACTGGGAGGCTGAGG - Intronic
912114462 1:106388166-106388188 TCCCAGCTCTTGGGAGGCCGAGG + Intergenic
912339008 1:108891754-108891776 TCCCAGCACTTGGGAGGCTAAGG - Intronic
912361272 1:109098250-109098272 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
912526496 1:110287359-110287381 TCCCAGCTCCTGGGAGGCTGAGG + Intergenic
912830600 1:112949788-112949810 TCCCAGCACTTGGGAGGCTGAGG - Intronic
912838638 1:113019344-113019366 TCTCAGCTATTGGGAAGCTGAGG - Intergenic
912914059 1:113793916-113793938 TCCCAGCAGTTTGGAGGCTGAGG - Intronic
912916723 1:113822841-113822863 TCCCAGCACTTGGGAGGCTGAGG + Intronic
913004714 1:114617556-114617578 TCCCAGCACTTGGGAGGCTGAGG - Intronic
913242943 1:116845955-116845977 TCCTAGTTGTTGGGAAACTCAGG + Intergenic
913272214 1:117105464-117105486 TCCCAGCATTTGGGAGGCTGAGG + Exonic
913297422 1:117335449-117335471 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
913513694 1:119584734-119584756 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
913517323 1:119615652-119615674 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
914011315 1:143781196-143781218 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
914166519 1:145179940-145179962 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
914649937 1:149689835-149689857 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
914708743 1:150193787-150193809 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
914773857 1:150717829-150717851 TCCCAGCACTTGGGAGGCTGAGG + Intronic
914793171 1:150897571-150897593 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
914863076 1:151402449-151402471 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
915176555 1:154020464-154020486 TCCCAACTATTGGGAGGCTGAGG - Intronic
915388590 1:155519772-155519794 TCCCAGCCCTTGGGAGGCTGAGG - Intronic
915389295 1:155526952-155526974 TCCCAGCAGTTGGGAGGCCAAGG + Intronic
915416184 1:155744968-155744990 TCCCAGGTTTTGGGAGGCTGAGG - Intergenic
915533851 1:156522007-156522029 TCCCAGCAGTTGGGAGGCCAAGG - Intergenic
915966524 1:160313662-160313684 TCCCAGCACTTGGGAGGCTGAGG - Intronic
916093148 1:161325089-161325111 TCCCAGCTATGGGGAGGCTAAGG + Intronic
916119758 1:161518723-161518745 TCCCAGCTACTGGGAGGCTGAGG - Exonic
916127890 1:161587648-161587670 TCCCAGCTCTTGGGAGGCTGAGG + Intronic
916129524 1:161600375-161600397 TCCCAGCTACTGGGAGGCTGAGG - Intronic
916137806 1:161669452-161669474 TCCCAGCTCTTGGGAGGCTGAGG + Intronic
916406140 1:164499829-164499851 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
916636758 1:166678774-166678796 TCCCAGCATTTGGGAGGCTGAGG + Intergenic
916654503 1:166861941-166861963 TCCCAGCTCTTGAGAGGCTGAGG + Intronic
916687574 1:167161245-167161267 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
917174196 1:172213710-172213732 TCCCAGCTATCGGGAGGCTGAGG + Intronic
917371132 1:174295497-174295519 TCCCAGCTGCTGGGAGGCTGAGG - Intronic
917852227 1:179074937-179074959 TCCCAGCATTTGGGAGGCTGAGG + Exonic
917878268 1:179306713-179306735 TCCCAGCTACTGGGAGGCTGAGG + Intronic
917952595 1:180055794-180055816 TCCCAGCATTTGGGAGGCTGAGG - Intronic
917988963 1:180352438-180352460 TCCCAGCTTTTCGGAGGCTGAGG - Intronic
918525318 1:185458281-185458303 TCCCAGCTTTTGGGAGGCTGAGG - Intergenic
918596327 1:186298264-186298286 TCCCAGCTATTCGGAGGCTGAGG + Intronic
918890715 1:190263703-190263725 TCCCAGCTACTGGGAGGCTGAGG - Intronic
919238203 1:194873955-194873977 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
919417704 1:197332022-197332044 TCCCAGCTACTGGGAGGCTGAGG + Intronic
919734310 1:200935951-200935973 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
919862009 1:201745946-201745968 TCCCAGCTGCTTGGAGGCTGAGG - Intronic
919905226 1:202073819-202073841 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
920063574 1:203247266-203247288 TCCCAGCTACTGGGGCGCTGAGG + Intronic
920090759 1:203451272-203451294 TCCCAGCTATTGGGAGACTGAGG + Intergenic
920096294 1:203488402-203488424 TCCCAGCTACTGGGAGGCTGAGG + Exonic
920354646 1:205361827-205361849 TCCCAGCTCTTGGGAGACTGAGG + Intergenic
920373645 1:205494799-205494821 TCCCAGCTTTTGGGAGGCTGAGG - Intergenic
921141084 1:212307008-212307030 TCCCAGCACTTGGGAGGCACAGG - Intronic
921144604 1:212341852-212341874 TCCCAGCTACTGGGAGGCTGAGG - Intronic
921357041 1:214294553-214294575 TCCCAGCTGCTTGGAGGCTGAGG + Intronic
921597504 1:217070495-217070517 TCCCAGCTACTGGGAGGCTGAGG - Intronic
921687152 1:218103204-218103226 TCCCAGCACTTGGGAGGCCCAGG - Intergenic
922560865 1:226568683-226568705 TCCCAGCTGTGGGGAGGAGCAGG + Intronic
922624940 1:227030015-227030037 TCCCAGCTACTGGGAGGCTGAGG + Intronic
922846185 1:228686854-228686876 TCCCAGCTATTGGGAGGCTGAGG - Intergenic
923599850 1:235392898-235392920 TCCCAGCTACTGGGAGGCTGAGG + Intronic
923688277 1:236169310-236169332 TCTCAGCTGCTGGTAGGCTCCGG + Intronic
923982785 1:239344165-239344187 TCCCAGCTGCTAGGAGGCTGAGG + Intergenic
924148965 1:241108185-241108207 TCCCAGCTATCGGGAGGCTGAGG + Intronic
924515958 1:244766439-244766461 TCCCAGCACTTGGGAGGCTGGGG - Intergenic
924681232 1:246236344-246236366 TCCCAGCTACTGGGAGGCTGAGG - Intronic
924778085 1:247124912-247124934 TCCCAGCTATTGGGAGGCTGAGG - Intronic
1063076217 10:2719350-2719372 TCCCAGCTCTTGTGGGGCTCTGG - Intergenic
1063104472 10:2981069-2981091 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1063160165 10:3412977-3412999 GCCCAGCTGATGGGGAGCTCCGG - Intergenic
1063249581 10:4259362-4259384 TCCCAGCTTTTGGGAGGCCAAGG - Intergenic
1063346960 10:5320561-5320583 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1063354853 10:5388473-5388495 TCCCAGCATTTGGGAGGCTGAGG + Intergenic
1063771288 10:9205009-9205031 TCCCAGCTATAGGGAGGCTGAGG + Intergenic
1064002476 10:11674994-11675016 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1064049678 10:12049313-12049335 TCCCAGCTATCAGGACGCTGAGG - Intergenic
1064257323 10:13753658-13753680 TCCCAGCTGCTTGGAGGCTAAGG - Intronic
1064351290 10:14579772-14579794 TCCCAGCATTTGGGAGGCTGAGG + Intronic
1064394359 10:14969330-14969352 TCCCAGCTACTGGGAGGCTCAGG + Intronic
1064411379 10:15107566-15107588 TCCCAGCTGCTAGGAGGCTGAGG - Intronic
1064421330 10:15193416-15193438 TCCCAGCTATTGGGAGACTGAGG - Intergenic
1064458423 10:15509896-15509918 TCCCAGCTTCTGGGAGTCTCAGG - Intergenic
1064588204 10:16861411-16861433 TCCCAGCGCTTGGGAGGCTGAGG - Intronic
1064858256 10:19796191-19796213 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1065003937 10:21362463-21362485 TCCCAGCTACTGGGAGGCTGGGG - Intergenic
1065288991 10:24211484-24211506 TCCCAGCTATTTGGAAGCTAAGG - Intronic
1065342171 10:24717842-24717864 TCCCAACTGTTTGGAGGCTGAGG - Intronic
1065779247 10:29151328-29151350 TCCCAGCTGCTGGAATGCCCAGG - Intergenic
1065847723 10:29760034-29760056 TCCCAGCTATTGGGGAGCTGAGG + Intergenic
1065998549 10:31083040-31083062 TCCCAGCACTTGGGAAGCTGAGG - Intergenic
1066090420 10:32013149-32013171 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1066097214 10:32083874-32083896 TCCCAGCTATTGGGAGGCTGAGG - Intergenic
1066116287 10:32243250-32243272 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1066253182 10:33653930-33653952 TCCCAGCATTTGGGAGGCTGGGG + Intergenic
1066276571 10:33874404-33874426 TGCCAGCTGCTGGGAGGCTGAGG + Intergenic
1066378815 10:34884089-34884111 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1066382167 10:34911184-34911206 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
1066382373 10:34912348-34912370 TCCCAGCCCTTGGGAGGCTGAGG + Intergenic
1066397641 10:35041651-35041673 TCATAGCTCTTGGGACGCTGAGG - Intronic
1066402173 10:35087166-35087188 TACCCGCTGTTGGGAAGCTGAGG - Intronic
1066684832 10:37971062-37971084 TCCCAGCATTTGGGAGGCTAAGG + Intronic
1067845252 10:49714819-49714841 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1068029277 10:51686985-51687007 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1068305887 10:55207715-55207737 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1068489937 10:57710398-57710420 TCCCAGCTGCTTGGAGGCTGAGG + Intergenic
1068566386 10:58580138-58580160 TCCCAGCTACTGGGAAGCTGAGG - Intronic
1068677267 10:59780962-59780984 TCCCAGCATTTGGGAGGCTGAGG + Intergenic
1068707800 10:60096055-60096077 TCCCAGCTATCGGGAGGCTGAGG + Intronic
1069009340 10:63353755-63353777 TCCCAGCGCTTGGGAGGCTGAGG - Intronic
1069320215 10:67160551-67160573 TCCCAGCTCTAGGGAGGCTGAGG - Intronic
1069509647 10:69032317-69032339 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
1069524392 10:69154747-69154769 TCCCAGCTATTTGGAGGCTGAGG + Intronic
1069528358 10:69194658-69194680 TCCCAGCTGCTTGGAAGCTGAGG + Intronic
1069535858 10:69252527-69252549 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1069540248 10:69288900-69288922 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1069541112 10:69294603-69294625 TCCCAGCACTTGGGAAGCTGAGG + Intronic
1069553586 10:69382136-69382158 TCCCAGCACTTGGGAAGCTGAGG + Intronic
1069895178 10:71676156-71676178 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1070003872 10:72403241-72403263 TCCCAGCTTTTGGGAGGCTGAGG + Intronic
1070018684 10:72561693-72561715 TCCCAGCTATTGGGAAGCTGAGG + Intronic
1070049252 10:72871014-72871036 TCCCAGCTATCGGGAGGCTGGGG - Intronic
1070069172 10:73069924-73069946 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1070142500 10:73748685-73748707 TCCCAGCATTTGGGAGGCTGAGG - Intronic
1070650985 10:78236267-78236289 TCCCAGCTATTGGGAGGCTGAGG + Intergenic
1071171920 10:82876770-82876792 TCCCAGCAGTTGGGAGGCCGAGG + Intronic
1071614622 10:87063992-87064014 TCCCAGCTATCGGGAGGCTGAGG - Intronic
1072069667 10:91904107-91904129 TCCCAGCCTTTGGGAAGCTGAGG - Intergenic
1072092021 10:92137882-92137904 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1072103096 10:92247761-92247783 TCCCAGCCTTTGGGAAGCTGAGG - Intronic
1072107010 10:92283976-92283998 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1072131537 10:92498806-92498828 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1072184389 10:93021228-93021250 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1072343966 10:94484361-94484383 TCCCAGCTGCTGGGAGGCTGAGG - Intronic
1072440162 10:95447216-95447238 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1072974115 10:100042840-100042862 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1073012912 10:100375108-100375130 TCCCAGCACTTTGGACGCTGAGG + Intergenic
1073162287 10:101408794-101408816 TCCCAGCATTTGGGAGGCTGAGG + Intronic
1073162445 10:101410496-101410518 TCCCAGCTGCTTGGAGGCTGAGG + Intronic
1073170759 10:101506028-101506050 TCCCAGCTAATGGGAGGCTGAGG - Intronic
1073269731 10:102252220-102252242 TCCCAGCTGCTGGGAGGTTGAGG + Intronic
1073313620 10:102562405-102562427 TCCCAGCTATCGGGAGGCTGAGG + Intronic
1073826434 10:107328616-107328638 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
1074128815 10:110554608-110554630 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1074234688 10:111573464-111573486 TCCCAGCACTTGGGAGGCTGGGG - Intergenic
1074311431 10:112326383-112326405 TCCCAGCACTTTGGAGGCTCAGG - Intergenic
1074381041 10:112980741-112980763 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1074526476 10:114267546-114267568 TCCCAGCTATCGGGAGGCTGAGG - Intronic
1074802051 10:117009785-117009807 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1074955017 10:118380227-118380249 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1075000466 10:118793388-118793410 TCCCAGCTATTGGGAGGCTGAGG - Intergenic
1075002231 10:118807317-118807339 TCCCAGCACTTGGGAGGCTGTGG - Intergenic
1075207975 10:120463141-120463163 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1075312834 10:121429363-121429385 TCCCAGCTCTCGGGAGGCTGAGG - Intergenic
1075350013 10:121715631-121715653 TCTCAGCTTTTGGGAGGCTGAGG + Intergenic
1075652264 10:124135618-124135640 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1076020030 10:127065123-127065145 TCCCAGCTGCTGGGAGGATGAGG - Intronic
1076075422 10:127530191-127530213 TCCCAGTTCTTGGGAGGCTGAGG + Intergenic
1076349917 10:129808651-129808673 TCCCAGCTGTGGGTGAGCTCTGG + Intergenic
1076386495 10:130060705-130060727 TCCCAGCTATCGGGAGGCTGAGG + Intergenic
1076401154 10:130186394-130186416 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1076656081 10:132024264-132024286 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1076910674 10:133387161-133387183 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1077068466 11:655946-655968 TCCCAGCTGTGGGGAGGCTGAGG - Intronic
1077382822 11:2253052-2253074 TCCCAGCCTTTGGGAGGCTGAGG - Intergenic
1077628341 11:3793402-3793424 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1077805570 11:5588439-5588461 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1077844897 11:6013426-6013448 GCCCAGCTGTTGGGAGTGTCAGG + Intergenic
1077943805 11:6873060-6873082 TCCCAGCCCTTGGGAGGCTGAGG - Intergenic
1078028314 11:7721250-7721272 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1078217634 11:9325031-9325053 TCCCAGCATTTGGGAGGCTGAGG + Intergenic
1078288250 11:9980229-9980251 TCCCAGCATTTGGGAGGCTGAGG - Intronic
1078348260 11:10570791-10570813 TCCCAGCATTTGGGAGGCTGAGG - Intronic
1078526933 11:12108635-12108657 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1078620004 11:12898643-12898665 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1078824679 11:14917861-14917883 TCCCAGCAGTTTGGAGGCTAAGG + Intronic
1078918486 11:15803735-15803757 TTCCAGCTGTTGGCAGGATCAGG - Intergenic
1079046422 11:17107985-17108007 TCCTGGCTGCTGGGAGGCTCAGG - Intronic
1079048017 11:17125871-17125893 TCCCAGCACTTGGGAGGCTAAGG + Intronic
1079066941 11:17302853-17302875 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1079169880 11:18082880-18082902 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1079204444 11:18402070-18402092 TCCCAGCTCTTGGGAGGCTGAGG - Intronic
1079248318 11:18769517-18769539 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1079632517 11:22695202-22695224 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1079635860 11:22739455-22739477 TCCCAGCTATCGGGAGGCTGAGG + Intronic
1080520571 11:33064905-33064927 TCCCAGCTACTGGGAGGCTCAGG - Intronic
1080532373 11:33189432-33189454 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1081177034 11:39940837-39940859 TCCCAGCACTTGGGAAGCTGAGG - Intergenic
1081183610 11:40014942-40014964 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1081321601 11:41698485-41698507 TCCCAGCTCTTGGGAGGCTGAGG - Intergenic
1081517842 11:43850809-43850831 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1081518925 11:43862703-43862725 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1081971494 11:47201977-47201999 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1082040345 11:47679755-47679777 TCCCAGCTCTCGGGAGGCTGAGG - Intronic
1082071974 11:47946590-47946612 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1082665029 11:55964840-55964862 TCCCAGCTCTTGGGAGGCTGAGG + Intergenic
1082937737 11:58671860-58671882 TCCCAGCTACTGGGAAGCTGAGG + Intronic
1083125533 11:60561909-60561931 TCCCAGCTCTTGGGAGGCTGAGG - Intergenic
1083434854 11:62635298-62635320 TCCCAGCTATTTGGAGGCTGAGG - Intronic
1083562500 11:63684262-63684284 TCCCAGCTACTGGGAAGCTGAGG - Intronic
1083562952 11:63688337-63688359 TCCCAGCTACTGGGAAGCTGAGG - Intronic
1083875169 11:65519325-65519347 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1083921521 11:65783585-65783607 TCCCAGCCTTTGGGAGGCTGAGG + Intergenic
1084059842 11:66664264-66664286 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1084120225 11:67064791-67064813 TCCCAGCTCTTGGGAGGCAGAGG + Intronic
1084416820 11:69037303-69037325 TCCAGGCTGCGGGGACGCTCGGG + Intergenic
1084631942 11:70358335-70358357 TTCCAGCTGCTGGGAGGCTGAGG - Intronic
1084648812 11:70476110-70476132 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1084746674 11:71174735-71174757 TTCCAGCTATTGGGAGGCTGAGG + Intronic
1085093493 11:73739420-73739442 TCCCAGCATTTGGGAGGCTGAGG - Intronic
1085111738 11:73895991-73896013 TCTCAGCTATTGGGAAGCTCAGG + Intronic
1085301030 11:75458420-75458442 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1085342156 11:75739425-75739447 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1085354076 11:75819850-75819872 TCCCAGCTATTTGGAGGCTGAGG + Intronic
1085356662 11:75844341-75844363 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1085585821 11:77704866-77704888 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1085752610 11:79174838-79174860 TCCCAGCTGTTGTTAGCCTCAGG + Intronic
1085818267 11:79764657-79764679 TCCCAGCTCCTGGGAGGCTGAGG - Intergenic
1086102019 11:83110654-83110676 TCCCAGCCTTTGGGAGGCTGAGG - Intergenic
1086724038 11:90159698-90159720 TCCCAGCATTTGGGAGGCTGAGG + Intronic
1086996152 11:93358697-93358719 TCCCAGCTATTTGGAGGCTGAGG - Intronic
1087228923 11:95637642-95637664 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1087448887 11:98292168-98292190 TCCCAGCTGTCGGGAGGCTGAGG + Intergenic
1087758640 11:102081773-102081795 TCCCAGCTTTGGGGAGGCTGAGG + Intronic
1088167175 11:106952754-106952776 TCCCAGATATTGGGAGGCTGAGG - Intronic
1088333620 11:108678973-108678995 TCCCAGCTATCGGGAGGCTGAGG - Intronic
1088727890 11:112655712-112655734 TCCCAGCTGTTGGAGGGATCAGG + Intergenic
1088932035 11:114361902-114361924 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1088934827 11:114389411-114389433 TCCCAGCTATTAGGAGGCTGAGG - Intergenic
1089000282 11:115046032-115046054 CCCCAGCTCTTGGGAGGCTGAGG + Intergenic
1089232838 11:116995015-116995037 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1089318532 11:117608914-117608936 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1089562897 11:119354147-119354169 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1090184790 11:124730244-124730266 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1090525898 11:127536369-127536391 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1090975253 11:131674475-131674497 TCCCTGCAGCTGGGATGCTCTGG + Intronic
1091523878 12:1276488-1276510 TCCCAGCATTTGGGAGGCTGAGG - Intronic
1091834849 12:3578472-3578494 TCCCAGCACTTGGGAAGCTGAGG - Intronic
1091924826 12:4337280-4337302 TCCCAGCTATTGGGAGGCTGAGG - Intronic
1092372895 12:7931995-7932017 TCCCAGCTGCTTGGAAGCTGAGG - Intronic
1092379241 12:7981245-7981267 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1092389416 12:8062758-8062780 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1092396354 12:8130486-8130508 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1092602205 12:10079568-10079590 TCCCAGCAGTTGGGAGGCTGAGG + Intronic
1092819736 12:12342057-12342079 TCCCAGCTATTGGGAGGCTGAGG - Intronic
1093159649 12:15731412-15731434 TCCCAGCTTTTGGGAATCTGAGG - Intronic
1093180364 12:15960519-15960541 TCCCAGCTGCTGGGAGGCTGAGG + Intronic
1093913056 12:24769034-24769056 TCCCAGCTATCGGGAGGCTGAGG + Intergenic
1093949917 12:25153303-25153325 TTCCAGCTATTGGGAGGCTGAGG + Intronic
1094171014 12:27491958-27491980 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1094242198 12:28241743-28241765 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1094537844 12:31337649-31337671 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1094577713 12:31702851-31702873 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1094662859 12:32487815-32487837 TCCCAGCTATCGGGAGGCTGAGG - Intronic
1095460009 12:42433571-42433593 TCCCAGCAATTGGGAGGCTGAGG - Intronic
1095464431 12:42475840-42475862 TCCCAGCATTTGGGAGGCTGGGG + Intronic
1095741017 12:45607339-45607361 TCCCAGCTATTAGGAAGCTGAGG + Intergenic
1095811678 12:46378661-46378683 TCCCAGCTGTAGGGAGGCTGAGG - Intergenic
1096048359 12:48584660-48584682 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1096161948 12:49386278-49386300 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1096191613 12:49623567-49623589 GCCCAGCTGCTCGGAGGCTCTGG + Exonic
1096259955 12:50084292-50084314 TCCCAGCACTTGGGAGGCCCAGG - Intergenic
1096269882 12:50156478-50156500 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1096354271 12:50927142-50927164 TCCCAGCTGCTGGGAGGGTGGGG - Intronic
1096364647 12:51018276-51018298 TCCCAGCTATTGGGAGGCTGAGG + Intronic
1096419548 12:51445283-51445305 TCCCAGCTATTGGGAGGCTGAGG - Intronic
1096548772 12:52358891-52358913 TCCCAGCTGTTTGGGCCCTGAGG - Intergenic
1096632276 12:52935757-52935779 TTCCAGCTGTTGGGAGGCAGAGG - Intronic
1096695844 12:53347652-53347674 TCCCAGCACTTGGGAGGCCCAGG - Intergenic
1096699008 12:53369991-53370013 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1096841552 12:54382912-54382934 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1097022601 12:56031133-56031155 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1097568635 12:61302839-61302861 TCCCAGCTGCTGGGAGGCTGAGG + Intergenic
1097620541 12:61933595-61933617 TCCCAGCTAATGGGAAGCTGAGG + Intronic
1097685931 12:62690853-62690875 TCCCAGCTGCTTGGAGGCTGAGG + Intronic
1097725720 12:63073693-63073715 TCCCAGCTATTCGGAGGCTGAGG + Intergenic
1097737213 12:63195243-63195265 TCCCAGCTCTCGGGAGGCTGAGG + Intergenic
1097776976 12:63658376-63658398 TCCCAGCTATTCGGAGGCTGAGG + Intronic
1097800518 12:63909004-63909026 TCCCAGCTATTGGGAGGCTGAGG - Intronic
1097823240 12:64148534-64148556 TCCCAGCACTTGGGAGGCTGAGG - Exonic
1097845518 12:64361980-64362002 TCCCAGCACTTGGGACGCCGAGG - Intronic
1097906876 12:64929959-64929981 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
1098022864 12:66173609-66173631 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1098068296 12:66643678-66643700 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1098160429 12:67644152-67644174 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1098195016 12:67990707-67990729 TCCCAGCCATTGGGAGGCTGAGG - Intergenic
1098305744 12:69100757-69100779 TCACAGCTTTTGGGAGGCTGAGG + Intergenic
1098360420 12:69649108-69649130 TCCCAGCTCTTGGGAGGCTGAGG - Intronic
1098797938 12:74916454-74916476 TCCTAGCTGTTTGGAGGCTAAGG + Intergenic
1098888536 12:75984222-75984244 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1098994843 12:77107371-77107393 ACCCAGGTGTGGAGACGCTCAGG + Intergenic
1100261280 12:92934571-92934593 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1100304667 12:93339362-93339384 TCCCAGCATTTGGGAGGCACAGG - Intergenic
1100535120 12:95501464-95501486 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1100544326 12:95586833-95586855 TCCCAGCTATTGGGAGGTTGAGG + Intergenic
1100545253 12:95596272-95596294 TCCCAGCTATTGGGAGGTTGAGG - Intergenic
1100546285 12:95605761-95605783 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1100600295 12:96107152-96107174 TCCAAACTGTTGGGACACTTTGG - Intergenic
1100835820 12:98565901-98565923 TCCCAGCAGTTTGGAGGCTGAGG + Intergenic
1100924039 12:99523667-99523689 TCCCAGCTATTGGGAGGCTGAGG - Intronic
1101135008 12:101734307-101734329 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1101139317 12:101778788-101778810 TCCCAGCTATTTGGAGGCTGAGG + Intronic
1101143249 12:101817707-101817729 TCCCAGCTATGGGGAGGCTGAGG + Intronic
1101164224 12:102011337-102011359 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1101532112 12:105582773-105582795 TCCCAGCTACTGGGAAGCTGAGG - Intergenic
1101623590 12:106416437-106416459 TCCCATCTGTCTGGAGGCTCTGG + Intronic
1101770204 12:107742877-107742899 TCCCAGCTCTTGGGAGGCTGAGG - Intronic
1101794687 12:107961938-107961960 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1101893356 12:108734818-108734840 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1102059600 12:109922743-109922765 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1102105559 12:110318874-110318896 TCCCAAGTGTTGGGAGGCTTTGG + Intronic
1102128902 12:110509354-110509376 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1102144948 12:110648085-110648107 TCCCAGCTATTAGGAGGCTGAGG - Intronic
1102214481 12:111150722-111150744 TCCCAGCTCTTGGGCAGCTCTGG - Intronic
1102239395 12:111314522-111314544 TCCCAGCTATTTGGAGGCTGAGG + Intronic
1102285010 12:111648808-111648830 TCCCAGCTATTGGGAGGCTGAGG + Intronic
1102359932 12:112276693-112276715 TCCCAGCACTTGGGAGGCTGTGG - Intronic
1102380555 12:112462241-112462263 TCCCAGCTATTGAGAGGCTGTGG + Intronic
1102505622 12:113382985-113383007 TCCCAGCTATTCGGAGGCTGAGG - Intronic
1102853375 12:116272444-116272466 TCCCAGCTCCTGGGAGGCTGAGG + Intronic
1102861437 12:116339668-116339690 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
1103384184 12:120518811-120518833 TCCCAGCATTTGGGAGGCTGAGG - Intronic
1103426288 12:120837915-120837937 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1103466105 12:121143127-121143149 TCCCAGCATTTGGGAGGCCCAGG + Intronic
1103622577 12:122197414-122197436 TCCCAGCACTTGGGAGGCTAAGG - Intronic
1103739640 12:123082551-123082573 TCCCAGCTATTTGGAGGCTGAGG - Intronic
1103799050 12:123525331-123525353 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1103815981 12:123656833-123656855 TCTCAGCACTTGGGAGGCTCAGG + Intronic
1104011379 12:124932796-124932818 TCCCAGCTATCGGGAGGCTGAGG + Intergenic
1104261173 12:127183484-127183506 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1104864340 12:131943994-131944016 TCCCAGCACTTGGGAGGCTGAGG + Exonic
1104869232 12:131982717-131982739 TCCCAGCCTTTGGGAGGCTGAGG + Intronic
1104954925 12:132459661-132459683 TCCCAGCAGTGGGGAGGGTCGGG + Intergenic
1105004357 12:132711534-132711556 TCCCAGCGTTTGGGAGGCTGAGG + Intronic
1105004712 12:132714266-132714288 TCCCAGCATTTGGGAGGCTGAGG - Intronic
1105046085 12:133004733-133004755 TCCCAGCATTTGGGAGGCTGAGG - Intronic
1105057151 12:133112435-133112457 TCCCAGCTACTGGGAGGCTGAGG - Exonic
1105379292 13:19872297-19872319 TCCCAGCACTTGGGAAGCTGAGG + Intergenic
1105499626 13:20960328-20960350 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1105502187 13:20982425-20982447 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1105757268 13:23478678-23478700 TTCCAGCTCTTGGGAGGCTGAGG - Intergenic
1105758176 13:23489091-23489113 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1106058574 13:26263383-26263405 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1106247077 13:27959850-27959872 TCCCAGCTATCGGGAGGCTGAGG - Intergenic
1106268616 13:28132772-28132794 TCCCAGCTTTTGGGAGGCTGAGG + Intergenic
1106296528 13:28418822-28418844 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1106634467 13:31512309-31512331 TCCCAGATGTTGGGCCATTCTGG + Intergenic
1106730543 13:32537819-32537841 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1107296300 13:38912968-38912990 TCCTGGCTGTTGGGAGGCTGCGG + Intergenic
1107444060 13:40454106-40454128 TCCCAGCAGTTGGGAGGCCAAGG - Intergenic
1107668360 13:42716416-42716438 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1107909823 13:45095317-45095339 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1107947200 13:45429576-45429598 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1108142554 13:47440040-47440062 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1108219122 13:48215546-48215568 TGCCAGCTCTTGGGAGGCTGAGG - Intergenic
1108360189 13:49662107-49662129 TCCCAGCTATCGGGAGGCTGAGG - Intronic
1108554023 13:51575307-51575329 TCCCATCTATTGGGAGGCTGAGG + Intergenic
1108554208 13:51577290-51577312 TCCCAGCTATTGAGAGGCTGAGG - Intergenic
1108571240 13:51753832-51753854 TGCCAGCTGTTGGGAGGCCAAGG + Intronic
1108616441 13:52138135-52138157 TCCCAGCTACTGGGAAGCTGAGG - Intronic
1108842824 13:54641612-54641634 TCCCAGCTATTCGGAGGCTGAGG + Intergenic
1108890368 13:55250998-55251020 TCCCAGCTAGTGGGAGGCTGAGG + Intergenic
1109181950 13:59224417-59224439 TACCAGCTATTGGGAGGCTGGGG - Intergenic
1109787300 13:67195259-67195281 TCCCAGCTGCTCGGAGGCTGAGG - Intronic
1109996460 13:70133733-70133755 TCCCAGCCGTTGGGAGAGTCAGG + Intergenic
1110160121 13:72366898-72366920 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1110240134 13:73257841-73257863 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1110720817 13:78759321-78759343 TCCCAGCTGCTGGGAGGCTAGGG + Intergenic
1110912401 13:80980959-80980981 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1111024278 13:82498999-82499021 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1111124613 13:83898212-83898234 TCCCAGCTATTGGGAGGCTGAGG - Intergenic
1111124961 13:83903283-83903305 TCCCAGCTGCTGGGAGGCTGAGG - Intergenic
1111294265 13:86258778-86258800 TCCCAGCTATTGGGAGGCTGAGG - Intergenic
1111555834 13:89880391-89880413 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1112204397 13:97309660-97309682 TCCCAGCTGTTGGTTTGCTTGGG - Intronic
1112277490 13:98034797-98034819 TCCTAGCTGCTGGGAGGCTGAGG - Intergenic
1112403404 13:99096381-99096403 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1112453052 13:99530172-99530194 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1112482989 13:99794302-99794324 TCCCAGCTTCTGGGAGGCTGAGG + Intronic
1112522556 13:100110015-100110037 TCCCAGCTATTAGGAGGCTGAGG + Intronic
1112781980 13:102910889-102910911 TCCCAACTATTGGGAGGCTGAGG + Intergenic
1112802191 13:103124737-103124759 TCCCAGCTGGTGGGAGGCAGTGG + Intergenic
1112909116 13:104460010-104460032 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1113181338 13:107631111-107631133 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1113352440 13:109542609-109542631 TCCCAGCTCTTGGGAGGCTGAGG - Intergenic
1113491336 13:110694384-110694406 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1113711888 13:112470620-112470642 TCCCAGCTACTGGGAAGCTGAGG + Intergenic
1114295788 14:21328051-21328073 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1114541559 14:23464068-23464090 TCCCAGCTATTGGGAGGCTGAGG - Intergenic
1114729186 14:24972999-24973021 TCCCAGCTCTTGGGAGGCTGAGG + Intronic
1114858073 14:26476830-26476852 TCACAGCTGCTGGGAGGCTGAGG - Intronic
1114924511 14:27378091-27378113 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1115010957 14:28544069-28544091 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1115231675 14:31167212-31167234 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1115548296 14:34482651-34482673 TCCCAGCCATTGGGAGACTCTGG - Intergenic
1115550181 14:34497979-34498001 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1115562227 14:34593513-34593535 TCCCAGCTATTGGGACGCTGAGG - Intronic
1115606085 14:35003683-35003705 TCCCAGCTACTAGGAGGCTCAGG - Intronic
1115636993 14:35299436-35299458 TCCCAGCTATTGGGGTGCTGAGG - Intronic
1115669172 14:35589814-35589836 TCCCAGCTATTTGGAGGCTGAGG - Intronic
1115674970 14:35663019-35663041 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1116117748 14:40678846-40678868 TCCCAGCAGTTGGGAGGCTGAGG + Intergenic
1116295166 14:43098418-43098440 TCCCAGCTACTTGGAGGCTCAGG + Intergenic
1116349930 14:43847969-43847991 TCCCAGCATTTGGGAGGCACAGG + Intergenic
1116818326 14:49603807-49603829 TCCCAGCTACTGGGAGGCTGGGG - Intronic
1116822510 14:49639235-49639257 TCCCAGCTGCTTGGAGGCTGGGG - Intergenic
1116864027 14:50016968-50016990 TCCCAGCAATTGGGAGGCTGAGG - Intergenic
1116874907 14:50101324-50101346 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1116887619 14:50236347-50236369 TCCCAGCATTTGGGAGGCTGAGG + Intergenic
1116890561 14:50264023-50264045 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1117057506 14:51928144-51928166 TCCCAGCTATTGAGAGGCTGAGG - Intronic
1117071171 14:52057584-52057606 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1117141634 14:52795814-52795836 TCCCAGCAGTTGGGAGGCTGAGG - Intergenic
1117403566 14:55379836-55379858 TCCCAGCTATTTGGAGGCTGAGG - Intronic
1117459466 14:55930625-55930647 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1117553654 14:56862213-56862235 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1117695528 14:58358349-58358371 TCCCAGATATTGGGAGGCTGAGG + Intronic
1118003031 14:61541163-61541185 TGCCAGCTGTTGGGGAGATCTGG - Intronic
1118187005 14:63546692-63546714 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1118196445 14:63631014-63631036 TCCCAGCACTTGGGAGGCTAAGG - Intronic
1118218556 14:63832921-63832943 TCCCAGCTCTCGGGAGGCCCTGG + Intergenic
1118242640 14:64074777-64074799 TCCCAGCTACTGGGATGCTGAGG + Intronic
1118575367 14:67236972-67236994 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1118608592 14:67522055-67522077 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1118650908 14:67893364-67893386 TCCCAGCATTTGGGAAGCTAAGG + Intronic
1118850833 14:69582121-69582143 TCCCAGCTATTGGGAGACTGAGG - Intergenic
1119129215 14:72156194-72156216 TCCCAGCATTTGGGAGGCTGAGG + Intronic
1119226188 14:72946276-72946298 TCCCAGCTGCTTGGGGGCTCGGG + Intronic
1119241906 14:73067519-73067541 TCCCAGCTCTTGGGAGGCTAAGG - Intronic
1119282717 14:73423523-73423545 TCCCAGCTCTTGGGAGGCTGAGG + Intronic
1119307700 14:73620951-73620973 TCCCAGCACTTGGGAGGCTAAGG + Intergenic
1119343997 14:73906594-73906616 TCCCAGCTACTGGGAAGCTGAGG - Intronic
1119371934 14:74153658-74153680 TCCCAGCTATCGGGAGGCTGAGG - Intronic
1119503463 14:75151154-75151176 TCCCAGCAGTTGGGAGGCCGAGG - Intronic
1119511466 14:75214978-75215000 TCCCAGCTGCTGGGAGGCTGAGG - Intergenic
1119530826 14:75359972-75359994 TCCCAGCTGCTCGGAGGCTGAGG - Intergenic
1120052649 14:79885258-79885280 TCCCAGCTGCTGCGAGGCTGAGG - Intergenic
1120133644 14:80837598-80837620 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1120197135 14:81496486-81496508 TCCCAGCCTTTGGGAGGCTGAGG + Intronic
1120334701 14:83139918-83139940 TCCCATCTCTTGGGAGGCTGAGG + Intergenic
1120628325 14:86857032-86857054 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1120783061 14:88503282-88503304 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1120787029 14:88547535-88547557 TCCCAGCTCTTGGCAGGCTAAGG + Intronic
1121041078 14:90748442-90748464 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1121071338 14:91024995-91025017 TCCCAGCTATTGGGAAGCTGAGG - Intronic
1121087980 14:91161185-91161207 TCCCAGCTACTGGGAAGCTGAGG - Intronic
1121184221 14:91952560-91952582 TCCCAGCCTTTGGGAGGCTGAGG + Intergenic
1121396836 14:93632446-93632468 TCCCAGCACTTGGGAAGCTGAGG + Intronic
1121477181 14:94219843-94219865 TCCCAGCTATTAGGAGGCTGAGG + Intronic
1121748541 14:96324432-96324454 TCCCAGCATTTGGGAGGCTGAGG + Intronic
1122002951 14:98678716-98678738 TCCCAGCTACTGGGAGGCTGGGG + Intergenic
1122003020 14:98679702-98679724 TCCCAGCATTTGGGAGGCTGAGG + Intergenic
1122137468 14:99643154-99643176 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1122213860 14:100190795-100190817 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1122222277 14:100247495-100247517 TCCCAGCTCTTGGGGCACTGAGG - Intronic
1122383522 14:101328084-101328106 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1122454439 14:101839098-101839120 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1122528201 14:102405055-102405077 TCCCAGCACTTGGGAGGCCCAGG + Intronic
1122683301 14:103484291-103484313 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1202905181 14_GL000194v1_random:67520-67542 TCCCAGCTACTGGGAGGCTGGGG + Intergenic
1123431326 15:20219494-20219516 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1123726559 15:23108994-23109016 TCCCAGCTATCGGGAGGCTGAGG - Intergenic
1123808049 15:23895596-23895618 TCCCAGCTATCGGGAGGCTGAGG + Intergenic
1124013136 15:25854941-25854963 TCCCAGCTATTCGGAGGCTGAGG + Intronic
1124225579 15:27890907-27890929 TCCCAGCTATTTGGAAGCTGAGG + Intronic
1124456272 15:29845686-29845708 CCCCAGCTGTCGGGAGGCTGAGG + Intronic
1124505591 15:30270399-30270421 TCCCAGCAGTGGGGTCGTTCAGG - Intergenic
1124574426 15:30895626-30895648 TCCCAGCACTTGGGACGCCCAGG + Intergenic
1124737962 15:32268233-32268255 TCCCAGCAGTGGGGTCGTTCAGG + Intergenic
1124850768 15:33336803-33336825 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1125011746 15:34884288-34884310 TCCCAGCTGCTCGGAAGCTGAGG + Intronic
1125446806 15:39767098-39767120 TCCCAGCATTTGGGAGGCCCAGG - Intronic
1125529267 15:40401294-40401316 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1125583229 15:40802284-40802306 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1125627951 15:41124402-41124424 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1125850300 15:42896675-42896697 TCCCAGCTACTGGGAGGCTAAGG + Intronic
1126024517 15:44433062-44433084 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1126077333 15:44923889-44923911 TCCCAGCTATTTGGAGGCTGAGG - Intergenic
1126081388 15:44966981-44967003 TCCCAGCTATTTGGAGGCTGAGG + Intronic
1126583737 15:50263275-50263297 TCCCAGCTGTCGGGGTCCTCAGG + Exonic
1126631936 15:50745399-50745421 TCCCAGCTCTTTGGAGGCTGAGG - Intronic
1126651881 15:50931316-50931338 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1126733713 15:51710700-51710722 TCCCAGCTATTAGGAGGCTGAGG - Intronic
1127067903 15:55259399-55259421 TCCCAGTTATTGGGAGGCTGAGG - Intronic
1127105341 15:55607887-55607909 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1127107656 15:55634317-55634339 TCCCAGCAGTTTGGAGGCTGAGG - Intronic
1127425544 15:58852170-58852192 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1127486860 15:59426494-59426516 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1127706040 15:61548185-61548207 TCCCAGCTGTTCAGAGGCTGAGG + Intergenic
1127786621 15:62361159-62361181 TCTCAGCTATTGGGAGGCTGAGG - Intergenic
1127835421 15:62787144-62787166 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1127937085 15:63651785-63651807 TCCCAGCATTTGGGAGGCTGGGG + Intronic
1127986437 15:64075764-64075786 TTCCAGCTATTGGGAGGCTGAGG - Intronic
1128024924 15:64427489-64427511 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1128222249 15:65977593-65977615 TCCCAGCTATTCGGAGGCTGAGG - Intronic
1128271798 15:66316697-66316719 TCCCAGCTACTGGGAAGCTGAGG + Intronic
1128274952 15:66345596-66345618 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1128481953 15:68046934-68046956 TCCCAGCTATTGGGAAGCTGAGG + Intergenic
1128893743 15:71354177-71354199 TCCCTGCTATTGGGAAGCTGAGG + Intronic
1129066031 15:72904651-72904673 TCCCAGCATTTGGGAGGCTGAGG + Intergenic
1129100136 15:73254072-73254094 TCCCAGCTGCTCGGAGGCTGAGG + Intronic
1129287595 15:74538716-74538738 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1129355565 15:74988582-74988604 TCCCAGCTACTGGGAAGCTGAGG - Intronic
1129356018 15:74992430-74992452 TCCCAGCTGCTGGGAGGCTGAGG - Intronic
1129417327 15:75393111-75393133 TCCCAGCCCTTGGGATGCTAAGG + Intronic
1130002742 15:80060803-80060825 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1130240309 15:82182139-82182161 TCCCAGCTGTCAGGAGGCTGAGG + Intronic
1130659256 15:85817365-85817387 TCCCAGCTATTGAGAGGCTGAGG - Intergenic
1130758760 15:86795417-86795439 TCCCAGGTAATGGGACCCTCAGG - Intronic
1130827857 15:87567777-87567799 TCACAGCTGGTGAGACCCTCTGG + Intergenic
1130846172 15:87748248-87748270 TCCCAGCTCTTGGGAGGCCGAGG + Intergenic
1131109228 15:89754294-89754316 TCCCAGCTCTCGGGAGGCTGAGG + Intergenic
1131280077 15:91013965-91013987 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1131436620 15:92427865-92427887 TCCCAGCTATTTGGAGGCTGAGG + Intronic
1131488347 15:92840703-92840725 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1132029427 15:98428060-98428082 TCCCAGCTGCTTGGAGGCTGAGG + Intergenic
1132138751 15:99370991-99371013 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1132509659 16:332458-332480 TCCCAGCTCTAGGGAGGCTGAGG + Intronic
1132820245 16:1863273-1863295 TCCCAGCTGCTGGGAGGCAGGGG - Intronic
1133005333 16:2877796-2877818 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1133034166 16:3025755-3025777 TCCCACATGGTGAGACGCTCTGG - Exonic
1133125591 16:3643875-3643897 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1133193703 16:4153357-4153379 TCCCAGCTATTGGGAGGCTGAGG + Intergenic
1133208025 16:4245766-4245788 TCCCAGCTGCTTGGAGGCTGAGG - Intergenic
1133309426 16:4834413-4834435 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1133735606 16:8612938-8612960 TCCCAGCTATCGGGAGGCTGAGG - Intergenic
1133808996 16:9146773-9146795 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1134030302 16:10986967-10986989 TCCCAGCTATTCGGAGGCTGAGG - Intronic
1134274966 16:12767705-12767727 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1134386172 16:13774746-13774768 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1134427730 16:14167805-14167827 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1134608867 16:15592233-15592255 TCCCAGCTGTTCGGAGGCTGAGG + Intronic
1134630275 16:15751274-15751296 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1134641363 16:15831820-15831842 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1134671767 16:16061038-16061060 TCCCAGCTACTCGGACGCTGAGG - Intronic
1135002480 16:18788603-18788625 TCCCAGCTCTTTGGAGGCTGAGG - Intronic
1135015414 16:18920722-18920744 TCCCAGCTATTGGGAGGGTGAGG + Intronic
1135102893 16:19622391-19622413 TCCCAGCACTTTGGAGGCTCAGG - Intronic
1135124480 16:19796960-19796982 TCCCAGCTATTGGGAGGCTGAGG + Intronic
1135140621 16:19918331-19918353 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1135252569 16:20913426-20913448 TCCCAGCTATTTGGAGGCTGAGG - Intronic
1135275169 16:21105929-21105951 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1135321032 16:21496542-21496564 TCCCAGCTATTGGGAGGGTGAGG + Intergenic
1135373866 16:21928044-21928066 TCCCAGCTATTGGGAGGGTGAGG + Intergenic
1135396287 16:22134216-22134238 TCCCAGCATTTGGGAGGCTGAGG - Intronic
1135437920 16:22442677-22442699 TCCCAGCTATTGGGAGGGTGAGG - Intergenic
1135541776 16:23335561-23335583 TCCCAGCTATTGGGAGGCTGAGG - Intronic
1135576901 16:23593042-23593064 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1135578743 16:23607057-23607079 TCCCAGCAATTGGGAGGCTGAGG - Intronic
1135594707 16:23732974-23732996 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1135676909 16:24423200-24423222 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1135829733 16:25762614-25762636 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1135933955 16:26763027-26763049 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1136332513 16:29589650-29589672 TCCCAGCTATTGGGAGGGTGAGG + Intergenic
1136376593 16:29869329-29869351 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1136447207 16:30329746-30329768 TCCCAGCTATTGGGAGGGTGAGG + Intergenic
1136458702 16:30396803-30396825 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1136514236 16:30758186-30758208 TCCCAGCTACTGGGAGGCTGAGG - Exonic
1136617172 16:31405234-31405256 TCCCAGCATTTGGGAGGCTGAGG - Intronic
1136656235 16:31710974-31710996 TCCCAGCTGAGGGGCCACTCGGG + Intergenic
1137320253 16:47373396-47373418 TCCCAGCTATTCGGAGGCTGAGG - Intronic
1137422208 16:48344805-48344827 TCCCAGCTGCTGGGGAGCTGAGG + Intronic
1137429560 16:48407549-48407571 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1137649597 16:50108548-50108570 TCCCAGCTACTGGGAAGCTGAGG + Intergenic
1137993312 16:53181961-53181983 TCCCAGCTATCGGGAGGCTGAGG + Intronic
1138089180 16:54160319-54160341 TCCCAGCTATTGGGAGGTTGAGG - Intergenic
1138437033 16:57007611-57007633 TCCCAGCTATTGGGAGGCTGAGG + Intronic
1138476635 16:57274101-57274123 TCCCAGCTCTTGGGAGGGTGAGG - Intronic
1138602147 16:58062308-58062330 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1138938512 16:61760425-61760447 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1138982130 16:62282088-62282110 TTCCAGCTGTCGGGAGGCTGAGG + Intergenic
1139082933 16:63547617-63547639 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1139092035 16:63659957-63659979 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1139095447 16:63699522-63699544 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1139226390 16:65236354-65236376 TCCCAGCTGGTGGGACCATCTGG - Intergenic
1139238858 16:65369783-65369805 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1139407358 16:66729690-66729712 TCCCAGCAGTTGGGAGGCTGAGG - Intronic
1139413288 16:66783845-66783867 TCCCAGCTATTGGGAGACTAAGG - Intronic
1139451624 16:67031940-67031962 TCCCAGCTATTGGGAGGCTGAGG - Intronic
1139540224 16:67609737-67609759 TCCCAGCTCTTGGGAGGCTGAGG - Intronic
1139575481 16:67839267-67839289 TACCAGCTCTTGGGAGGCTGAGG + Intronic
1139821151 16:69722277-69722299 TCCCAGCTATTCGGAGGCTGAGG - Intronic
1139903319 16:70345137-70345159 TCCCAGCTGCTGGGGAGCTGAGG + Intronic
1140026058 16:71291361-71291383 TCCCAGCTCTAGGGAGGCTGAGG + Intergenic
1140038711 16:71390970-71390992 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1140078961 16:71726264-71726286 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1140108690 16:71984606-71984628 TCCCAGCACTTGGGAGGCTAAGG + Intronic
1140226737 16:73083778-73083800 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1140433726 16:74927335-74927357 TCCCAGCACTTGGGAAGCTGAGG + Intronic
1140465957 16:75182900-75182922 TCCCAGCTCTTGGGAGGCTGAGG + Intergenic
1140493058 16:75357027-75357049 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1140562146 16:75995884-75995906 TCCCAGCTGTCTGGAGGCTGAGG + Intergenic
1140747024 16:77989518-77989540 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1140764498 16:78144635-78144657 TCCCAGCTATTGGGAGGCTGAGG - Intronic
1140913907 16:79477970-79477992 TCCCAGCCGTTGGGAGGCTGAGG - Intergenic
1141084549 16:81083399-81083421 TCCCAGCTACTGGGAAGCTGAGG + Intronic
1141129038 16:81422193-81422215 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1141152068 16:81571217-81571239 TCCCAGCATTTGGGAGGCTCAGG + Intronic
1141208989 16:81958738-81958760 TGCCAGCTGCTGGGAGGCTCTGG + Exonic
1141269675 16:82527833-82527855 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1141278960 16:82613471-82613493 TCCCAGCTCTGGGAACACTCAGG - Intergenic
1141352590 16:83311955-83311977 TCCCAGCTCTCGGGAGGCTGCGG + Intronic
1141459033 16:84166167-84166189 TCCCAGCTCTGGGGAGGCTGAGG - Intronic
1141535480 16:84676835-84676857 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1141583489 16:85017055-85017077 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1141701034 16:85642193-85642215 TCCCAGCTGCTCGGAGGCTGAGG + Intronic
1142033437 16:87849783-87849805 TGCCAGCTCTTGGGTGGCTCTGG + Intronic
1142316747 16:89352139-89352161 TCCCAGCATTTGGGAGGCTGAGG - Intronic
1142384437 16:89753936-89753958 TCCCACCTATTGGGAGGCTGAGG + Intronic
1142419649 16:89962405-89962427 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1142429679 16:90019391-90019413 CCGCAGCTGTTGGGGCGCCCGGG - Intronic
1142431908 16:90033410-90033432 TCCCAGCACTTGGGAGGGTCAGG + Intronic
1142470192 17:158926-158948 TCCCAGCTATTGGGAGGCTGAGG + Intronic
1142857650 17:2740848-2740870 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1142934101 17:3312738-3312760 TCCCAGCTATCGGGAGGCTAAGG - Intergenic
1143082599 17:4392949-4392971 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1143219369 17:5248699-5248721 TCCCAGCTATTGGGAGGCTATGG - Intergenic
1143415600 17:6746726-6746748 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1143603134 17:7962723-7962745 TCCCAGCTCTTGGGAGACTGAGG - Intergenic
1143760721 17:9101874-9101896 TCCCAGCTGCTGGGAGGCTGAGG + Intronic
1144027171 17:11287554-11287576 TCCCAGCTGTTGGGAGGCTGAGG + Intronic
1144133631 17:12271619-12271641 TCCCAGCTCTCGGGAGGCTGAGG - Intergenic
1144348483 17:14371527-14371549 TCCCAGCTGTCAGGAGGCTGAGG - Intergenic
1144436306 17:15245754-15245776 TCCCAGCACTTGGGAGGCCCAGG + Intronic
1144517924 17:15931980-15932002 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1144537440 17:16104653-16104675 TCCCAGCTATTGGGAGGCTGAGG + Intronic
1144689960 17:17254692-17254714 TCCCAGCTCTCGGGAGGCTGAGG + Intronic
1144697901 17:17317844-17317866 TCCCAGCTCTTGGGAGACTGAGG + Intronic
1144711244 17:17403057-17403079 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1144816135 17:18036819-18036841 TCCCAGCATTTGGGAGGCTGAGG + Intronic
1144823114 17:18089252-18089274 TCCCAGCTATTTGGAGGCTGAGG - Intronic
1144930279 17:18853606-18853628 TCCCAGCTGCTGGGGAGCTGAGG + Intronic
1145025511 17:19465191-19465213 TCCCAGCTATTGGGAGGCTGAGG + Intergenic
1145035257 17:19536180-19536202 TCCCAGCTCTTGGGAGGCCGAGG - Intronic
1145083246 17:19913267-19913289 TCCCAGCTATCGGGAGGCTGAGG - Intronic
1145195485 17:20890161-20890183 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1145757057 17:27400137-27400159 TCCCAGCACTTGGGAGGCTAAGG - Intergenic
1145783561 17:27579623-27579645 TCCCAGCATTTGGGAGGCTGAGG + Intronic
1145811827 17:27768942-27768964 TCCCTGCTGTGGGGCAGCTCTGG + Intronic
1145947823 17:28791158-28791180 TCCCAGCTTTTGGGAGGCCGAGG - Intronic
1146034958 17:29398320-29398342 TCCCAGCTGTTGGGAGGCTGAGG - Intronic
1146053603 17:29570155-29570177 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1146055125 17:29577130-29577152 TCCCACCTGTGGGGCTGCTCAGG + Exonic
1146060205 17:29601038-29601060 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1146155086 17:30516828-30516850 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1146219108 17:31002994-31003016 TCCCAGCTATTTGGAGGCTGAGG + Intergenic
1146222616 17:31037860-31037882 TCCCAGCTATCGGGAGGCTGAGG - Intergenic
1146342377 17:32032149-32032171 TCCCAGCTATCGGGAGGCTGAGG + Intronic
1146350430 17:32087447-32087469 TCCCAGCTATCGGGAGGCTGAGG - Intergenic
1146407105 17:32548310-32548332 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1146443890 17:32921091-32921113 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1146500118 17:33356903-33356925 TCCCAGAGGTTGGGACGTTCTGG - Intronic
1146756408 17:35435378-35435400 TCCCAGCTACTGGGAGGCTGAGG - Exonic
1146966414 17:37035006-37035028 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1147016311 17:37494460-37494482 TCCCAGCTTTTAGGAGGCTGAGG - Intronic
1147174486 17:38645405-38645427 TCCCAGCATTTGGGAGGCTGAGG + Intergenic
1147270135 17:39263397-39263419 TCTCAGCTGTTGGGAGGCTGGGG + Intronic
1147284637 17:39392019-39392041 TCCCAGCTATCGGGAGGCTGAGG + Intronic
1147449069 17:40492482-40492504 TCCCAACTATTGGGAGGCTGAGG - Intronic
1147625812 17:41899157-41899179 TCCCAGCTACTCGGAGGCTCAGG + Intronic
1147754152 17:42757067-42757089 TCCCAGCTACTGGGAGGCTAAGG + Intergenic
1147967715 17:44202374-44202396 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
1148033272 17:44637998-44638020 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1148118968 17:45196509-45196531 TCCCAGCTCTTGGGAGGCTGAGG - Intergenic
1148167182 17:45491491-45491513 TCCCAGCTGCTTGGAGGCTGAGG - Intergenic
1148369771 17:47089600-47089622 TCCCAGCATTTGGGAGGCTGAGG + Intergenic
1148428903 17:47625848-47625870 TCCCAGCACTTGGGAGGCCCAGG + Intergenic
1148446429 17:47740612-47740634 TCCCAGCTCTTGGGAGGCTGAGG + Intronic
1148488534 17:48007518-48007540 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1148528897 17:48370420-48370442 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1148591251 17:48818012-48818034 TCCCAGCTATCGGGAGGCTGAGG + Intergenic
1148612800 17:48975664-48975686 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1148939871 17:51199211-51199233 TCCCAGTTCTTGGGAGGCTGAGG - Intronic
1149364778 17:55932382-55932404 TCCCAGCACTTGGGAGGCTAAGG - Intergenic
1149783916 17:59419866-59419888 TCCCAGCTATTCGGAGGCTGAGG - Intergenic
1149971542 17:61223271-61223293 TCCCAGCTATTGGGGGGCTGAGG - Intronic
1149984845 17:61339513-61339535 TCCCAGCAGTTGGGAGGCCAAGG + Intronic
1150052586 17:61979557-61979579 TCCCAGCATTTGGGAGGCTGAGG - Intronic
1150081227 17:62241085-62241107 TCCCAGCACTTGGGAGGCTAAGG - Intergenic
1150185859 17:63180771-63180793 TCCCAGCATTTGGGAGGCTGAGG + Intronic
1150237977 17:63608403-63608425 GTCCAGCTGTTGGGATCCTCTGG + Intergenic
1150297576 17:64021325-64021347 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
1150696230 17:67408069-67408091 TCCCAGCTGCTGGGAGGCTGAGG - Intronic
1150741124 17:67779702-67779724 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1151484897 17:74392756-74392778 TCCCAGCTCTTGGGAGGCTGAGG + Intergenic
1151562704 17:74879151-74879173 TCCCAGCTGCTTGGAAGCTGAGG - Intronic
1151606279 17:75138522-75138544 CCCCAGCTATTGGGAGGCTGAGG - Intronic
1151637485 17:75361020-75361042 TCCCAGCACTTGGGAGGCTAAGG - Intronic
1151640587 17:75389727-75389749 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1151646955 17:75439247-75439269 TCCCGGCTATTGGGAGGCTGAGG - Intergenic
1151673140 17:75583719-75583741 TCCCAGCTCTTGGGAGACTGAGG - Intergenic
1151708117 17:75782744-75782766 TCCCAGCTCTTGGGAGGCTGAGG + Intronic
1151846731 17:76661441-76661463 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1152086332 17:78221365-78221387 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1152131749 17:78481351-78481373 TCCCAGCATTTGGGAGGCTGAGG - Intronic
1152179474 17:78809737-78809759 TCCCAGCTGTTTGGAGGTTGAGG - Intronic
1152364696 17:79848871-79848893 TCCCAGCTCTGGGGCAGCTCTGG + Intergenic
1152369281 17:79876108-79876130 TCCCAGCTACTCGGACGCTAAGG - Intergenic
1152371234 17:79889966-79889988 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1152478046 17:80531245-80531267 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1152564000 17:81092096-81092118 ACCCAGCTCTTGGGTCGCTGAGG - Intronic
1152831323 17:82498534-82498556 TCCCAGCTATCGGGAGGCTGAGG + Intergenic
1153243028 18:3047819-3047841 TCCCAGCTATTCGGAGGCTGAGG + Intergenic
1153551478 18:6266671-6266693 TCCCAGCACTTGGGAAGCTGAGG + Intronic
1153551689 18:6269209-6269231 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1153672636 18:7427129-7427151 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1153798191 18:8644229-8644251 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1153803444 18:8691516-8691538 TCCCAGCTTTTGGGAGGCTGAGG + Intergenic
1153894443 18:9545692-9545714 TCCCAGCTGCTCGGAGGCTGAGG - Intergenic
1154060590 18:11056116-11056138 CCTCAGCTGCTGGGATGCTCTGG + Intronic
1154218625 18:12433539-12433561 TCCCAGCTGTCGGGAGGCTGAGG - Intergenic
1154307145 18:13238933-13238955 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1154351361 18:13586289-13586311 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1154367491 18:13725020-13725042 TCCCAGCCGTTGGGAGGCCGAGG - Intronic
1155078584 18:22385180-22385202 TCCCAGCACTTGGGAAGCTGAGG + Intergenic
1155158023 18:23173845-23173867 TCCCAGCTATTGGGAGGCCAAGG + Intronic
1155171504 18:23270142-23270164 TCCCTGCTGTGGGGAGGCTAGGG + Intronic
1155204760 18:23548904-23548926 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1155274280 18:24171148-24171170 TCCCAGCCATTGGGAGGCTGAGG - Intronic
1155305561 18:24474800-24474822 TCCCAGCTCTCGGGAGGCTGAGG - Intronic
1155325770 18:24663385-24663407 TCCCAGCTATTGGGAGACTGAGG + Intergenic
1155758744 18:29537169-29537191 TCCCAGCAATTGGGAGGCTTAGG - Intergenic
1157372086 18:47123469-47123491 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1157757098 18:50228537-50228559 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1157798565 18:50599532-50599554 TCCCAGCTATTAGGAGGCTGAGG - Intronic
1158074025 18:53508007-53508029 TCCCAGCTCTCGGGAGGCTGAGG - Intronic
1158427227 18:57351691-57351713 CCTCAGCTTTTGGGAGGCTCAGG + Exonic
1158597097 18:58826093-58826115 TCCCAGCTTTTTGGAGGCTGAGG - Intergenic
1158722812 18:59940787-59940809 TCCCAGCACTTGGGAGGCTAAGG - Intergenic
1158755701 18:60321719-60321741 TCTCAGTTGTTTGGACCCTCTGG - Intergenic
1158918308 18:62159861-62159883 TCCCAGCACTTGGGAGGCTAAGG + Intronic
1159244428 18:65786937-65786959 TCCCAGCTATTGGGGGGCTGAGG - Intronic
1159306773 18:66653222-66653244 TCCCAGCAGTTGGGAGGCTGAGG - Intergenic
1159341617 18:67141185-67141207 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
1159362022 18:67417629-67417651 TCCCAGCTTTTGGGAGGCCGAGG - Intergenic
1159442017 18:68493619-68493641 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1159442279 18:68496772-68496794 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1159882972 18:73877229-73877251 TCCCAGCTACTGGGAGGCTGGGG - Intergenic
1159954460 18:74509515-74509537 TCCCAGCTCCTGGGAGGCTGAGG + Intronic
1160173217 18:76571651-76571673 TCCCAGCTCTCGGGAGGCTGAGG + Intergenic
1160344675 18:78123451-78123473 TCCCAGCTGCTGGGAGGCTGAGG - Intergenic
1160596317 18:79977074-79977096 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1160655012 19:261571-261593 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1160755360 19:754345-754367 TCCCAGCTCTAGGGAGGCTGAGG + Intronic
1160800915 19:968241-968263 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1160973339 19:1780141-1780163 TGCCTGCTGTTGGGGCCCTCAGG - Exonic
1161105909 19:2443954-2443976 TCCCAGCTGTTGGGACGCTCGGG - Intronic
1161325715 19:3662975-3662997 TCCCAGCTCTTGGGAGGCTGAGG - Intronic
1161392257 19:4027674-4027696 TCCCAGCTGCTTGGAGGCTGAGG - Intronic
1161691939 19:5740648-5740670 TCCCAGCTATCGGGAGGCTGAGG + Intronic
1161837172 19:6655513-6655535 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1161867320 19:6842716-6842738 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1161924045 19:7288106-7288128 TCCCAGCACTTGGGAGGCCCAGG + Intronic
1162081722 19:8221995-8222017 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1162235756 19:9308228-9308250 TCCCAGCTGGTGGGAAGCTAAGG - Intronic
1162313943 19:9925683-9925705 TCCCAGCAATTGGGAGGCTGAGG - Intronic
1162416728 19:10543085-10543107 TCCCAGCATTTGGGAGGCTGAGG + Intergenic
1162417718 19:10548144-10548166 TCCCAGCTATTGGGAGGCTGAGG - Intronic
1162437043 19:10667369-10667391 TCCCAGCTATAGGGAGGCTGAGG - Intronic
1162448542 19:10739601-10739623 TCCCAGCATTTGGGAGGCTGAGG + Intronic
1162469277 19:10862711-10862733 TCCCAGCTATTAGGAGGCTGAGG + Intronic
1162492353 19:11000760-11000782 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1162517929 19:11160948-11160970 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1162556918 19:11392768-11392790 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1162631950 19:11935058-11935080 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1162635128 19:11962164-11962186 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1162704921 19:12548331-12548353 TCCCAGCTGCTGGGTGGCTGAGG - Intronic
1162729289 19:12708246-12708268 TCCTAGCTATTGGGAGGCTGAGG - Intronic
1162810517 19:13161997-13162019 TCCCACCTCTTGGGAGGCTGAGG + Intergenic
1162875763 19:13619790-13619812 TCCCAGCTCTCGGGAGGCTGAGG - Intronic
1162884486 19:13686210-13686232 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1162890954 19:13732723-13732745 TCCCAGCTACTGGGAGGCTAAGG - Intronic
1162903005 19:13806414-13806436 TCCCAGCATTTGGGAGGCTGAGG + Intronic
1163043226 19:14618436-14618458 TCCCAGCTATCGGGAGGCTAAGG + Intergenic
1163078872 19:14921264-14921286 TCCCAGCTACTGGGAGGCTAAGG + Intergenic
1163132360 19:15282849-15282871 TCCCAGCTCTTAGGAGGCTCAGG + Intronic
1163259414 19:16178956-16178978 TACCAGCTATTGGGAGGCTGAGG + Intergenic
1163352683 19:16788316-16788338 TCCCAGCACTTGGGAGGCTCAGG + Intronic
1163416845 19:17192070-17192092 TCCCAGCTGCTTGGAGGCTGAGG - Intronic
1163672506 19:18637121-18637143 TCTCACCTGTTCGGGCGCTCGGG - Exonic
1163877783 19:19889460-19889482 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1163937997 19:20467646-20467668 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1164043470 19:21512985-21513007 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1164133498 19:22388130-22388152 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1164165309 19:22668625-22668647 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1164167071 19:22689699-22689721 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1164605148 19:29592652-29592674 TCCCAGCCTTTGGGAGGCTGAGG + Intergenic
1164626994 19:29736237-29736259 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1164627458 19:29738911-29738933 TCCCAGCTATTGCGAGGCTGAGG + Intergenic
1164852401 19:31495305-31495327 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1164886509 19:31783069-31783091 TCCCAGCTGCTGGGACGCTGAGG - Intergenic
1165059342 19:33197373-33197395 TCCCAGCATTTGGGAGGCTGAGG + Intronic
1165196362 19:34107176-34107198 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1165210895 19:34235010-34235032 TCCCAGCTGCCGGGAGGCTGAGG - Intergenic
1165535410 19:36440165-36440187 TCCCAGCTTTTGGGAGGCCAAGG + Intergenic
1165541837 19:36498287-36498309 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1165542197 19:36500973-36500995 TCCCAGCACTTGGGAGGCCCAGG - Intergenic
1165598507 19:37032221-37032243 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1165634694 19:37330934-37330956 TCCCAGCGTTTGGGAGGCTGAGG + Intronic
1165644173 19:37419605-37419627 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1165737789 19:38187878-38187900 TCTCAGCTATTGGGAGGCTGAGG + Intronic
1165886174 19:39080283-39080305 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1165936932 19:39395102-39395124 TCCCAGCGCTTGGGAGGCTGAGG - Intronic
1165961382 19:39537447-39537469 TCCCAGCTCTTGGGAGGCTGAGG + Intergenic
1166144123 19:40822568-40822590 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1166183489 19:41124512-41124534 TCCCAGCACTTGGGAGGCCCAGG - Intronic
1166189506 19:41166624-41166646 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1166208355 19:41288359-41288381 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1166223551 19:41380967-41380989 TCCCCGCTTTTGGGAGGCTGAGG + Intronic
1166452975 19:42917477-42917499 TCCCAGCTTTCGGGAGGCTGAGG - Intronic
1166726402 19:45030679-45030701 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1166794533 19:45418570-45418592 TCCCAGCCTTTGGGAGGCTGAGG + Intronic
1166827457 19:45618324-45618346 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1166982173 19:46637697-46637719 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1167036198 19:46996351-46996373 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1167115149 19:47484818-47484840 TCCCAGCTGCTGGGAGGCTGAGG - Intergenic
1167233539 19:48299684-48299706 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1167496439 19:49821698-49821720 TCCCAGCTCTTGGGAGGCTGAGG + Intronic
1167541378 19:50090035-50090057 TCCCAGCTACTGGGTCGCTGAGG + Intergenic
1167628713 19:50609474-50609496 TCCCAGCTACTGGGTCGCTGAGG - Intergenic
1167838925 19:52097851-52097873 TCCCAGCTATTGGGAGGCTGAGG + Intergenic
1167841930 19:52129159-52129181 TCCCAGCTATTGGGAGGCTGAGG + Intronic
1167878056 19:52430664-52430686 TCCCAGCTCTTAGGAGGCTGAGG - Intronic
1167950987 19:53027634-53027656 TCACAGCTATTGGGAGGCTGAGG - Intergenic
1168003050 19:53464256-53464278 TCCCAGCTGCTGGAGCGCTGAGG + Intergenic
1168013385 19:53552614-53552636 TCCCAGCTCTTGGGAGGCTAAGG + Intronic
1168021784 19:53614065-53614087 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1168325248 19:55535615-55535637 TCCCAGCAATTGGGAGGCTGAGG + Intronic
1168382197 19:55933364-55933386 TCCCAGCTACTCGGACGCTGAGG - Intergenic
1168541591 19:57216233-57216255 TCCCAGCTGCTGGGGGGCTGAGG + Exonic
1168622015 19:57887070-57887092 TCCCAGCTACTGGGAGGCTGAGG + Intronic
925020688 2:565382-565404 TCCCAGCTCTTGGGGTCCTCGGG + Intergenic
925133846 2:1512805-1512827 TCCCAGCTCCTGAGATGCTCTGG - Intronic
925290569 2:2745605-2745627 TCCCAGCTGTGGGAACTCTAGGG + Intergenic
925484961 2:4318332-4318354 TCCCAGCTGCTGGGAGGCTGAGG - Intergenic
925814202 2:7731771-7731793 TCCCAGGTGTTGGGAGAGTCAGG + Intergenic
926266020 2:11321424-11321446 TCCCAGCACTTGGGAGGCTGAGG - Intronic
926663943 2:15499177-15499199 TCCCAGCACTTGGGAGGCTGAGG - Intronic
927196792 2:20553361-20553383 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
927294689 2:21440572-21440594 TCCCAGCTGTTGGGAAGGTCAGG - Intergenic
927368525 2:22327492-22327514 TCCCAGCTATTGGGAGGCTGAGG + Intergenic
927375017 2:22403521-22403543 TCCCAACTATTGGGAGGCTGAGG - Intergenic
927555529 2:24028519-24028541 TCCCAGCACTTGGGAGGCTGAGG + Intronic
927755401 2:25704575-25704597 TCCCAGCTATTGGGAGGCTGAGG - Intergenic
928299415 2:30112229-30112251 TCCCAGCATTTGGGAGGCTCAGG + Intergenic
928307622 2:30183489-30183511 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
928321913 2:30290703-30290725 TCCCAGCTGTTGTGATCATCTGG + Intronic
928678706 2:33676990-33677012 TCCCAGCTCTTGGGAGGCTGAGG - Intergenic
928686681 2:33757279-33757301 TCCCAGCTCTCGGGAGGCTGAGG - Intergenic
928706009 2:33950462-33950484 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
928764299 2:34624149-34624171 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
928773501 2:34730978-34731000 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
928775617 2:34759664-34759686 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
928972185 2:37041493-37041515 TCCCAGCATTTGGGAGGCTGAGG + Intronic
929058076 2:37895802-37895824 TCCCAGCTATGGGGAGGCTAAGG + Intergenic
929206351 2:39298847-39298869 TCCCAGCTACTGGGAGGCTGGGG + Intronic
929740601 2:44595354-44595376 TCCCAGCACTTTGGACGCTGAGG - Intronic
929850669 2:45586659-45586681 TCCCAGCTATTTGGAGGCTGAGG - Intronic
929959214 2:46483901-46483923 TCCCATCTATTGGGAGGCTGAGG - Intronic
929981832 2:46688505-46688527 TCCCAGCTATTGGGAGGCTGAGG + Intergenic
930634426 2:53788511-53788533 TCCCAGCTACTGGGAAGCTGAGG - Intronic
930800804 2:55440731-55440753 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
930824059 2:55677853-55677875 TCCCAGCTACTGGGAGGCTGAGG - Intronic
930824660 2:55684239-55684261 TCCCAGCACTTGGGAGGCTGAGG + Intronic
930872126 2:56181215-56181237 TCCCAGCTATCGGGAGGCTGAGG - Intergenic
931049832 2:58399665-58399687 TGCCAGCTATTGGGAGGCTGAGG - Intergenic
931148953 2:59551225-59551247 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
931265687 2:60658165-60658187 TCCCAGCAGATGGGAGGCTGAGG - Intergenic
931314293 2:61112742-61112764 TCCCAGCAGTTGGGAGGCCGAGG - Intronic
931331036 2:61283730-61283752 TCCCAGCTATTGGGAGGCTGAGG - Intronic
931382523 2:61766749-61766771 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
931405541 2:61974041-61974063 TCCCAGCACTTGGGAGGCTGAGG + Intronic
931539437 2:63313995-63314017 TCCCAGCTATCGGGAGGCTGAGG - Intronic
931618374 2:64184809-64184831 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
931891753 2:66680949-66680971 TCCCAGCAGTTGGGAGGATGAGG + Intergenic
931947807 2:67330850-67330872 TCCCAGATCTTGGGAGGCTAAGG + Intergenic
931963962 2:67512987-67513009 TCCCAGCTATTGAGAGGCTGAGG + Intergenic
932000298 2:67878744-67878766 TCCATACTGTTGGGAAGCTCAGG + Intergenic
932009406 2:67960286-67960308 TCCCAGCTGTTGGTACATCCTGG + Intergenic
932026915 2:68143111-68143133 TCCCAGCACTTGGGAGGCTGAGG - Intronic
932109840 2:68987953-68987975 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
932321611 2:70826490-70826512 TCCTAGCTCTTGGGAGGCTGAGG - Intergenic
933041031 2:77466947-77466969 TCCCAGCACTTGGGAGGCTAAGG - Intronic
933667969 2:84980081-84980103 TCCCAGCACTTGGGAGGCTGAGG - Intronic
933737187 2:85504595-85504617 TCCCAGCTTTTGGTAGGCTAAGG - Intergenic
933805175 2:85993887-85993909 TCCCAGATATTGGGAAGCTAAGG + Intergenic
933872305 2:86579117-86579139 TCCCAGCACTTGGGAGGCTGAGG - Intronic
933881161 2:86671242-86671264 TCCCAGCTATTGGGAGGCTGAGG + Intronic
934033157 2:88065712-88065734 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
934090381 2:88545844-88545866 TCCCAGCTGTTGGGAAGCTGAGG - Intergenic
934743225 2:96740887-96740909 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
934757657 2:96835582-96835604 TCCCAGCTATGGGGAGGCTGAGG - Intronic
935011934 2:99143720-99143742 TCCCAGCACTTGGGATGCTGAGG - Intronic
935115572 2:100133042-100133064 TCCCAGCTGTTGGGAGGCTGAGG - Intronic
935164789 2:100561128-100561150 TCCCAGCTATTCGGAAGCTGAGG + Intergenic
935203345 2:100877212-100877234 TCCCAGCACTTGGGAGGCTGAGG + Intronic
935372073 2:102357239-102357261 TCCCAGCACTTGGGAGGCTGAGG + Intronic
935513124 2:104001053-104001075 TCCCAGCTATCGGGAGGCTGAGG + Intergenic
935783229 2:106526123-106526145 TCCCAGCTATTCGGAGGCTGGGG + Intergenic
936021744 2:109000408-109000430 TCCCAGCTATCGGGAGGCTGAGG + Intergenic
936067555 2:109343858-109343880 TCTCAGCTATTGGGAGGCTGAGG - Intronic
936155211 2:110042651-110042673 TCGCAGCTTTAGGGAAGCTCTGG + Intergenic
936189470 2:110328762-110328784 TCGCAGCTTTAGGGAAGCTCTGG - Intergenic
936396358 2:112134827-112134849 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
936434518 2:112492612-112492634 TCCCAGCTACTGGGAGGCTGAGG + Intronic
936454573 2:112662462-112662484 TCCCAGCACTTGGGAGGCTGAGG + Intronic
937294334 2:120800619-120800641 TCCCAGCTACTGGGAGGCTGAGG - Intronic
937407342 2:121642479-121642501 TCCCAGCATTTGGGAGGCTGAGG + Intronic
937423477 2:121777905-121777927 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
937625745 2:124041975-124041997 TCCCAGCTATTCGGAGGCTGAGG - Intronic
937936665 2:127250957-127250979 TCCCAGCACTTGGGAGGCCCAGG - Intergenic
938008222 2:127806456-127806478 TCCCAGCACTTGGGAGGCTGAGG - Intronic
938010711 2:127826691-127826713 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
938212145 2:129477356-129477378 TCCCAGCTATAGGGAGGCTGAGG + Intergenic
938306656 2:130261050-130261072 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
938325684 2:130398450-130398472 TCCCAGCATTTGGGAGGCTGAGG + Intergenic
938398849 2:130971407-130971429 TCCCAGCCTTTGGGAGGCTCAGG + Intronic
938469668 2:131546845-131546867 TCCCAGCACTTGGGAAGCTGAGG - Intergenic
938600594 2:132834737-132834759 TCCCAGCCTTTGGGAAGCTGAGG - Intronic
938930608 2:136083382-136083404 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
939058442 2:137391569-137391591 TCCCATCTATTGGGAGGCTGAGG + Intronic
939239535 2:139539722-139539744 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
939865439 2:147467335-147467357 TCCCAGCTGCTGGGTGCCTCAGG + Intergenic
940119219 2:150244675-150244697 TCCCAGCTGTCGGGAGGCTGAGG + Intergenic
940207936 2:151224759-151224781 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
940281106 2:151990438-151990460 TCCCTGCTGTGGGGTCTCTCAGG + Intronic
941057751 2:160807761-160807783 TCCCAGCTATTGGCAGGCTGAGG + Intergenic
941448342 2:165628813-165628835 TCCCAGCTTTTGGGAGGCCAAGG + Intronic
941575203 2:167221345-167221367 TCCCAGCTACTGGGAGGCTGAGG + Intronic
941790362 2:169546045-169546067 TTCCAGCGGTTGGGAGGCTGAGG - Intronic
942029710 2:171947368-171947390 TCCCAGCTACTCGGAGGCTCAGG - Intronic
942105801 2:172632149-172632171 TCCCAGCTATAGGGAGGCTGAGG + Intergenic
942188073 2:173443660-173443682 TCCCAGCCGCTGGGAGGCTGAGG - Intergenic
942280483 2:174358353-174358375 TCACAGCTGCTGGGAGGCTGAGG - Intronic
942949607 2:181707498-181707520 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
943027423 2:182646566-182646588 TCCCAGCTATTCGGAGGCTGAGG + Intergenic
943642259 2:190372509-190372531 TCCCTGCAGTTGGCACTCTCTGG - Intergenic
943681353 2:190771310-190771332 TCCCAGCACTTGGGAAGCTGAGG - Intergenic
943752619 2:191525618-191525640 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
943790749 2:191929945-191929967 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
943915706 2:193629056-193629078 TCCCAGCTACTGGGAAGCTGAGG + Intergenic
944142919 2:196476325-196476347 TCCCAGCTATTAGGTCGCTGAGG + Intronic
944337386 2:198551790-198551812 TCCCAGCTACTGGGAGGCTGAGG + Intronic
944674634 2:202024864-202024886 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
944705867 2:202287858-202287880 TCCCAGCACTTGGGAGGCTGAGG + Intronic
944717651 2:202391419-202391441 TCCCAGCTACTGGGAGGCTGAGG - Intronic
944820536 2:203425903-203425925 TCCCAGCACTTGGGAGGCTGAGG + Intronic
945013879 2:205494009-205494031 TCCCAGCACTTGGGAGGCTGAGG - Intronic
945058904 2:205891501-205891523 TCCCAGCTATTTGGAGGCTGAGG - Intergenic
945099304 2:206249812-206249834 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
945254090 2:207789690-207789712 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
945422851 2:209660507-209660529 TCCCAGCTATTGGGAGGCTGAGG - Intronic
945701251 2:213173421-213173443 TCCCAGCTATAGGGAGGCTGAGG + Intergenic
945798357 2:214392404-214392426 TCCCAGCCTTTGGGAGGCTGAGG - Intronic
945802657 2:214452269-214452291 TCCCAGCTACTGGGAGGCTGAGG - Intronic
946323599 2:218969753-218969775 TCCCAGCTTTTGGGAGGCTGAGG - Intergenic
946839779 2:223808877-223808899 TCCCAGCTACTGGGAGGCTGAGG + Intronic
946925543 2:224623269-224623291 TCCCAGCTATCGGGAGGCTGAGG - Intergenic
947236582 2:227947831-227947853 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
947649705 2:231775423-231775445 TCCCAGCTACTGGGAGGCTGAGG - Intronic
947786038 2:232821079-232821101 TCCCAGCATTTGGGAGGCTGAGG - Intronic
947859064 2:233345899-233345921 TCCCAGCACTTGGGAGGCTGAGG + Intronic
948791496 2:240380058-240380080 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
948998798 2:241599956-241599978 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1169308391 20:4514611-4514633 TCCATGCTGTTGGGAGCCTCTGG - Intergenic
1169370214 20:5023166-5023188 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1169449651 20:5700833-5700855 TCCCAGGTGCTGGGAGGCTGAGG - Intergenic
1169459096 20:5779084-5779106 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1169786625 20:9366279-9366301 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1169790633 20:9406609-9406631 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1170221837 20:13949545-13949567 TCCCAGCTATCGGGAGGCTGAGG + Intronic
1170553650 20:17498473-17498495 TCCCAGCAGGTGGGATGCCCAGG - Intronic
1170958886 20:21007283-21007305 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1171285401 20:23933517-23933539 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1171305083 20:24098348-24098370 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1171990638 20:31693784-31693806 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1172059965 20:32180680-32180702 TCCCAGCTATTCGGAGGCTGAGG - Intergenic
1172111185 20:32546062-32546084 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1172287689 20:33752766-33752788 TCCCAGCTATCGGGAGGCTGAGG - Intronic
1172418146 20:34788826-34788848 TCCCAGCTACTGGGAGGCTAAGG + Intronic
1172454421 20:35056727-35056749 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1172564257 20:35916581-35916603 TCCCAGCTATGGGGAGGCTGAGG - Intronic
1172945433 20:38684072-38684094 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1173232887 20:41215139-41215161 TCCCAGCTATCGGGAAGCTGAGG + Intronic
1173260530 20:41431081-41431103 TCCCAGCCTTTGGGAGGCTGAGG - Intronic
1173589155 20:44210697-44210719 TCCTCGCAGCTGGGACGCTCCGG + Intronic
1173797413 20:45871743-45871765 TCCCAGCTCTTGGGAGGCTGAGG + Intronic
1173895972 20:46550950-46550972 TCCCTGCTCTTGGGACTCACAGG + Intergenic
1173902872 20:46603873-46603895 TCCCAGCTCTTGAGAGGCTGAGG + Intronic
1173939176 20:46895107-46895129 CCGCAGCTGTCGGGACGTTCTGG + Intronic
1173966149 20:47114362-47114384 TCCCAGCACTTGGGAAGCTGAGG + Intronic
1173985893 20:47261102-47261124 TCCCAGCTACTCGGAGGCTCAGG + Intronic
1174016654 20:47494158-47494180 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1174021610 20:47534797-47534819 TCCCAGCTGTTGGGTGGCTGAGG + Intronic
1174194695 20:48764664-48764686 TCCCAGCTCTTGGAAGGCTGAGG + Intronic
1174463432 20:50699175-50699197 TCCCAGCTACTGGGAGGCTGGGG + Intergenic
1174495772 20:50941459-50941481 TCCCAGCTACTGGGAAGCTGAGG + Intronic
1174641356 20:52047242-52047264 TCCCAGCTATTGGGAGGCTGAGG - Intergenic
1174702740 20:52625519-52625541 TCCCAGCTGCTTGGAAGCTGAGG + Intergenic
1174817935 20:53702685-53702707 TCCCAGCATTTGGGAGGCTGAGG + Intergenic
1174830057 20:53804282-53804304 TCCCGGTTCTTGGGAGGCTCAGG - Intergenic
1174833422 20:53834657-53834679 TCCCAGCTCTTCGGAGGCTGAGG - Intergenic
1174873919 20:54207937-54207959 TCCCAGCCGTTTGGACTCACTGG + Exonic
1175000827 20:55629183-55629205 TCCCATCTCTTGGGAGGCTGAGG - Intergenic
1175201564 20:57281409-57281431 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1175433012 20:58920371-58920393 TCCCAGCTATAGGGAGGCTGAGG + Intergenic
1176097857 20:63352524-63352546 CCCCCGCTGGAGGGACGCTCGGG - Intronic
1176419532 21:6503149-6503171 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1176624547 21:9082275-9082297 TCCCAGCTACTGGGAGGCTGGGG + Intergenic
1177049117 21:16209558-16209580 TCCCAGCTCTTGGGAGGCTGAGG + Intergenic
1177076093 21:16575415-16575437 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1177214100 21:18106609-18106631 TCCCAGCTATTTGGAGGCTGAGG - Intronic
1177226256 21:18260695-18260717 TCCCAGCTACTGGGAAGCTGAGG + Intronic
1177303999 21:19288786-19288808 TCCCAGCTATTCGGAGGCTCAGG + Intergenic
1177459739 21:21395216-21395238 TCCCAGCTCTTGGGAGGCTGAGG + Intronic
1177587613 21:23118949-23118971 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1177638668 21:23818436-23818458 TCCCAGCACTTGGGAAGCTGAGG + Intergenic
1177773742 21:25545337-25545359 TCCCAGCATTTGGGAGGCTAAGG - Intergenic
1177808637 21:25901045-25901067 TCCCAGCCTTTGGGAGGCTGAGG + Intronic
1178136481 21:29633380-29633402 TCCCAGCTGCTCGGAGGCTGAGG + Intronic
1178357818 21:31923322-31923344 TCCCAGCTCCTGGGAGGCTGAGG + Intronic
1178450315 21:32692458-32692480 TCCCAGCTCTCGGGAGGCTGAGG + Intronic
1178555990 21:33590529-33590551 TCCCAGCTACTGGGAGGCTGGGG - Intronic
1178890759 21:36519458-36519480 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1179143283 21:38746170-38746192 TCCCAGTAGTTGGGAAGCTGAGG + Intergenic
1179477932 21:41659809-41659831 TCCCAGGTGCTGGGACCCTCAGG + Intergenic
1179695025 21:43111472-43111494 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1179811778 21:43876037-43876059 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1179918154 21:44491411-44491433 TCCCAGCCCTTGGGAGGCTGAGG - Intergenic
1180056266 21:45360652-45360674 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1180557346 22:16588513-16588535 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1180993449 22:19952521-19952543 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1181321744 22:22012617-22012639 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1181396243 22:22624628-22624650 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
1181555501 22:23669332-23669354 TCCCAGCTGGTGGAAGGCTGAGG + Intergenic
1181680256 22:24490829-24490851 TTCCAGCTACTGGGAGGCTCAGG - Intergenic
1181704377 22:24640219-24640241 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
1181904062 22:26179136-26179158 TCCCAGCAGTTGGGAGGCTGAGG + Intronic
1182324895 22:29505025-29505047 TCCCAGCTCTTGGGAGGCTAAGG + Intergenic
1182832054 22:33312322-33312344 TCCCAGCTATTGGGAGGTTGAGG + Intronic
1182849280 22:33458220-33458242 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1183487202 22:38095033-38095055 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1183756152 22:39767371-39767393 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1183881065 22:40830408-40830430 TCCCAGCTCTTGGGAGGCTGTGG - Intronic
1183973902 22:41498975-41498997 TCCCAGCTACTGGGAAGCTGAGG + Intronic
1184344166 22:43902909-43902931 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
1184560607 22:45260896-45260918 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1184565506 22:45289323-45289345 TCCCAGCCTTTGGGAGGCTGAGG + Intronic
1184807897 22:46807849-46807871 TCCCAGCAGTTGGGAGGCCTAGG + Intronic
1184985835 22:48133023-48133045 TCCCAGCTATCGGGAGGCTGAGG + Intergenic
1185149721 22:49157201-49157223 TTCCAGCTGTGGAGACGGTCGGG + Intergenic
1185242305 22:49753214-49753236 TCCCAGCTACTGGGAGGCTAAGG - Intergenic
1185251797 22:49805990-49806012 TCCCAGCACTTGGGACGCCGAGG - Intronic
1185353231 22:50349245-50349267 TCCCAGCTGCTCGGACACTGAGG + Intronic
1185385051 22:50527889-50527911 TCCCAGCTACTGGGAAGCTGAGG - Intronic
950056782 3:10031384-10031406 TCCCAGCTACTGGGAGGCTGAGG + Intronic
950057109 3:10034071-10034093 TCCCAGCACTTGGGAGGCTGAGG + Intronic
950411125 3:12838288-12838310 TCCCAGCTCTTGGGAGGGTGAGG + Intronic
950853290 3:16082983-16083005 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
951212428 3:19990259-19990281 TCCCAGCTCTCGGGAGGCTGAGG - Intronic
951514272 3:23540844-23540866 TCCCAGCTCTTGGGAGGTTGAGG - Intronic
951520316 3:23605190-23605212 TCCCAGCTGTCAGGAGGCTGAGG + Intergenic
951560194 3:23958522-23958544 TCCCAGCTCTTGGGAGGCTGAGG + Intronic
951618594 3:24576155-24576177 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
951701381 3:25500593-25500615 TCCCAGCCCTTGGGAGGCTGAGG - Intronic
951726412 3:25765846-25765868 TCCTAGCTGCTGGGAGGCTGAGG - Intronic
951741145 3:25925115-25925137 TCCCAGCTATTGGGAGGCTGAGG - Intergenic
951769018 3:26234013-26234035 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
952348941 3:32515948-32515970 TCCCAGCTGCCGGGAGGCTGAGG + Intergenic
952668535 3:35937465-35937487 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
952927457 3:38331168-38331190 TCCCAGCTATTGGGAGGCCGAGG - Intergenic
953150632 3:40321027-40321049 TCCCAGCTATGGGGAAGCTGAGG + Intergenic
953597484 3:44331576-44331598 CCCCAGCGCTTTGGACGCTCAGG - Intronic
953762479 3:45700786-45700808 TCCCAGCTATTGGGAGGCTAAGG - Intronic
954055441 3:48019758-48019780 TCCCAGCTCTTGGGAGGCTGAGG + Intronic
954128263 3:48545381-48545403 TCCCAGCACTTGGGAGGCTGAGG - Intronic
954207381 3:49070151-49070173 TCCCAGCTATTCGGAGGCTAAGG - Intronic
954236354 3:49260121-49260143 TCCCAGCACTTGGGAGGCCCAGG + Intergenic
954429448 3:50462270-50462292 TCCCAGCTACTGGGGGGCTCAGG + Intronic
954780649 3:53057106-53057128 TCCCAGCTACTGGGAGGCTGAGG - Intronic
954785138 3:53087119-53087141 TCCCAGCTACTGGGAGGCTGAGG + Intronic
954786325 3:53095459-53095481 TCCCAGCATTTGGGAGGCTAAGG + Intronic
954814393 3:53269383-53269405 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
954826442 3:53377631-53377653 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
954930408 3:54276316-54276338 TCCCAGCATTTGGGAAGCTGAGG + Intronic
955049438 3:55395341-55395363 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
955251209 3:57284378-57284400 TCCCAGCCTTTGGGAGGCTGAGG - Intronic
955331484 3:58050915-58050937 GCGCTGCTGTTGGGATGCTCAGG + Intronic
955350675 3:58190913-58190935 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
955374203 3:58380692-58380714 TCCCAGCTGCTTGGAGGCTGAGG + Intronic
955385465 3:58475904-58475926 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
955676734 3:61456822-61456844 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
955974636 3:64468231-64468253 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
956138143 3:66119046-66119068 TCCCAGCTACTTGGACGCTGAGG + Intergenic
956150077 3:66231885-66231907 TCCTAGCTGCTGGGAGGCTGAGG - Intronic
956164436 3:66385701-66385723 TCCCAGCAGTTGGGAGACTGAGG - Intronic
956821484 3:72958155-72958177 TCCCAGCTACTGGGAGGCTGAGG + Intronic
956937658 3:74121633-74121655 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
957057808 3:75457721-75457743 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
957391053 3:79569982-79570004 TCCCAGCTAGTGGGATGCTGAGG + Intronic
957504481 3:81101725-81101747 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
957661150 3:83155362-83155384 TCCCAGCTATTGAGAGGCTGAGG + Intergenic
957790958 3:84940889-84940911 TCCCAGCATTTGGGAGGCTGAGG + Intergenic
958707037 3:97668795-97668817 TCCCAGCTCTCGGGAGGCTGAGG + Intronic
958933299 3:100230523-100230545 TCCCAGCTATTCGGAGGCTGAGG + Intergenic
958949749 3:100403578-100403600 TCCCAGCTACTGGGACGCTGAGG - Intronic
958966521 3:100564597-100564619 TCCCAGCTCTTGGGAGACTGAGG - Intronic
959333118 3:105031619-105031641 TCCCAGCACTTGGGAGGCTAAGG + Intergenic
959446851 3:106450921-106450943 TCCCAGCTGCTGGGGGGCTGAGG + Intergenic
959469752 3:106735901-106735923 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
959514646 3:107251119-107251141 TCCCAGCACTTGGGAAGCCCAGG - Intergenic
960435245 3:117618613-117618635 TTCTAGCTTTTGGGAGGCTCAGG + Intergenic
960918366 3:122720854-122720876 TCCCAGCTATTGGGAGGCTGAGG + Intronic
961196760 3:125008679-125008701 TCCCAGCTATTTGGAGGCTGAGG + Intronic
961265122 3:125635315-125635337 TCCCAGCTATTGGGAGGCTGAGG - Intergenic
961736711 3:129006430-129006452 TCCCAGCTATGGGGAGGCTGAGG - Intronic
961807091 3:129497150-129497172 TCCCAGCTACTGGGAGGCTAAGG + Intronic
961832504 3:129631153-129631175 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
961836228 3:129662520-129662542 TCCCAGCTGCTTGGAAGCTGAGG + Intronic
961997562 3:131262268-131262290 TCCCAGCTATTGGGAGGCTGAGG + Intronic
962103375 3:132365872-132365894 TCCCAGCTACTGGGAGGCTGAGG + Intronic
962765887 3:138561905-138561927 TCCCAGCTATTGGGAGGCTGAGG + Intronic
962816000 3:139000917-139000939 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
963006298 3:140728870-140728892 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
963219008 3:142785615-142785637 TCCCAGCTACTGGGAGGCTAAGG - Intronic
963544769 3:146642815-146642837 TCCCAGCATTTGGGAGGCTGAGG + Intergenic
963595370 3:147318512-147318534 TCCCAGCAGTTGGGAGGCCAAGG - Intergenic
963773985 3:149420102-149420124 TTCCAGCACTTGGGACGCTGAGG + Intergenic
963932419 3:151017431-151017453 TCCCAGCTACTGGGATGCTGAGG + Intergenic
964119668 3:153169692-153169714 TCCCAACTCTTGGGAGGCTGAGG - Intergenic
964419755 3:156489014-156489036 AACCAGCTGTGGGGAAGCTCAGG + Intronic
964797122 3:160511039-160511061 TCCCAGCACTTGGGAGGCTGAGG - Intronic
965255905 3:166410501-166410523 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
965659046 3:171021533-171021555 TCCCAGCGTTTGGGAGGCTGAGG + Intronic
965801985 3:172504102-172504124 TCCCAGCTATTGGGGAGCTGAGG + Intergenic
965853799 3:173064053-173064075 TCCCAGCACTTGGGAGGCTGAGG + Intronic
966199659 3:177348656-177348678 TCCCAGCTACTGGGACGCTGAGG + Intergenic
966358197 3:179104584-179104606 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
966363925 3:179161579-179161601 TCCCAGCTATCGGGAGGCTTAGG + Intronic
966364889 3:179174352-179174374 TCCCAGCTCTCGGGAGGCTAAGG + Intronic
966428836 3:179810127-179810149 TCCCAGCTATTCGGACGCTGAGG - Intronic
966555019 3:181249432-181249454 TCCCAGCTCTTGGGAGGCTGAGG - Intergenic
966842162 3:184098791-184098813 TCCCAGCACTTGGGACGCTGAGG + Intronic
967313674 3:188130414-188130436 TCCCAGCTCTCGGGAGGCTGAGG - Intergenic
967348997 3:188491009-188491031 TCCCAGCACTTGGGAGGCTGAGG - Intronic
967793926 3:193578041-193578063 TCCCAGCACTTGGGAGGCTGAGG + Intronic
967846452 3:194046918-194046940 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
967871241 3:194231630-194231652 TCCCACCTCTTGGGAGGCTGAGG - Intergenic
967974276 3:195023395-195023417 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
968054788 3:195683147-195683169 TCCCAGCATTTGGGAGGCTGAGG + Intergenic
968101121 3:195966125-195966147 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
968133335 3:196205774-196205796 TCCCAGCTATTTGGAGGCTGAGG - Intronic
968612328 4:1562950-1562972 GCCCAGCTCTTGGGACAGTCTGG + Intergenic
968665757 4:1821570-1821592 TCCCAGATATTGGGAGGCTGAGG + Intronic
968690883 4:1989567-1989589 TCACACCTGTTGGGAGGCTGGGG - Intronic
968768560 4:2488345-2488367 TCCCAGCTACTGGGAGGCTGAGG + Intronic
969492259 4:7506113-7506135 TCCCAGTGGTAGGGACACTCCGG + Intronic
969735803 4:8989389-8989411 TCCCAGCCCTTGGGAGGCTGAGG + Intergenic
969815731 4:9686026-9686048 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
969967426 4:11011644-11011666 TCCCAGCTATTTGGAGGCTGAGG + Intergenic
970393428 4:15640294-15640316 TCCCAGCACTTGGGAAGCTGAGG - Intronic
970734874 4:19154058-19154080 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
971322590 4:25617265-25617287 TCCCAGCTATTGGGAGGCTGAGG + Intergenic
971325332 4:25638769-25638791 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
971416720 4:26438691-26438713 CCCCAGCTCTCGGGACGCTGAGG - Intergenic
971456692 4:26851830-26851852 TCCCAGCTATTGGGAGGCTGAGG - Intergenic
971888415 4:32483465-32483487 TCCCAGCATTTTGGAGGCTCAGG - Intergenic
972037762 4:34548101-34548123 TCCCAGCTATTTGGAGGCTGAGG + Intergenic
972057602 4:34824184-34824206 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
972086541 4:35223947-35223969 TCCCAACTATTGGGAGGCTGAGG + Intergenic
972167858 4:36309334-36309356 TCCCAGCCGCTGGGAGGCTGAGG + Intronic
972252457 4:37318139-37318161 TCCCAGCTATTTGGAGGCTGAGG - Intronic
972433847 4:39012687-39012709 TCCCAGCACTTGGGAGGCTGAGG + Intronic
972628112 4:40820411-40820433 TCCCAGCACTTGGGAGGCTGAGG + Intronic
972980466 4:44694092-44694114 TCCCAGCAGCTGGGAGGCTTCGG - Intronic
973168759 4:47112353-47112375 TCCCAGCACTTGGGAGGCTGAGG - Intronic
973202246 4:47517298-47517320 TCCCAGATATTGGGAGGCTGAGG + Intronic
973620071 4:52717365-52717387 TCCCAGCTCTCGGGAGGCTGAGG - Intergenic
973855676 4:55008163-55008185 TCCCAGCTTTTGGGAGGCCAAGG - Intergenic
974406423 4:61476824-61476846 TCCCAGCATTTGGGAGGCTGAGG - Intronic
974492472 4:62585023-62585045 TCCCAGCAGTTTGGAGGCTGAGG - Intergenic
974654145 4:64797990-64798012 TCCCAGCTATTGGGTGGCTGAGG - Intergenic
974831020 4:67189679-67189701 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
975049480 4:69842370-69842392 TCTCAGCTGTTGGGGCTCCCAGG + Intronic
975698802 4:77042067-77042089 TCCCAGCATTTGGGAGGCTGAGG + Intergenic
975713252 4:77181270-77181292 TCCCAGCACTTGGGAGGCTGAGG - Intronic
975804543 4:78098389-78098411 TCCCAGCTACTGGGAGGCTGAGG - Intronic
975866701 4:78731283-78731305 TCCCAGCATTTGGGAGGCTAAGG + Intergenic
975871738 4:78786547-78786569 TCCCAACTGTCGGGAGGCTAAGG - Intronic
976128194 4:81855714-81855736 TCCCAGCACTTGGGAGGCTGAGG - Intronic
976248392 4:83026279-83026301 TCCCAGCTGCTGGGAGGCTGAGG - Intergenic
976250594 4:83047436-83047458 TCCCAGCTATTGGGACGCTGAGG + Intronic
976294239 4:83454085-83454107 TCCCAGCTACTCGGAGGCTCAGG + Intronic
976420742 4:84840691-84840713 TCCCAGCTGTTCAGAGGCTGAGG - Intronic
977197215 4:94078367-94078389 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
977216026 4:94284512-94284534 TCCTAGCAGTTGGGAGGCTAAGG - Intronic
977253147 4:94710993-94711015 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
977342300 4:95774066-95774088 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
977591931 4:98836693-98836715 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
977603153 4:98955691-98955713 TCCCAGATTTTGGGAGGCTGAGG - Intergenic
977656377 4:99525676-99525698 TCCCAGCTACTGGGAGGCTGAGG + Intronic
977746283 4:100551340-100551362 TCCCAGCTACTGGGAGGCTGAGG + Intronic
977793202 4:101131118-101131140 TCCCAGCTCTTGGAAGGCTGAGG + Intronic
977956037 4:103026991-103027013 TCCCAGCACTTGGGAGGCTAAGG - Intronic
978261727 4:106768224-106768246 TCCCAGCTGTTGTGACCATGAGG + Intergenic
978324988 4:107543179-107543201 TTCCAGCCTTTGGGACACTCTGG - Intergenic
978420979 4:108532578-108532600 TCCCAGCTGTCAGGAGGCTGGGG + Intergenic
978572534 4:110154369-110154391 TCCCAGCTGCTCGGAGGCTGAGG - Intronic
978691584 4:111519004-111519026 TCCCAGCTGCTGGGAGGCTGAGG + Intergenic
978762732 4:112372327-112372349 TCACAGCTATTGGGAGGCTGAGG - Intronic
978831394 4:113089573-113089595 TCCCAGCATTTGGGAGGCTGAGG + Intronic
979344337 4:119569147-119569169 TCCCAGCTGCTTGGAAGCTGAGG - Intronic
979674144 4:123392804-123392826 TCCCAGCAGTTGGGAGGCCGAGG - Intergenic
980046197 4:127991472-127991494 TCCCAGCACTTGGGAGGCTGAGG - Intronic
980079220 4:128326310-128326332 TCCCAGCTCTTGGGAGGCTGAGG + Intergenic
980116488 4:128684574-128684596 TCCCAACTGCTGGGAGGCTGAGG - Intergenic
980636771 4:135515870-135515892 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
980835600 4:138188177-138188199 TCCCAGCTACTGGGAGGCTGAGG - Intronic
980912193 4:139003996-139004018 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
980968300 4:139545254-139545276 TCCCAGCTGCTGGGGAGCTGAGG - Intronic
981093560 4:140756647-140756669 TCCCCGCTGGAAGGACGCTCCGG + Intergenic
981163753 4:141531867-141531889 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
981716459 4:147757308-147757330 TCCCAGCTTTCGGGAGGCTGAGG - Intronic
981849594 4:149213966-149213988 TCCCAGTTATTGGGAGGCTGAGG - Intergenic
981992093 4:150933906-150933928 TCCCAGCTGCTTGGAGGCTGAGG + Intronic
981996700 4:150983204-150983226 TCCCAGCATTTGGGAGGCTGAGG + Intronic
982238889 4:153278681-153278703 TCCCAGCTGTTCAGAGGCTGAGG + Intronic
982286133 4:153737107-153737129 TCCCAGCACTTGGGAGGCTGAGG - Intronic
982359548 4:154504912-154504934 ACCCAGCTATTGGGAGGCTGAGG - Intergenic
982514229 4:156324182-156324204 TCCCAGCTGCTCGGAGGCTGAGG - Intergenic
983018280 4:162641679-162641701 TCCCAGTTGTTGGGAAGCTGAGG + Intergenic
983225821 4:165085155-165085177 TCCCAGCTACTGGGAGGCTGAGG + Intronic
983230035 4:165120087-165120109 TCCCAGCACTTGGGAGGCTGAGG + Intronic
983235964 4:165179419-165179441 TCCCAGCTACTGGGAGGCTGAGG + Intronic
983378210 4:166957136-166957158 TCCCAGCTACTGGGAGGCTGAGG + Intronic
983901592 4:173141670-173141692 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
984072753 4:175135922-175135944 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
984284266 4:177709203-177709225 TCCCAGCTATTGGGAGGCTGAGG + Intergenic
984500001 4:180546916-180546938 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
984632582 4:182076318-182076340 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
984689204 4:182706709-182706731 TCCTAGCAGTTGGGAGGCTGAGG + Intronic
984883608 4:184430809-184430831 TCCCAGCTACTGGGAGGCTGAGG - Intronic
984982899 4:185300417-185300439 TCCCAGCATTTGGGAGGCTGAGG - Intronic
985015525 4:185629809-185629831 TCCCAGCAGTTGGGAGGCTGAGG - Intronic
985274200 4:188222026-188222048 TCCCAGCTATTCGGAGGCTGAGG - Intergenic
985483531 5:135070-135092 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
985501959 5:253808-253830 TCCCAGCATTTGGGAGGCTGAGG + Intronic
985642082 5:1068316-1068338 TCCCAGCTACTGGGAGGCTGAGG + Intronic
985735056 5:1574856-1574878 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
985934819 5:3089225-3089247 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
986761647 5:10885434-10885456 TCCCAGCACTTGGGAGGCTAAGG + Intergenic
986813301 5:11382480-11382502 TCCCAGCTATCGGGAGGCTGAGG + Intronic
987085933 5:14467695-14467717 TCCCAGCTATCGGGAGGCTGAGG + Intronic
987234529 5:15929366-15929388 TCCCAGCACTTGGGAGGCTGAGG + Intronic
987622435 5:20352675-20352697 TCCCAGCTATCGGGAGGCTGAGG + Intronic
988315891 5:29627780-29627802 TCCCAGCTCTCGGGAGGCTGAGG - Intergenic
988580660 5:32466001-32466023 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
988808726 5:34764460-34764482 TAGCACCTGTTGGAACGCTCTGG - Intronic
989008880 5:36847234-36847256 TCCCAGCTACTGGGAGGCTAAGG - Intergenic
989018315 5:36967978-36968000 TCCCAGCTATTTGGAGGCTGAGG + Intronic
989054167 5:37350685-37350707 TCCCAGCTATTGGGAGGCTGAGG + Intronic
989063161 5:37430809-37430831 TCCCAGCAGTTGGGAGGCCGAGG - Intronic
989082409 5:37637223-37637245 TCCCAGCTACTGGGAGGCTGAGG + Intronic
989315047 5:40068776-40068798 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
989339877 5:40362354-40362376 TCCCAGATTTTGGGAAGCTGAGG + Intergenic
989572668 5:42959474-42959496 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
990389102 5:55300420-55300442 TCCCAGCACTTGGGACGCGGAGG + Intronic
990665686 5:58069224-58069246 CCCCAGCGGTGGGGAGGCTCAGG + Intergenic
990934249 5:61130295-61130317 TCCCAACTTTTGGGGTGCTCTGG + Intronic
991071926 5:62492786-62492808 TCCCAGCATTTGGGAGGCTGAGG - Intronic
991253549 5:64589809-64589831 TCCCAGCTATTGGGAGGCTAAGG + Intronic
991334019 5:65526706-65526728 TCCCAGCTGTGTGGAGGCTGAGG + Intronic
991581515 5:68160472-68160494 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
991676243 5:69092334-69092356 TCCCAGCAGTTGGGAGGCTGAGG - Intergenic
991702977 5:69333108-69333130 TCCCAGCTTTTGGGAGGCCAAGG + Intergenic
991989961 5:72327721-72327743 TCCCAGCCTTTGGGAGGCTGAGG - Intronic
992116034 5:73539362-73539384 TCCCAGCTACTGGGATGCTGGGG - Intergenic
992175025 5:74141468-74141490 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
992200727 5:74381166-74381188 TCCCAGCTCTCGGGAGGCTGAGG + Intergenic
992562621 5:77967367-77967389 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
992571997 5:78068205-78068227 TCCCAGCTATCGGGACGCTAAGG + Intronic
992777520 5:80101596-80101618 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
993117964 5:83740330-83740352 TCCCAGCTACTGGGAAGCTGAGG - Intergenic
993396461 5:87395751-87395773 TCCCAGCTGCTGAGAGGCTCAGG + Intronic
993913890 5:93718081-93718103 TCCCAGCACTTGGGAAGCTGAGG - Intronic
993999386 5:94760799-94760821 TCCCAGCTTTTGGGAGGCTGAGG - Intronic
994212186 5:97099584-97099606 TCCCAGCACTTGGGAGGCTGCGG + Intronic
994219816 5:97182804-97182826 TCACAGCTGGTCGGAAGCTCAGG + Intronic
994343859 5:98662776-98662798 TCCCAGCGCTTGGGAGGCTGAGG + Intergenic
994348490 5:98716799-98716821 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
994803052 5:104404622-104404644 TCCCAGCTCTTGGGAGGCTGAGG - Intergenic
995084578 5:108092564-108092586 TCCCAGCAGTTGGGAGACTGAGG - Intronic
995197211 5:109384931-109384953 TCCCAGCTACTGGGAGGCTGAGG - Intronic
995532201 5:113102863-113102885 TCCCAGCACTTGGGAGGCCCAGG + Intronic
995552790 5:113297249-113297271 TCCCAGCATTTGGGAGGCTGAGG + Intronic
995725850 5:115179817-115179839 CCGCAGCTGCTGGGACGCCCGGG + Intronic
996064876 5:119069676-119069698 TCCCAGCTACTGGGAAGCTGAGG - Intronic
996215407 5:120859688-120859710 TACCAGCTGTTGGTAATCTCAGG - Intergenic
996578321 5:125000861-125000883 TCCCAGCTATGGGGAGGCTAAGG + Intergenic
996721016 5:126630168-126630190 TCCCAGCTATTGGGAGGCTGGGG + Intergenic
996767303 5:127047451-127047473 TGCCAGCTGTTGGGACCCATGGG + Exonic
997402926 5:133616516-133616538 TCCCAGCTATTGGGAGGCTAAGG - Intergenic
997862974 5:137435901-137435923 TCCCAGCACTTGGGATGCTGAGG + Intronic
997879161 5:137574215-137574237 TCCCAGCTGATGGGTCTGTCAGG + Intronic
998267996 5:140680722-140680744 TCCCAGCTATTCGGAGGCTTAGG + Intronic
998413288 5:141927442-141927464 TCCCAGCACTTGGGAGGCTGAGG - Intronic
998470944 5:142383185-142383207 TCCCAGCTGCTTGGAGGCTGAGG + Intergenic
998512730 5:142727229-142727251 TCCCAGCCTTTGGGAGGCTGAGG + Intergenic
998533797 5:142910486-142910508 TCCCAGCACTTGGGAGGCTGAGG + Intronic
998833277 5:146181535-146181557 TACCAGCTGTGGGGAGGCTGAGG + Intronic
999143098 5:149375761-149375783 TCCCAGCTACTGGGAGGCTGAGG + Intronic
999792358 5:154953237-154953259 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1000033496 5:157423485-157423507 TCCCAGCACTTGGGAAGCTAAGG - Intronic
1000064335 5:157682196-157682218 TCCCAGCTATTGGGAGGCTGAGG - Intergenic
1000134995 5:158339299-158339321 TCCCAGCTGCTCGGAGGCTGAGG - Intergenic
1000308071 5:160014411-160014433 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1000547421 5:162620424-162620446 TTCCAGCTATTGGGAGGCTGAGG - Intergenic
1000637121 5:163657208-163657230 TCCCAGCTCTTGGGAGGCCAGGG - Intergenic
1000880243 5:166689177-166689199 TCCCAGCTATTCGGAGGCTGAGG - Intergenic
1001030015 5:168255554-168255576 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1001083659 5:168685064-168685086 TCCCAGCTATTGGGAGGCGGAGG - Intronic
1001502247 5:172246558-172246580 TCCCAGCTTTTGGGAGGCTGAGG - Intronic
1001859954 5:175045490-175045512 TCCCAGCACTTGGGAGGCTAAGG - Intergenic
1001965189 5:175905047-175905069 TCCCAGCATTTGGGAGGCTGAGG + Intergenic
1002156432 5:177284536-177284558 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1002251763 5:177934142-177934164 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
1002694623 5:181076631-181076653 TCCCAGCAGTTGGGAGGCCAAGG - Intergenic
1002823432 6:750727-750749 TCCCAGCTATCGGGAGGCTGAGG - Intergenic
1002896844 6:1384389-1384411 TCCCGGCTGTGGCAACGCTCGGG - Intergenic
1003125290 6:3351218-3351240 CCCCAGCTTTTGTGAGGCTCAGG + Intronic
1003329683 6:5119671-5119693 TCCCAGCTACTGGGAAGCTGAGG + Intronic
1003566678 6:7228620-7228642 TCCTAGCTATTGGGAGGCTAAGG - Intronic
1003569197 6:7245277-7245299 TCCCAGCTCTTGGGAGGCTGAGG + Intronic
1003584106 6:7370545-7370567 TCCCAGCACTTGGGAGGCTAAGG - Intronic
1003671369 6:8163457-8163479 TCCCAGCCTTTGGGAGGCTGAGG - Intergenic
1003835362 6:10066011-10066033 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1004064038 6:12225675-12225697 TCCCAGCTGTCAGGAGGCTGAGG - Intergenic
1004224790 6:13775559-13775581 TTCCAGCTCTTGGGAGGCTGGGG + Intergenic
1004642897 6:17532629-17532651 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1004696708 6:18040819-18040841 TCCCAGCTATTGAGAAGCTGAGG + Intergenic
1004893453 6:20123939-20123961 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1004933937 6:20489345-20489367 TCCCAGCTATAGGGAGGCTGGGG + Intronic
1004978773 6:20998493-20998515 TCCCAGCTACTTGGACGCTTAGG + Intronic
1005054225 6:21714838-21714860 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1005297437 6:24440202-24440224 TCCCAGCATTTGGGAGGCTGAGG + Intronic
1005307218 6:24525445-24525467 TCCCAGCATTTGGGAAGCTGAGG + Intronic
1005334345 6:24778382-24778404 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1005366509 6:25083627-25083649 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1005395094 6:25373831-25373853 TCCCAGCATTTGGGAGGCTGAGG - Intronic
1005634463 6:27739944-27739966 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1005700923 6:28399580-28399602 TTCCAGCTGCTGGGCCCCTCAGG - Intronic
1005911139 6:30310559-30310581 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1005978874 6:30820733-30820755 TCCTAGCTATTGGGAGGCTAAGG + Intergenic
1006023979 6:31135466-31135488 TCCCAGCATTTGGGAGGCTGAGG - Intronic
1006111665 6:31750315-31750337 TCCCAGCATTTGGGAGGCTGAGG + Intronic
1006311132 6:33261214-33261236 TCCCAGCACTTGGGAGGCCCAGG + Intronic
1006350883 6:33520311-33520333 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1006399106 6:33805748-33805770 TCCCAGCTTTTGGGAGGCTGAGG + Intergenic
1006561150 6:34913747-34913769 TCCCAGTTCTTGGGAGGCTGAGG - Intronic
1006758078 6:36435186-36435208 TCCCAGCATTTGGGAGGCTGAGG + Intronic
1006763381 6:36483461-36483483 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1006786740 6:36673005-36673027 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1006818310 6:36869099-36869121 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1006967822 6:38007427-38007449 TCCTAGCTCTTGGGAGGCTGAGG + Intronic
1006999475 6:38295930-38295952 TCCCAGCTATTGGGAGGCTGAGG + Intronic
1007035470 6:38668875-38668897 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1007080406 6:39097990-39098012 TCCCAGCTATTGGGAGGCTGAGG - Intergenic
1007460209 6:42012483-42012505 TCCCAGCTCTCGGGAGGCTGAGG + Intronic
1007488488 6:42199221-42199243 TCCCAGCAGTTGGGAGGCCAAGG - Intergenic
1007547259 6:42703982-42704004 TCCCAGCTATCGGGAGGCTGAGG + Intronic
1007584582 6:42981259-42981281 TCCCAGCTATGGGGAGGCTGAGG + Intergenic
1007612105 6:43156647-43156669 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1007875274 6:45092497-45092519 TCCCAGCATTTGGGAGGCTGAGG + Intronic
1007898263 6:45384952-45384974 TCCCAGCAGTTTGGATGCTGAGG - Intronic
1008161253 6:48079000-48079022 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1008568971 6:52796657-52796679 TCCCAGCTATTGGGAGGCTGAGG - Intronic
1008614940 6:53217664-53217686 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1008837748 6:55857852-55857874 TCCCAGCTCTTGGGAGGCTGAGG - Intronic
1009473840 6:64062573-64062595 TCCCAGCTGCTTGGAGGCTGAGG + Intronic
1009741468 6:67752543-67752565 TCCCAGCTCTTGGGAGGCTGAGG - Intergenic
1009947541 6:70356941-70356963 TCCCAGCTATTGGGAGGCTGAGG + Intergenic
1009965549 6:70574202-70574224 TCCCAGCTATTGGGAGGCTGAGG + Intronic
1010032684 6:71287786-71287808 TCCCAGCTATTGGGAGGCTGAGG + Intergenic
1010234418 6:73563379-73563401 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1010636153 6:78261104-78261126 TCCCAGCATTTGGGACGCCAAGG - Intergenic
1010692818 6:78930813-78930835 TCCCAGTTCTTGGGAGGCTGAGG + Intronic
1010839110 6:80626324-80626346 TTCCAGCTGCTGGGAGGCTGAGG + Intergenic
1011037697 6:82995948-82995970 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1011096878 6:83675993-83676015 TCCTAGCTGCTGGGAGGCTGAGG + Intronic
1011246830 6:85328463-85328485 TCCCAGCTATTTGGAGGCTGAGG + Intergenic
1011482694 6:87811023-87811045 TCTCAGCTATTGGGAGGCTAAGG - Intergenic
1011632399 6:89339756-89339778 TCCCAGCACTTGGGAGGCTAAGG + Intronic
1011932863 6:92736243-92736265 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1012042834 6:94232378-94232400 TCCCAGCTTTTGGGAGGCTGAGG + Intergenic
1012161647 6:95891937-95891959 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1012234073 6:96792244-96792266 TCCCTGCAGTTGGGAGGCTGAGG - Intergenic
1012472814 6:99590108-99590130 TCGCAGCTGTTGGGAGGCTGAGG + Intergenic
1012955484 6:105565288-105565310 TCCCACCTTTTGGGAGGCTGAGG - Intergenic
1013030977 6:106332620-106332642 TCCCAGCATTTGGGAGGCTGAGG + Intergenic
1013108210 6:107044004-107044026 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1013131653 6:107239024-107239046 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1013175668 6:107674699-107674721 TCCTAGCTGTCGGGAGGCTAAGG + Intergenic
1013216385 6:108031402-108031424 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
1013528435 6:110997050-110997072 TCCCAGCACTTGGGACGCCGAGG - Intronic
1013555685 6:111254947-111254969 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1013743128 6:113312804-113312826 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1013774655 6:113666231-113666253 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1013780104 6:113719546-113719568 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1013805989 6:113996442-113996464 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1013820963 6:114153203-114153225 TCCCAGCTGTTGGTACTGTGAGG - Intronic
1014003425 6:116390317-116390339 TCCCAGCAGTTGGGAGGCTGAGG - Intronic
1014054890 6:117002400-117002422 TCCCAGCTATTGGGAGACTGAGG - Intergenic
1014235409 6:118948477-118948499 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1014437003 6:121431850-121431872 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1014540063 6:122664644-122664666 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1014804483 6:125813565-125813587 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1014907703 6:127049782-127049804 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1014977208 6:127902207-127902229 TCCCAGCTGTGAGGAGGCTGAGG + Intronic
1015104417 6:129519529-129519551 TCCCAGCACTTTGGTCGCTCAGG + Intergenic
1015217076 6:130762680-130762702 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1015332265 6:131994382-131994404 TCCCAGCTATTGGGAGGCTGAGG - Intergenic
1015690281 6:135914606-135914628 TCCCAGCTCTCGGGAGGCTGAGG - Intronic
1015760838 6:136658563-136658585 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1015780407 6:136859906-136859928 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1016359785 6:143254919-143254941 TCCCAGCTGTCGGGAGGCTGAGG + Intronic
1016405559 6:143725708-143725730 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1016408496 6:143756928-143756950 TCCCAGCTACTGGGAAGCTGAGG + Intronic
1016704546 6:147091430-147091452 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1016715614 6:147224307-147224329 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1016810899 6:148260488-148260510 TCCCAGCTCTTGGGAGGCCGAGG + Intergenic
1016868752 6:148796373-148796395 TCCCAGCATTTGGGAGGCTGAGG + Intronic
1016885719 6:148957683-148957705 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1017147777 6:151250245-151250267 TCCCAGCATTTGGGAGGCTGAGG + Intronic
1017178051 6:151523433-151523455 TCCCAGCATTTGGGAGGCTGAGG + Intronic
1017181430 6:151556337-151556359 TCCCAGCTATTGGGAGGCTGAGG + Intronic
1017256410 6:152338503-152338525 TCCCAGCTATTGGGAGGCGGAGG + Intronic
1017436700 6:154422240-154422262 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1017579115 6:155841289-155841311 TCCCAGCACTTGGGAGGCTGTGG + Intergenic
1017668542 6:156746529-156746551 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1017690905 6:156962896-156962918 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1017696142 6:157018330-157018352 TCCCAGCTGTTGGGAGGCTGAGG - Intronic
1017761477 6:157573206-157573228 TGCCAGCTGTTGAGGAGCTCTGG + Intronic
1018015629 6:159710331-159710353 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1018018414 6:159733661-159733683 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1018025067 6:159799334-159799356 TCCCAGCTGTTCAGAGGCTGAGG + Intergenic
1018251393 6:161875308-161875330 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1018476348 6:164145895-164145917 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1018673672 6:166200601-166200623 TCCCAGCTATCGGGAGGCTGAGG + Intergenic
1018884601 6:167923737-167923759 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1019297642 7:286790-286812 TCCCAACTTTTGGGAGGCTGAGG - Intergenic
1019400427 7:849203-849225 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1019557068 7:1637793-1637815 TCCCAGCTCTTGGGTGGCTGAGG + Intergenic
1019688731 7:2397687-2397709 TCCCAGCTATGGGGAGGCTGAGG - Intergenic
1019788753 7:2996818-2996840 TCCCAGCGCTTGGGAGGCTGAGG - Intronic
1019967191 7:4509376-4509398 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1020060134 7:5145225-5145247 TCCCAGCAATTGGGAGGCCCAGG - Intergenic
1020064674 7:5178179-5178201 TCCCAGCTCTCGGGAGGCTGAGG + Intergenic
1020102899 7:5404999-5405021 TCCCAGCTATTGGGAGGCTGAGG + Intronic
1020204076 7:6102229-6102251 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1020937480 7:14485773-14485795 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1021109125 7:16674013-16674035 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1021348419 7:19557141-19557163 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1021741983 7:23696305-23696327 TCCCAGCATTTGGGAGGCTGAGG + Intronic
1022117011 7:27270177-27270199 TCCCAGCTATCGGGAGGCTGAGG - Intergenic
1022169713 7:27813585-27813607 TCCCAGCACTTGTGAGGCTCTGG - Intronic
1022479077 7:30731289-30731311 TGCCAGCTGTTGGGAAGTTGAGG + Intronic
1022699944 7:32750322-32750344 TCCCAGCTATTTGGAGGCTGAGG + Intergenic
1022800004 7:33767701-33767723 TCCCAGCTATTGGGAGGCTGAGG - Intergenic
1022810610 7:33864320-33864342 TCCCAGCACTTGGGAAGCTGAGG + Intergenic
1022894238 7:34733301-34733323 TCCCAGCTACTGGGAGGCTAAGG + Intronic
1023009562 7:35913704-35913726 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1023050085 7:36243590-36243612 TCCCCACTGTTGGGACTGTCTGG - Intronic
1023050157 7:36244243-36244265 TCCCCACTGTTGGGACTGTCTGG - Intronic
1023444580 7:40218095-40218117 TCCCAGTTTTTGGGAGGCTGAGG + Intronic
1023508446 7:40924354-40924376 TCCCAGCTATTTGGAAGCTGAGG - Intergenic
1023617695 7:42037023-42037045 TCCCAGCTATCGGGAGGCTGAGG + Intronic
1023679511 7:42670889-42670911 TCCCAGCTACTGGGAAGCTGAGG - Intergenic
1023809234 7:43898883-43898905 TCCCAGCTCTTGGGAGGCCAAGG + Intronic
1023810580 7:43908192-43908214 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1023825173 7:44004149-44004171 TCCCAGCTGCTTGGAGGCTGAGG - Intronic
1023958174 7:44904587-44904609 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1024077182 7:45827484-45827506 TCCCAGCGCTTGGGAGGCTGAGG + Intergenic
1024185366 7:46943192-46943214 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1024297768 7:47859592-47859614 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1024600034 7:50972356-50972378 TCCCAGCTATTGGGAGGCTGAGG - Intergenic
1024732077 7:52264035-52264057 TCCCAGCATTTGGGAGGCTGAGG + Intergenic
1024758286 7:52562806-52562828 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1024927057 7:54628153-54628175 TCCCAGCTATCGGGAGGCTGAGG - Intergenic
1025059097 7:55788865-55788887 TCCCAGCTCTTGGAAGGCTGAGG - Intergenic
1025187855 7:56875007-56875029 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1025206280 7:56995194-56995216 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1025224205 7:57142591-57142613 TCTCAGCTGTGGGGATGCACGGG + Intergenic
1025665656 7:63581733-63581755 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1025684066 7:63701922-63701944 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1025744809 7:64233373-64233395 TCCTAGCTATTGGGAGGCTGAGG + Intronic
1025827665 7:65023800-65023822 TCCCAGCTCTTGGAAGGCTGAGG + Intergenic
1025833919 7:65078250-65078272 TCCCAGCTCTTAGGAGGCTGAGG + Intergenic
1025915198 7:65860256-65860278 TCCCAGCTCTTGGAAGGCTGAGG + Intergenic
1025966595 7:66278665-66278687 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1026001283 7:66560585-66560607 TCCCAGCTATTGGGAGGCTGAGG + Intergenic
1026006826 7:66606641-66606663 TCCCAGCTCTTGGAAGGCTGAGG - Intergenic
1026026860 7:66752376-66752398 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1026055262 7:66978110-66978132 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1026062755 7:67040726-67040748 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1026088722 7:67282920-67282942 TCCCAGCTGCTTGGAGGCTGAGG - Intergenic
1026114044 7:67481317-67481339 TCCCAGCTATTTGGAGGCTGAGG - Intergenic
1026169004 7:67936532-67936554 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1026243434 7:68597295-68597317 TCCCAGCACTTGGGAAGCTGAGG - Intergenic
1026364915 7:69638265-69638287 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1026498628 7:70924239-70924261 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1026652703 7:72229366-72229388 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1026715595 7:72786689-72786711 TCCCAGCTGCTAGGAGGCTAAGG - Intronic
1026716623 7:72794932-72794954 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1026725526 7:72867422-72867444 TCCCAGCTGCTTGGAGGCTGAGG + Intergenic
1026747617 7:73025278-73025300 TCCCAGCTGCTTGGAGGCTGAGG + Intergenic
1026751267 7:73053417-73053439 TCCCAGCTGCTTGGAGGCTGAGG + Intergenic
1026754916 7:73081531-73081553 TCCCAGCTGCTTGGAGGCTGAGG + Intergenic
1026758568 7:73109565-73109587 TCCCAGCTGCTTGGAGGCTGAGG + Intergenic
1026817564 7:73523998-73524020 TCCCAGCTACTGGGAAGCTGAGG + Intergenic
1026824978 7:73575923-73575945 TCCCAGCTATTCGGAGGCTGAGG + Intronic
1026970265 7:74463483-74463505 TCCCAGCACTTGGGAAGCTGAGG - Intronic
1027033824 7:74910571-74910593 TCCCAGCTGCTTGGAGGCTGAGG + Intergenic
1027088837 7:75283920-75283942 TCCCAGCTGCTTGGAGGCTGAGG - Intergenic
1027092480 7:75311848-75311870 TCCCAGCTGCTTGGAGGCTGAGG - Intergenic
1027096123 7:75339815-75339837 TCCCAGCTGCTTGGAGGCTGAGG - Intergenic
1027118316 7:75498238-75498260 TCCCAGCTGCTTGGAGGCTGAGG - Intergenic
1027169915 7:75864290-75864312 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1027243360 7:76348370-76348392 TCCCAGCTGCTTGGAGGCTGAGG - Intronic
1027268476 7:76506803-76506825 TCCCAGCGGTCGGGAGGCTGAGG + Intergenic
1027273483 7:76537228-76537250 TCCCAGCTGCTTGGAGGCTGAGG + Intergenic
1027323218 7:77027877-77027899 TCCCAGCTGCTTGGAGGCTGAGG + Intergenic
1027326931 7:77056292-77056314 TCCCAGCTGCTTGGAGGCTGAGG + Intergenic
1027534948 7:79387168-79387190 TCTCAGCTGTTTGGAGCCTCTGG + Intronic
1027800022 7:82738832-82738854 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1028406254 7:90477845-90477867 TCCCAGCATTTGGGAGGCTGAGG + Intronic
1028428825 7:90722454-90722476 TCCCAGCATTTGGGAAGCTGTGG - Intronic
1028450476 7:90976612-90976634 TCCCAGCAGTTTGGAAGCTGAGG - Intronic
1028587188 7:92463850-92463872 TCCCAGCTGCTGGGAGGATGAGG + Intergenic
1028763444 7:94521966-94521988 TCCCAGCTATCGGGAGGCTGAGG + Intronic
1028911639 7:96214474-96214496 TCCCAGCATTTGGGAGGCCCAGG + Intronic
1028997921 7:97122105-97122127 TCCCAGCATTTGGGAGGCCCAGG - Intronic
1029009049 7:97239708-97239730 TCCCAGCATTTGGGAGGCTGAGG + Intergenic
1029093867 7:98069772-98069794 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1029132618 7:98344059-98344081 TCCCAGCTATAGGGAGGCTGAGG + Intronic
1029266689 7:99347586-99347608 TCCCAGCTATCGGGAGGCTGAGG + Intronic
1029364641 7:100108782-100108804 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1029397124 7:100316085-100316107 TCCCAGCTGCTTGGAGGCTGAGG - Intronic
1029468202 7:100739260-100739282 TCCCAGCATTTGGGAGGCTGAGG - Intronic
1029530244 7:101120727-101120749 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1029544454 7:101202900-101202922 TCCCAGCACTTGGGAGGCGCAGG - Intergenic
1029548362 7:101223119-101223141 TCCCAGCATTTGGGAGGCTGAGG + Intronic
1029719175 7:102351783-102351805 TCCCAGCTGCTTGGAGGCTGAGG + Intergenic
1029753438 7:102557476-102557498 TCCCAGCTGCTTGGAGGCTGAGG - Intronic
1029771387 7:102656560-102656582 TCCCAGCTGCTTGGAGGCTGAGG - Intronic
1029831857 7:103268769-103268791 TCCCAGCTATTCGGAGGCTGAGG + Intergenic
1030047263 7:105508754-105508776 TCCCAGCTCTTGGGAGGCTGAGG + Intronic
1030119597 7:106095463-106095485 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1030219825 7:107086575-107086597 TCCCAGCTTGTGGGAGGCTGAGG - Intronic
1030261451 7:107569085-107569107 TCCCAGCTGCTGGGAGGCTGAGG + Intronic
1030824886 7:114142895-114142917 TCCCACATGTTGGGAGGCTGAGG + Intronic
1031454453 7:121962196-121962218 TCCCAGCATTTGGGAGGCTGAGG + Intronic
1031695717 7:124850613-124850635 TCCCAGCTATTGGGAGGCTGAGG + Intronic
1032158263 7:129488624-129488646 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1032174787 7:129613780-129613802 TCCCAGCTGCTGGGAGGGGCGGG + Intronic
1032246188 7:130215186-130215208 TCCCAGCTGCTGGGGGGCTGAGG + Intronic
1032627764 7:133611052-133611074 TCCCAGCCTTTGGGAGGCTGAGG - Intronic
1032963787 7:137071861-137071883 TCCCAGCTATGGGGAGGCTGAGG + Intergenic
1033107439 7:138540952-138540974 TCCCAGCTATTGGGAGGCTGAGG - Intronic
1033175510 7:139119929-139119951 TCCCAGCACTTGGGACACTGAGG - Intergenic
1033216050 7:139494475-139494497 TCCCAGCCCTTGGGAGGCTGAGG - Intergenic
1033335303 7:140447231-140447253 TCCCAGCTCTTGGGAGGCTGAGG - Intergenic
1033542988 7:142374179-142374201 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1033649165 7:143327768-143327790 TCCCAGCTGCTGGGAGGCTGAGG - Intronic
1033987382 7:147243111-147243133 TCCCAGCTCTTGGGAGGCTGAGG - Intronic
1034145957 7:148871823-148871845 TCCCAGCACTTGGGAGGCTGGGG - Intronic
1034172791 7:149075777-149075799 TCCCAGCTGTCAGGAGGCTGAGG - Intronic
1034380983 7:150692107-150692129 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1034495757 7:151421145-151421167 TCCCAGCATTTGGGAGGCTGAGG + Intergenic
1034611626 7:152375634-152375656 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1034619229 7:152444583-152444605 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1034634292 7:152555000-152555022 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1035152437 7:156885760-156885782 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1035380634 7:158438259-158438281 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1035785377 8:2255608-2255630 TTCCACCTGTTTGAACGCTCAGG - Intergenic
1035807431 8:2466108-2466130 TTCCACCTGTTTGAACGCTCAGG + Intergenic
1036163404 8:6408999-6409021 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1036514764 8:9433584-9433606 TCCTAGCTATTGGGAGGCTGAGG + Intergenic
1036925985 8:12906352-12906374 TCCCAGCTATGGGGAGGCTGAGG - Intergenic
1036974467 8:13395369-13395391 TCCCAGCTTTTGGGAGGCCAAGG - Intronic
1037048712 8:14342430-14342452 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1037824422 8:22152623-22152645 TCCCAGCACTTGGGAGGCTTAGG + Intronic
1037842317 8:22253925-22253947 TCCCAGCACTTGGGAGGCTGAGG - Exonic
1037865072 8:22436896-22436918 TCCCAGCTATCGGGAGGCTGAGG + Intergenic
1038154424 8:24974861-24974883 TCCCAGCTATCGGGAGGCTGAGG - Intergenic
1038194671 8:25356081-25356103 TCCGAGCTATTGGGAGGCTGAGG + Intronic
1038204334 8:25450740-25450762 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1038257986 8:25968676-25968698 TCCCAGCTGCTGGGAGGCTGAGG - Intronic
1038373534 8:27015300-27015322 TCCCAGCATTTGGGAGGCTGGGG + Intergenic
1038412784 8:27371143-27371165 TCCCAGCGTTTGGGAGGCTGAGG - Intronic
1038656838 8:29460504-29460526 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1038718643 8:30013525-30013547 TCCCAGCACTTGGGAAGCTGAGG - Intergenic
1038736069 8:30170755-30170777 TCCCAGCTATTGGGAGGCTGAGG - Intronic
1038757505 8:30355421-30355443 TCCCAGCACTTGGGAAGCTGAGG - Intergenic
1038819935 8:30943025-30943047 TCCCAGCTATTGGGAGGCTGAGG - Intergenic
1038822397 8:30964774-30964796 TCCCAGCTATTGGGAGGCTGAGG + Intergenic
1038987576 8:32829156-32829178 TCCCAGCTGTTGGGAGGCTGAGG + Intergenic
1039070411 8:33644449-33644471 TCCCAGCTGCTTGGAGGCTGAGG + Intergenic
1040004135 8:42604254-42604276 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1040492592 8:47938293-47938315 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1040662228 8:49587295-49587317 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1040967125 8:53093812-53093834 TCCCAGCTGCTCGGAGGCTGAGG + Intergenic
1041038728 8:53823591-53823613 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1041241948 8:55855596-55855618 TCCCAGCTAGTGGGAGGCTGAGG + Intergenic
1041417745 8:57630919-57630941 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1041573835 8:59370076-59370098 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1041614664 8:59892535-59892557 TCCCAGCTATTTGGAGGCTGAGG - Intergenic
1041910171 8:63080603-63080625 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1042132248 8:65599004-65599026 TCCCAGCTATCGGGAGGCTGAGG - Intergenic
1042271277 8:66958412-66958434 TCCCAGCTCTTGGGAGGCTGAGG + Intronic
1042390927 8:68232732-68232754 TCCCAGCTCCTGGGAGGCTGAGG - Exonic
1042485968 8:69346022-69346044 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1042496288 8:69458142-69458164 TCCCAGCTCTAGGGAGGCTGAGG - Intergenic
1042550077 8:69986401-69986423 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1042928094 8:73987444-73987466 TCCCAGCTACTTGGAGGCTCAGG + Intergenic
1043100691 8:76041445-76041467 TCCCAGCTACTGGGAAGCTGAGG - Intergenic
1043271396 8:78338641-78338663 TCCCAGCTCTTGGGAGGCTGAGG + Intergenic
1044116027 8:88335189-88335211 TCCCAGCTATTGGGAGGCTGAGG - Intergenic
1044252266 8:90017671-90017693 TCCCAGCTACTGGGAAGCTGAGG + Intronic
1044535170 8:93349589-93349611 TCCCAGCATTTGGGAAGCTTAGG - Intergenic
1044664881 8:94624659-94624681 CCCCAGCTGTGGGGAGGCTGAGG + Intergenic
1044977116 8:97675619-97675641 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1044980095 8:97708082-97708104 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1045149702 8:99390351-99390373 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1045206188 8:100043523-100043545 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1045568255 8:103343345-103343367 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
1045642472 8:104266887-104266909 TCCCACCTTTTGGGAGGCTGAGG + Intergenic
1045960642 8:107964356-107964378 TCTCAGCTACTGGGACGCTGAGG - Intronic
1046218106 8:111176112-111176134 TCCCAGCTATTTGGAGGCTGAGG + Intergenic
1046910287 8:119618783-119618805 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1047109392 8:121772131-121772153 TCCCAGCTGCTCGGAGGCTGAGG + Intergenic
1047245206 8:123136699-123136721 TCCCAGCTTTTGGGAGGCCGAGG - Intronic
1047313741 8:123713807-123713829 TCCCAGCTATGGGGAGGCTGAGG - Intronic
1047398968 8:124529973-124529995 TCCCAGCTCTTGGGATGCTGAGG + Intronic
1047459429 8:125047960-125047982 TCCCAGCTACTTGGAGGCTCAGG - Intronic
1047484569 8:125317311-125317333 TCCCAGCTATTCGGAGGCTGGGG - Intronic
1047498923 8:125427816-125427838 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1047527450 8:125645723-125645745 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1047714455 8:127582777-127582799 TCCCAGCTTTTGGGAGGCAGAGG + Intergenic
1048392452 8:133980681-133980703 TCCCAGCACTTGGGAGGCCCAGG + Intergenic
1049495902 8:142932811-142932833 TCCCAGCCCTTGGGAGGCTGAGG + Intergenic
1049679391 8:143910933-143910955 TCCCACCTGTTGAGACGTGCTGG + Intergenic
1050383457 9:5057696-5057718 TCCCAGCTATCGGGAGGCTGAGG - Intronic
1050478885 9:6069363-6069385 TCCTAGCTCTTGGGAGGCTGAGG - Intergenic
1050639717 9:7654459-7654481 TCCCAGCTATCGGGAGGCTGAGG - Intergenic
1050944307 9:11498681-11498703 TCCCAGCTGCTTGGAGGCTGAGG + Intergenic
1051275678 9:15395619-15395641 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1051400641 9:16678382-16678404 TCCCAGCTATTTGGAGGCTGAGG - Intronic
1051440185 9:17075116-17075138 TCCCAGCTCTTGGGAGGCTGAGG + Intergenic
1051493409 9:17692527-17692549 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1051654039 9:19361112-19361134 TCCCAGCAGTTGGGAGGCCGAGG - Intronic
1052518941 9:29518324-29518346 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
1052750956 9:32490121-32490143 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1052763004 9:32611769-32611791 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
1052812319 9:33072578-33072600 TCCCAGCATTTGGGAGGCTGAGG + Intronic
1052927764 9:34031646-34031668 TCCCAGCTACTGGGAGGCTCAGG - Intronic
1052934955 9:34085371-34085393 TCCCAGCTATTGGGAGGCTGAGG - Intergenic
1052946529 9:34173008-34173030 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
1053315196 9:37045168-37045190 TCCCAGCAGTTGGGAGGCTAAGG + Intergenic
1053330295 9:37199819-37199841 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1053375453 9:37602119-37602141 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1053401993 9:37833002-37833024 TCCCAGCTATTGAGAGGCTGAGG - Intronic
1053507767 9:38658913-38658935 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1054895206 9:70302552-70302574 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1055013471 9:71591851-71591873 TCCCAGCTATTGGGAGGCTGAGG - Intergenic
1055300361 9:74876332-74876354 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1055318250 9:75055713-75055735 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1055644055 9:78346290-78346312 TTCCAGCTGTTGTGACTCTTTGG + Intergenic
1055949108 9:81714243-81714265 TCCCAGCTGTTCAGAGGCTGAGG - Intergenic
1056025569 9:82491223-82491245 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1056052889 9:82788568-82788590 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1056210903 9:84364345-84364367 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
1056405367 9:86268909-86268931 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1056516762 9:87359504-87359526 TCCCAGCTGTTGTGACTATGGGG + Intergenic
1056541431 9:87574803-87574825 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1056692260 9:88817662-88817684 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1056993304 9:91430894-91430916 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1057098285 9:92332555-92332577 TCCCAGCTTTTGGGAGGCCAAGG + Intronic
1057103117 9:92383010-92383032 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1057136456 9:92692399-92692421 TCCCAGCTCCTGGGAGGCTAAGG - Intergenic
1057215666 9:93227086-93227108 TTCCAGCTGCTGGGAGGCTGGGG - Intronic
1057373508 9:94496539-94496561 TCCCAGCTGCTGGGAGGCTGAGG + Intergenic
1057524856 9:95789707-95789729 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1057588416 9:96349774-96349796 TCCCAGCGATTGGGAGGCCCAGG - Intronic
1057903138 9:98964970-98964992 GCTCATCTGTTGGGACGCCCCGG + Intronic
1058099582 9:100904312-100904334 TCCCAGCTGCTAGGAGGCTGAGG + Intergenic
1058115474 9:101079826-101079848 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1058316289 9:103570592-103570614 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1058398239 9:104581193-104581215 TCCCAGCTATGGGGATGCTGTGG - Intergenic
1058454310 9:105125072-105125094 TCCCACCTCTTGGGAGGCTGAGG + Intergenic
1058525613 9:105855126-105855148 TCCCAGCTGTTGCTTTGCTCTGG + Intergenic
1059061890 9:111041660-111041682 TCCCAGCTGTTGGGAGGCTGAGG + Intergenic
1059090103 9:111347316-111347338 TCCTAGCTATTCGGACGCTGAGG + Intergenic
1059096170 9:111417121-111417143 TCCCAGCTATCGGGAGGCTGAGG + Intronic
1059229306 9:112703691-112703713 TCCCAGCATTTGGGAGGCTGAGG - Intronic
1059967791 9:119632983-119633005 TCCCAGCTATTGGGAGACTGAGG + Intergenic
1060362522 9:122973351-122973373 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1060363396 9:122982982-122983004 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1060487794 9:124060367-124060389 TCCCAGCATTTGGGAAGCTGAGG + Intergenic
1060837265 9:126765833-126765855 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1060866296 9:127001169-127001191 TCCCAGCTATTAGGAGGCTGAGG + Intronic
1060902553 9:127273190-127273212 TCCTAGCTGTGGGACCGCTCTGG - Intronic
1061042422 9:128147951-128147973 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
1061254799 9:129448591-129448613 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
1061323541 9:129848044-129848066 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1061340197 9:129974071-129974093 TCCCAGCAATTGGGAGGCTGAGG - Intronic
1061380368 9:130252965-130252987 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1061447404 9:130648179-130648201 TTCCAGCTGCTGGGAGGCTGAGG - Intergenic
1061471269 9:130827776-130827798 TCCCAGCTATTGGGAGGCTGAGG + Intronic
1061831318 9:133297127-133297149 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
1061952945 9:133946300-133946322 TCCCAGTTGCTGGGCTGCTCTGG - Intronic
1062229906 9:135476232-135476254 TCCCAGCTGTCAGGAGGCTGAGG - Intergenic
1062633386 9:137477563-137477585 TCCCAGCTGCTTGGAGGCTGAGG - Intronic
1062679637 9:137771815-137771837 TCCCAGCTGTTCTGCTGCTCAGG - Intronic
1203747722 Un_GL000218v1:52707-52729 TCCCAGCTACTGGGAGGCTGGGG + Intergenic
1203562021 Un_KI270744v1:65279-65301 TCCCAGCTACTGGGAGGCTGGGG - Intergenic
1185450727 X:279963-279985 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1185476733 X:419987-420009 TCTCAGCTATTGGGAGGCTGAGG - Intergenic
1185572560 X:1146022-1146044 TCCCAGCTATTTGGAGGCTTAGG - Intergenic
1185885171 X:3776088-3776110 TTCCAGCTCTTGGGAGGCTGAGG - Intergenic
1186174547 X:6911308-6911330 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1186473836 X:9841941-9841963 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1186787210 X:12964797-12964819 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1187148646 X:16661073-16661095 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1187806672 X:23128526-23128548 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1188234399 X:27709169-27709191 TCCCAGCACTTGGGAGGCTGAGG - Intronic
1188884940 X:35537937-35537959 TCCCAGCATTTGGGAGGCTGAGG + Intergenic
1189087378 X:38040056-38040078 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1189294524 X:39909281-39909303 TCCCAGTTATTGGGAGGCTGAGG - Intergenic
1189360359 X:40345163-40345185 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1189394766 X:40611477-40611499 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1189454767 X:41176005-41176027 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1189747821 X:44188232-44188254 TCCCAGCTTTGGGGAGGCTGAGG - Intronic
1189761885 X:44330138-44330160 TCCCAGCTATTGGGGGGCTGAGG + Intronic
1189814472 X:44811073-44811095 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1190008707 X:46763381-46763403 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1190034087 X:47004544-47004566 TCCCAGCTCTTGGGAGGCTGAGG - Intronic
1190035917 X:47023788-47023810 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1190225072 X:48539153-48539175 TCCCAGCTCTTGGGAGGCTGAGG + Intergenic
1191152490 X:57234794-57234816 TCCCAGCATTTGGGAGGCTGAGG + Intergenic
1191596913 X:62955470-62955492 TCCCAGCTACTGGGAAGCTGAGG - Intergenic
1191846776 X:65552594-65552616 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
1192135516 X:68595616-68595638 TCCCAGCTATTGGGAGGCCGAGG - Intergenic
1192566913 X:72172591-72172613 TCCCAGCATTTGGGAGGCTGAGG + Intergenic
1192577347 X:72253507-72253529 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1192675687 X:73193541-73193563 TCCCAGCATTTGGGAGGCTGAGG + Intergenic
1193100173 X:77602119-77602141 TACCAGCTTTTGGGAGGCTGAGG - Intronic
1193309761 X:79992111-79992133 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1193502394 X:82295306-82295328 TCCCAGCTATTTGGAGGCTAAGG - Intergenic
1193539377 X:82753135-82753157 TCCCAGCTTTGGGGAGGCTGAGG - Intergenic
1193550125 X:82881715-82881737 TCCCAGCTACTGGGAGGCTGAGG + Intergenic
1194053269 X:89099835-89099857 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1194349042 X:92803041-92803063 TCCCAGCTCTCGGGAGGCTGAGG - Intergenic
1194350609 X:92821711-92821733 TCCCAGATGGTGGGACGGCCGGG - Intergenic
1194650258 X:96505876-96505898 TCCCAGCTCTTGGGAGGGTGAGG - Intergenic
1194731765 X:97463639-97463661 TCCCAGCATTTGGGAGGCTGAGG - Intronic
1195009208 X:100718912-100718934 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1195084257 X:101399446-101399468 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1195529375 X:105934923-105934945 TCCCAGCTCTTGGGAGGCCAAGG - Intronic
1195634023 X:107092489-107092511 TCCCAGCACTTGGGAGGCTGAGG + Intronic
1195773397 X:108376486-108376508 TCCCAGCTACTGGGAGGCTGAGG + Intronic
1196243792 X:113374407-113374429 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1196427459 X:115586100-115586122 TCCCAGCTATTCGGAGGCTGAGG - Intronic
1196464164 X:115956574-115956596 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1196747102 X:119081011-119081033 TCCCAGCTTTTGGGAGGCTGAGG + Exonic
1196784819 X:119412488-119412510 TCCCAGCTCTTGGGAAGCTGAGG - Intronic
1196799207 X:119527189-119527211 TCCCAGCAGTTGGGAAGCCGAGG - Intergenic
1197225264 X:123950711-123950733 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1197762895 X:130040102-130040124 TCCCAGCTGCTCCGCCGCTCAGG - Intronic
1197822352 X:130554001-130554023 TCCCAGCTTTCGGGAGGCTGTGG + Intergenic
1197928831 X:131675326-131675348 TCCCAGCTACTGGGAGGCTGAGG - Intergenic
1199617232 X:149666779-149666801 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1199625409 X:149736470-149736492 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1200051078 X:153432122-153432144 TCTCAGCTGGTGAGACCCTCAGG + Intergenic
1200099381 X:153682394-153682416 TCCCAGCTATGGGGAGGCTGAGG - Intronic
1200131806 X:153853285-153853307 TCCCAGCACTTGGGAGGCTGAGG - Intergenic
1200406756 Y:2819764-2819786 TCCCAGCACTTGGGAGGCTGAGG + Intergenic
1200657369 Y:5919645-5919667 TCCCAGCTCTCGGGAGGCTGAGG - Intergenic
1200658935 Y:5938391-5938413 TCCCAGATGGTGGGACGGCCGGG - Intergenic
1200764172 Y:7066481-7066503 TCCCAGCTACTGGGAGGCTGAGG - Intronic
1200780435 Y:7210718-7210740 TCCCAGCTATTGGGAGGCTGAGG + Intergenic
1200869251 Y:8079233-8079255 TCCCAGCATTTGGGAGGCTGAGG - Intergenic
1201161056 Y:11167692-11167714 TCCCAGCTACTGGGAGGCTGGGG + Intergenic
1202162466 Y:21949656-21949678 TCCCAGCAGTTGGGACAGACAGG + Intergenic
1202314264 Y:23559458-23559480 TCCCAGCAGTTGGGACAGACAGG + Intergenic
1202556538 Y:26111137-26111159 TCCCAGCAGTTGGGACAGACAGG - Intergenic