ID: 1161105910

View in Genome Browser
Species Human (GRCh38)
Location 19:2443955-2443977
Sequence GTCCCAGCTGTTGGGACGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 165}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161105910_1161105923 27 Left 1161105910 19:2443955-2443977 CCGAGCGTCCCAACAGCTGGGAC 0: 1
1: 0
2: 3
3: 29
4: 165
Right 1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG 0: 1
1: 0
2: 0
3: 4
4: 66
1161105910_1161105924 28 Left 1161105910 19:2443955-2443977 CCGAGCGTCCCAACAGCTGGGAC 0: 1
1: 0
2: 3
3: 29
4: 165
Right 1161105924 19:2444006-2444028 ACAGGGAAATGCCTACGATGGGG 0: 1
1: 0
2: 0
3: 5
4: 92
1161105910_1161105917 10 Left 1161105910 19:2443955-2443977 CCGAGCGTCCCAACAGCTGGGAC 0: 1
1: 0
2: 3
3: 29
4: 165
Right 1161105917 19:2443988-2444010 CACCAAGAACATCCAACCACAGG 0: 1
1: 0
2: 2
3: 11
4: 128
1161105910_1161105922 26 Left 1161105910 19:2443955-2443977 CCGAGCGTCCCAACAGCTGGGAC 0: 1
1: 0
2: 3
3: 29
4: 165
Right 1161105922 19:2444004-2444026 CCACAGGGAAATGCCTACGATGG 0: 1
1: 0
2: 2
3: 8
4: 86
1161105910_1161105918 11 Left 1161105910 19:2443955-2443977 CCGAGCGTCCCAACAGCTGGGAC 0: 1
1: 0
2: 3
3: 29
4: 165
Right 1161105918 19:2443989-2444011 ACCAAGAACATCCAACCACAGGG 0: 1
1: 0
2: 1
3: 18
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161105910 Original CRISPR GTCCCAGCTGTTGGGACGCT CGG (reversed) Intronic
901474910 1:9482888-9482910 GAGCCAGCTGCTGGGACACTCGG + Intergenic
902403053 1:16168267-16168289 GTCCCAGCTATTGGGAAACTGGG - Intergenic
903104636 1:21065442-21065464 GTCCTAGCTCTAGGGAGGCTGGG + Intronic
903161506 1:21492277-21492299 ATCCCTGCTGTTAGGACCCTAGG + Intergenic
903326424 1:22571416-22571438 GTTCCAGCTGATGGCAAGCTGGG + Intronic
904824824 1:33267249-33267271 GTCACAGCTGATGGGGCGATAGG - Intronic
906005897 1:42469917-42469939 GACCCAGCGGTTGAGAAGCTTGG + Intronic
906702485 1:47870010-47870032 AGTCCAGCTCTTGGGACGCTAGG - Intronic
907538210 1:55185074-55185096 GTCCCAGCTGCTGGGGAGCTGGG - Intronic
908294400 1:62698889-62698911 GTCCCAGCTACTTGGATGCTAGG - Intergenic
908518520 1:64917797-64917819 GGCCCAGCTGTTGGGAGCCTGGG - Intronic
911325148 1:96462555-96462577 GTCCCAGCTGTTGGGGAGGCTGG - Intergenic
916458237 1:164993080-164993102 GTCCCAGCTGTTGGGAGAAGAGG - Intergenic
916557567 1:165906482-165906504 GTCCCAGCTACCGGGAGGCTGGG - Intronic
916729424 1:167553211-167553233 GTCCCAGATGTTGGGCAGCTGGG - Intronic
920963582 1:210684335-210684357 TTCCCTGCTGTTGGAAAGCTGGG - Intronic
923792427 1:237123468-237123490 GTCCCAGCTACTAGGAGGCTGGG + Intronic
924515959 1:244766440-244766462 ATCCCAGCACTTGGGAGGCTGGG - Intergenic
1064770136 10:18714362-18714384 GTTTCAGCTCTTGGGAGGCTGGG + Intergenic
1065003938 10:21362464-21362486 GTCCCAGCTACTGGGAGGCTGGG - Intergenic
1066253181 10:33653929-33653951 ATCCCAGCATTTGGGAGGCTGGG + Intergenic
1070049253 10:72871015-72871037 GTCCCAGCTATCGGGAGGCTGGG - Intronic
1071167511 10:82823581-82823603 CTCCCAGCTACTGGGAGGCTTGG + Intronic
1071873953 10:89823679-89823701 GACTCAGCTGTGGGGAGGCTGGG + Intergenic
1073060276 10:100729773-100729795 GTCCGAGCTGCGGGGACGTTGGG + Intergenic
1073206000 10:101769754-101769776 GCCCCAGCTGGTGGGCGGCTGGG - Intergenic
1074234689 10:111573465-111573487 ATCCCAGCACTTGGGAGGCTGGG - Intergenic
1077378614 11:2217469-2217491 GTCCCAGCAGGTGGGACTCCAGG - Intergenic
1077505633 11:2928846-2928868 GTCCCGGCTGTTAGGGCGCAGGG + Intronic
1078768471 11:14323332-14323354 TTCCAAGCTGTTGGGACTATAGG - Intronic
1080247575 11:30196843-30196865 GTCGCAGCAGTCGGGACTCTTGG - Intergenic
1080516507 11:33026718-33026740 GTCCCAGCTACTGGGAGGCTAGG - Intronic
1080664377 11:34322794-34322816 GTCCCAGCTACTGGGAGGGTGGG - Intronic
1081698395 11:45135502-45135524 GTCCTTGCTGTTGGAAAGCTAGG - Intronic
1081775777 11:45675134-45675156 GTCCCAGGCATTGGGACTCTGGG - Intergenic
1083203855 11:61135670-61135692 GTCCCAGCTATTGGAAGGATGGG - Intronic
1083328232 11:61884600-61884622 GGCCCAGCTGCTGGGAGCCTGGG + Intronic
1084320372 11:68370192-68370214 GGCCCAGCTGTTAGAACCCTGGG - Intronic
1085909532 11:80804887-80804909 ATCCCAGCGGTTGGGACTTTTGG + Intergenic
1086890882 11:92256922-92256944 ATCTCAGCTGTTGGGAAGCTTGG + Intergenic
1087169015 11:95031562-95031584 GTTCCAGCAATTGGGACGCTGGG - Intergenic
1090769567 11:129907981-129908003 GTCCTAGCTACTGGGAGGCTGGG + Intronic
1091311994 11:134581203-134581225 GTCCCAGTTGCTGAGAGGCTTGG + Intergenic
1091471638 12:733378-733400 GTCCCAGCTACTTGGAGGCTGGG - Intergenic
1093769746 12:23004609-23004631 ATCCCAGCACTTGGGAGGCTGGG + Intergenic
1095464430 12:42475839-42475861 ATCCCAGCATTTGGGAGGCTGGG + Intronic
1095524087 12:43104546-43104568 GTCACAGCATTTGGGACGTTGGG - Intergenic
1096354272 12:50927143-50927165 GTCCCAGCTGCTGGGAGGGTGGG - Intronic
1096732204 12:53622853-53622875 GTCCCAGCTACTTGGAGGCTGGG + Intronic
1099027534 12:77484297-77484319 GTCCCAGCTATCTGGAAGCTGGG + Intergenic
1100578350 12:95914205-95914227 GTCCCAGCTACTCGGAGGCTGGG + Intronic
1109181951 13:59224418-59224440 ATACCAGCTATTGGGAGGCTGGG - Intergenic
1110720816 13:78759320-78759342 ATCCCAGCTGCTGGGAGGCTAGG + Intergenic
1112204398 13:97309661-97309683 TTCCCAGCTGTTGGTTTGCTTGG - Intronic
1116116338 14:40656381-40656403 ATCTCAGCTGTTGGCAGGCTTGG + Intergenic
1116414296 14:44661963-44661985 GTCCCAGATGTTGGGACTGCAGG - Intergenic
1116776317 14:49185278-49185300 ATCCCAGTTGTTGGGAGGCAAGG - Intergenic
1116818327 14:49603808-49603830 ATCCCAGCTACTGGGAGGCTGGG - Intronic
1116822511 14:49639236-49639258 GTCCCAGCTGCTTGGAGGCTGGG - Intergenic
1117196171 14:53342096-53342118 CTCCCAACTGTTGGGAAGATGGG + Intergenic
1117877819 14:60273916-60273938 GTCCCAACTGCTTGGAGGCTGGG - Intronic
1117995849 14:61477798-61477820 AGCCCAGCTGTTGGGACACAGGG - Intronic
1119226187 14:72946275-72946297 GTCCCAGCTGCTTGGGGGCTCGG + Intronic
1120401229 14:84034663-84034685 GTCCCAGCTATTTGGAAGTTGGG + Intergenic
1120934912 14:89885558-89885580 GTCCCAGCTACTTGGAGGCTGGG + Intronic
1121034927 14:90694147-90694169 GTCCCAGCTACTCGGAGGCTGGG + Intronic
1122002950 14:98678715-98678737 GTCCCAGCTACTGGGAGGCTGGG + Intergenic
1122198812 14:100109404-100109426 GTCCCATTTGTTTGGACCCTGGG + Intronic
1122580761 14:102770240-102770262 GTCCCAGATGTGGGGTCACTGGG + Intergenic
1202905180 14_GL000194v1_random:67519-67541 GTCCCAGCTACTGGGAGGCTGGG + Intergenic
1125602684 15:40924113-40924135 GTCCAAGTGGTTGGGACCCTTGG - Intergenic
1127937084 15:63651784-63651806 ATCCCAGCATTTGGGAGGCTGGG + Intronic
1128334826 15:66779161-66779183 GTCCCAGCAGGTGGGCAGCTGGG - Intronic
1131880000 15:96852252-96852274 GTCCCAGCCTTTGGGAGGCCAGG - Intergenic
1132820246 16:1863274-1863296 GTCCCAGCTGCTGGGAGGCAGGG - Intronic
1133069127 16:3234286-3234308 GTCCCAGCTACTGGGGAGCTGGG + Intronic
1133226001 16:4340668-4340690 GTCCCAGCTGCTGGGAGGGAGGG + Intronic
1134084972 16:11349991-11350013 GTCCCAGCAGTTGGAACAATGGG + Intronic
1142429681 16:90019392-90019414 GCCGCAGCTGTTGGGGCGCCCGG - Intronic
1143045333 17:4074183-4074205 CTCCCGGCTGATGGGACGCCTGG - Exonic
1146926455 17:36749232-36749254 GGCCCAGCTTGTGGGGCGCTGGG - Intergenic
1147270134 17:39263396-39263418 GTCTCAGCTGTTGGGAGGCTGGG + Intronic
1147508194 17:41041204-41041226 GTCCCACCGGTTGAGAAGCTAGG + Exonic
1148468401 17:47878396-47878418 TTCCCAGCTGATGGGAGGCGGGG - Intergenic
1150658400 17:67055642-67055664 GTCCCAGCTACTAGGAGGCTGGG - Intronic
1152047365 17:77946214-77946236 ATCCCAGATGTTGTGACGTTTGG - Intergenic
1152277505 17:79366844-79366866 ACCCCAGCTGCTGGGACCCTGGG + Intronic
1155171503 18:23270141-23270163 CTCCCTGCTGTGGGGAGGCTAGG + Intronic
1158831990 18:61289776-61289798 GTCCAAGCTGCTGGGGCTCTAGG + Intergenic
1159882973 18:73877230-73877252 ATCCCAGCTACTGGGAGGCTGGG - Intergenic
1160662204 19:306377-306399 GACCCCGCCGTTGGGACGCAGGG - Exonic
1161105910 19:2443955-2443977 GTCCCAGCTGTTGGGACGCTCGG - Intronic
1162201909 19:9026635-9026657 GTCTCAGCTGTTCGGGAGCTGGG - Intergenic
1163672507 19:18637122-18637144 GTCTCACCTGTTCGGGCGCTCGG - Exonic
1165028536 19:32980487-32980509 GTCCCAGCTGCTTGGAGCCTGGG + Intronic
1165488086 19:36107493-36107515 GTCCCAGCTGCTGGGTGGCCTGG + Intergenic
1165548912 19:36566569-36566591 GTCCTAGCTGTTGGGGAGGTGGG + Intronic
1167100083 19:47399285-47399307 GTCCCAGCGGCTGGTACACTGGG - Intergenic
1167514992 19:49918181-49918203 GTCCCAGCTAACGGGAGGCTAGG - Intronic
1167851028 19:52202055-52202077 GGCCCAGATGTGGGGACTCTTGG + Intronic
925290568 2:2745604-2745626 CTCCCAGCTGTGGGAACTCTAGG + Intergenic
929206350 2:39298846-39298868 GTCCCAGCTACTGGGAGGCTGGG + Intronic
930165090 2:48196710-48196732 GTCCTAGCTATTGGGAAACTTGG + Intergenic
935783228 2:106526122-106526144 GTCCCAGCTATTCGGAGGCTGGG + Intergenic
939481037 2:142747406-142747428 GTCCCAGCACTCGGGAGGCTGGG + Intergenic
939822417 2:146973638-146973660 GTCCAAGCTGTTGGAAAGTTTGG - Intergenic
944105882 2:196078762-196078784 GTCTCAGCTACTGGGAGGCTGGG + Intergenic
944545237 2:200792690-200792712 GTCCCAGCTACTTGGAGGCTTGG + Intergenic
1168924580 20:1568637-1568659 GTCCCTGCTGTTTGGCTGCTGGG - Intronic
1170944074 20:20874377-20874399 GTCCCAGCTCTTGGGGGTCTGGG + Intergenic
1174463431 20:50699174-50699196 ATCCCAGCTACTGGGAGGCTGGG + Intergenic
1175004284 20:55665871-55665893 GTCCCAGCTAGTGTGACCCTGGG - Intergenic
1175496734 20:59419690-59419712 CTCCCAGCTGTTGGGAAGCCCGG + Intergenic
1176624546 21:9082274-9082296 GTCCCAGCTACTGGGAGGCTGGG + Intergenic
1178555991 21:33590530-33590552 ATCCCAGCTACTGGGAGGCTGGG - Intronic
1180713095 22:17853257-17853279 GTGCCAGCTGTTGTGAAGCACGG - Intronic
1180910792 22:19448511-19448533 GTCCCAGCTGTTCGGAGTCCAGG - Intergenic
1181582926 22:23837839-23837861 GGCCCAGCTGCTGGGACTCCTGG - Exonic
1183591861 22:38783646-38783668 GGCCCAGCAGCTGGGAGGCTTGG + Intronic
1183729253 22:39608188-39608210 GTCCCAGCTGTTTGGGCGGCAGG + Intronic
950643215 3:14361562-14361584 TTCCCAGGTGATGGGACACTGGG - Intergenic
950656660 3:14440953-14440975 GCCCCAGGTGGTGGGACGATGGG + Intronic
954691421 3:52397553-52397575 GTCCCTGCTCTTGGGACTCCAGG - Intronic
957711276 3:83861923-83861945 GTCCCAGCTACTCGGAGGCTGGG + Intergenic
958614748 3:96478122-96478144 GTCCCAGCTATTGGGGGGCTGGG - Intergenic
960135281 3:114098201-114098223 GTCCCAGCTCCTGGGAAGGTTGG - Intergenic
961028354 3:123580937-123580959 GTCCCAGCTACTGGGAGGCAAGG - Intronic
961646860 3:128397349-128397371 TTCCCAGCTGTTGTGACCCCAGG + Intronic
965566305 3:170122130-170122152 GACCCAGCTATTTGGAAGCTGGG + Intronic
967627548 3:191703436-191703458 GGCCCTGCTGCTGGGAAGCTTGG - Intergenic
968690884 4:1989568-1989590 CTCACACCTGTTGGGAGGCTGGG - Intronic
968913164 4:3485894-3485916 GTCCGAGCTGTTGGAACGCTTGG + Intronic
971484323 4:27143862-27143884 GTCCCAGCTACTTGGAGGCTGGG - Intergenic
973678073 4:53286442-53286464 GTCCCAGAGGCTGGGATGCTGGG - Intronic
973771842 4:54213852-54213874 GTCCAAGCTGAAGGGACCCTTGG + Intronic
974857021 4:67473667-67473689 GTCCTAGCTCTCGGGAGGCTGGG - Intronic
975576240 4:75865501-75865523 GACCCAGCTATTGGGAGGCGAGG - Intronic
976285854 4:83370551-83370573 CTCCCAGCTGCTGTGACTCTGGG + Intergenic
976442928 4:85096970-85096992 GTCCTAGCTGCTGGGACACCAGG + Intergenic
978420978 4:108532577-108532599 ATCCCAGCTGTCAGGAGGCTGGG + Intergenic
979031778 4:115658098-115658120 GTTCCAGCTGTTGTGGCCCTGGG - Intergenic
982590532 4:157303662-157303684 GTGCCATCTGTTGGGAAGCTGGG - Exonic
983375803 4:166926616-166926638 CTACCAGCTGTTGGGTTGCTTGG - Intronic
985776846 5:1848793-1848815 ATCCCAGCTGTTGGCCAGCTTGG + Intergenic
986152343 5:5139777-5139799 GGCACAGCTGTGGGGACACTGGG - Intergenic
986177370 5:5363822-5363844 GTCCCTGCAGTTGGGACCCTTGG - Intergenic
986707646 5:10464527-10464549 GTCCCAGTTCTTTGGAGGCTTGG - Intronic
989269312 5:39513386-39513408 GTCCCAGCTGCTGGAACAATAGG + Intergenic
989796798 5:45484315-45484337 GTCCCAGCTACTTGGAGGCTGGG + Intronic
992116035 5:73539363-73539385 ATCCCAGCTACTGGGATGCTGGG - Intergenic
992432229 5:76720321-76720343 GTCCCAGCACTTGGGAGACTGGG + Intronic
996721015 5:126630167-126630189 GTCCCAGCTATTGGGAGGCTGGG + Intergenic
996767302 5:127047450-127047472 TTGCCAGCTGTTGGGACCCATGG + Exonic
998108142 5:139481533-139481555 GTCCCAGCTGCAGGGAGGCTAGG + Exonic
1000637122 5:163657209-163657231 ATCCCAGCTCTTGGGAGGCCAGG - Intergenic
1002534944 5:179870849-179870871 GGCTCAACTGTTGTGACGCTAGG + Intronic
1002591896 5:180296143-180296165 GTCCCAGCTGCTGGTGCTCTGGG - Intergenic
1003202757 6:3977373-3977395 GTCTCTGCTGTTGGCAGGCTGGG + Intergenic
1004224789 6:13775558-13775580 ATTCCAGCTCTTGGGAGGCTGGG + Intergenic
1004933936 6:20489344-20489366 GTCCCAGCTATAGGGAGGCTGGG + Intronic
1008976632 6:57434890-57434912 GTCCCAGCTACTCGGAGGCTGGG - Intronic
1018686620 6:166308411-166308433 GTCTCAGCTGTGGGGACCCGGGG - Intronic
1018937127 6:168280857-168280879 GGCACTGCTGTTGGGAGGCTTGG - Intergenic
1019175253 6:170156333-170156355 GTCCCAACTGTTGAGAACCTGGG + Intergenic
1019586912 7:1809971-1809993 GTCCCAGCTCTGGTGTCGCTGGG - Intergenic
1022141300 7:27495269-27495291 GTCCCAGCTACTGGGAGGCATGG + Intergenic
1023200633 7:37693668-37693690 GGCACAGCTGTTGGGGCCCTGGG + Intronic
1032270583 7:130400947-130400969 GTCCCTGCTGGTGTGACGGTAGG - Intronic
1034145958 7:148871824-148871846 ATCCCAGCACTTGGGAGGCTGGG - Intronic
1035271273 7:157721529-157721551 GCTCCTGCTGGTGGGACGCTGGG - Intronic
1036619555 8:10415620-10415642 GACCCAGCAGATGGGACCCTGGG - Intronic
1038328898 8:26592274-26592296 GTCCCAGTAGTTGGGACTGTAGG + Intronic
1038373533 8:27015299-27015321 ATCCCAGCATTTGGGAGGCTGGG + Intergenic
1039447302 8:37643054-37643076 GTCCCAGCTATTTGGAAGGTGGG - Intergenic
1044935621 8:97290943-97290965 CTCCCAGCTGGTAGGACTCTTGG + Intergenic
1047484570 8:125317312-125317334 GTCCCAGCTATTCGGAGGCTGGG - Intronic
1048532978 8:135267156-135267178 GTCCTGGCTGTTGGCATGCTGGG + Intergenic
1049635237 8:143684634-143684656 GTCCCAGCAGCCGCGACGCTGGG - Intronic
1049919042 9:346288-346310 GTACCAGCTGTTGGGTCACATGG - Intronic
1051460947 9:17314437-17314459 CACCCACCTGTTGGGACGCAGGG - Intronic
1051612261 9:18972702-18972724 GGCCCTTCTGTTGGTACGCTGGG - Intronic
1053084426 9:35206064-35206086 GTCCCAGCTACTTGGAGGCTGGG + Intronic
1056201903 9:84285055-84285077 GTCCCAGCTCATGTGACTCTGGG + Intronic
1056506887 9:87265990-87266012 GTCCTAGCTGCTGGGAGGGTTGG - Intergenic
1056516761 9:87359503-87359525 TTCCCAGCTGTTGTGACTATGGG + Intergenic
1057215667 9:93227087-93227109 CTTCCAGCTGCTGGGAGGCTGGG - Intronic
1058614099 9:106807383-106807405 GTCCCAGCTACTTGGAGGCTGGG + Intergenic
1060187061 9:121570050-121570072 GTCCCAAGTGTTGGGATTCTAGG + Intronic
1061484806 9:130914837-130914859 GTCCCAGCTGATGGGATGATGGG + Intronic
1203747721 Un_GL000218v1:52706-52728 GTCCCAGCTACTGGGAGGCTGGG + Intergenic
1203562022 Un_KI270744v1:65280-65302 GTCCCAGCTACTGGGAGGCTGGG - Intergenic
1187737203 X:22317070-22317092 GTCACAGCTGGTGGGAGTCTGGG - Intergenic
1190899999 X:54662443-54662465 GTCCCAGCTACTCGGAAGCTGGG - Intergenic
1192637851 X:72836719-72836741 GTCCCAGAAGTGGGGAGGCTAGG - Intronic
1192643863 X:72884096-72884118 GTCCCAGAAGTGGGGAGGCTAGG + Intronic
1192809606 X:74536827-74536849 GATCCCGCTCTTGGGACGCTAGG - Intergenic
1193004977 X:76606323-76606345 GTGCCAGCTGGTGTGACCCTAGG - Intergenic
1201161055 Y:11167691-11167713 GTCCCAGCTACTGGGAGGCTGGG + Intergenic