ID: 1161105911

View in Genome Browser
Species Human (GRCh38)
Location 19:2443963-2443985
Sequence GGGGTTTTGTCCCAGCTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 172}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161105911_1161105925 27 Left 1161105911 19:2443963-2443985 CCCAACAGCTGGGACAAAACCCC 0: 1
1: 0
2: 1
3: 5
4: 172
Right 1161105925 19:2444013-2444035 AATGCCTACGATGGGGCCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 101
1161105911_1161105924 20 Left 1161105911 19:2443963-2443985 CCCAACAGCTGGGACAAAACCCC 0: 1
1: 0
2: 1
3: 5
4: 172
Right 1161105924 19:2444006-2444028 ACAGGGAAATGCCTACGATGGGG 0: 1
1: 0
2: 0
3: 5
4: 92
1161105911_1161105922 18 Left 1161105911 19:2443963-2443985 CCCAACAGCTGGGACAAAACCCC 0: 1
1: 0
2: 1
3: 5
4: 172
Right 1161105922 19:2444004-2444026 CCACAGGGAAATGCCTACGATGG 0: 1
1: 0
2: 2
3: 8
4: 86
1161105911_1161105918 3 Left 1161105911 19:2443963-2443985 CCCAACAGCTGGGACAAAACCCC 0: 1
1: 0
2: 1
3: 5
4: 172
Right 1161105918 19:2443989-2444011 ACCAAGAACATCCAACCACAGGG 0: 1
1: 0
2: 1
3: 18
4: 182
1161105911_1161105917 2 Left 1161105911 19:2443963-2443985 CCCAACAGCTGGGACAAAACCCC 0: 1
1: 0
2: 1
3: 5
4: 172
Right 1161105917 19:2443988-2444010 CACCAAGAACATCCAACCACAGG 0: 1
1: 0
2: 2
3: 11
4: 128
1161105911_1161105923 19 Left 1161105911 19:2443963-2443985 CCCAACAGCTGGGACAAAACCCC 0: 1
1: 0
2: 1
3: 5
4: 172
Right 1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG 0: 1
1: 0
2: 0
3: 4
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161105911 Original CRISPR GGGGTTTTGTCCCAGCTGTT GGG (reversed) Intronic
902557751 1:17256904-17256926 GCTGTGTTGTCCCAGCTGCTTGG + Intronic
903895608 1:26601580-26601602 GTGGTGTAGTCCCAGCTATTTGG + Intergenic
904017153 1:27430761-27430783 GGGGACTTGGCCCAGCTATTCGG - Intronic
906042598 1:42799848-42799870 GTGGTGTTGTTCCAGCTGCTTGG - Intergenic
911325152 1:96462563-96462585 GGCCTGTAGTCCCAGCTGTTGGG - Intergenic
913291326 1:117274879-117274901 GGCTTCTTGTCCCAGCTGCTGGG - Intergenic
914819988 1:151094175-151094197 TGGCTATTGTCCCAGCTGCTCGG - Intronic
915556191 1:156662047-156662069 GGGCCTTTGTCCCAGCCGTGAGG + Intergenic
923047091 1:230363243-230363265 GGGGATTAGTCCCACCTGTGGGG - Intronic
924323319 1:242870852-242870874 AGGCTTTTGTCCCAGCTGTGGGG - Intergenic
1070315909 10:75312003-75312025 GTGGTGTAATCCCAGCTGTTTGG - Intergenic
1073311516 10:102546194-102546216 CTGGCTTTGTCCCAGCAGTTTGG - Intronic
1074184992 10:111093480-111093502 GTGTTCTTGTCCCAGCTTTTAGG + Intergenic
1074208378 10:111304305-111304327 AGGGATTTGTCCCAGCTGACAGG + Intergenic
1076218920 10:128717618-128717640 TTGGTTTTTACCCAGCTGTTGGG + Intergenic
1077065412 11:638954-638976 CGGCTGTTGTCCCAGCTATTCGG + Intronic
1078764866 11:14286439-14286461 AGGGTTTTGTCCCAGTAGTGGGG - Intronic
1080932420 11:36825857-36825879 GACTTATTGTCCCAGCTGTTGGG + Intergenic
1081254770 11:40878653-40878675 GGTGTTTTGGCCCAGGGGTTGGG + Intronic
1081755760 11:45543242-45543264 GGGTTTTTGTCCCAGATTGTGGG + Intergenic
1082085415 11:48045737-48045759 GTGGTTGTGGCCCAGTTGTTTGG + Intronic
1083193933 11:61071780-61071802 GGGGTTTCCTCCAGGCTGTTGGG - Intergenic
1083799318 11:65037337-65037359 GTGGTCCTGTCCCAGCTATTTGG - Intronic
1083824302 11:65189681-65189703 TGGGTTTTGTGCCAGATGATGGG - Intronic
1086149705 11:83595189-83595211 TGAGTTTTCTCCCAGCTCTTGGG + Intronic
1087312848 11:96569940-96569962 CTGGTTTTGTCCCATGTGTTTGG - Intergenic
1088832309 11:113547772-113547794 GGGTTTTTATCCCAGTGGTTTGG - Intergenic
1090357430 11:126149456-126149478 GAGGTTTATTCCCAGGTGTTGGG + Intergenic
1090447264 11:126775078-126775100 GGGTATTTGCCCCAGCTGCTCGG - Intronic
1091088849 11:132750072-132750094 GGGGTTTTGCCCCAACACTTTGG + Intronic
1091715837 12:2775555-2775577 GGGGTGCTGTTCCAGCTGGTGGG - Intergenic
1094562325 12:31567190-31567212 TGGGTGTAGTCCCAGCTATTTGG + Intronic
1095171966 12:39046724-39046746 GGGCTGTAGTCCCAGCTGCTCGG + Intergenic
1102232540 12:111273493-111273515 GTGGTTTTGTCCAAGCTCCTTGG - Intronic
1103437675 12:120939450-120939472 GGGGTGTAGTCCCAGCTACTAGG + Intergenic
1105374505 13:19831250-19831272 TGGCTGTAGTCCCAGCTGTTTGG - Intronic
1106518855 13:30478992-30479014 TGGGATTTGGCCCAGCTATTTGG - Intronic
1106586160 13:31058121-31058143 GAGGTTTTGTCCTAGGTGCTTGG + Intergenic
1107656437 13:42596456-42596478 GGTATTTTGTCCCAGCTTTCAGG + Intronic
1109051489 13:57488319-57488341 AAGCTTTTGTCCCAGCTGCTAGG + Intergenic
1109410726 13:61964275-61964297 TGGTTTGTGGCCCAGCTGTTCGG + Intergenic
1109695085 13:65944786-65944808 TGCCTTTGGTCCCAGCTGTTGGG + Intergenic
1118312138 14:64701996-64702018 GAGGTATTTTCCCAACTGTTTGG - Intergenic
1120095338 14:80381721-80381743 GGTGTTTTGTTTGAGCTGTTTGG - Intronic
1121345119 14:93129889-93129911 TGGGTATGGTCCCAGCTGCTTGG - Intergenic
1122467981 14:101947389-101947411 GGCCTGTAGTCCCAGCTGTTCGG + Intergenic
1123990246 15:25678043-25678065 GGGCTTTTCTCCCAGCTTTCAGG - Exonic
1125608711 15:40956889-40956911 AGGGTTCTGGCCTAGCTGTTAGG - Intergenic
1131675318 15:94665243-94665265 GGGCTTCTGTCCCTGCTGTGTGG + Intergenic
1131694750 15:94864517-94864539 GTGTTTTTGTCCCACCTTTTGGG + Intergenic
1131983113 15:98015132-98015154 GGGCTTTTCTCCCACCTGTAGGG + Intergenic
1132487845 16:205273-205295 TGGCTTTAGTCTCAGCTGTTCGG - Intronic
1132614026 16:831558-831580 GGGGTTTAGTCCCACCAGGTGGG + Intergenic
1133213585 16:4276756-4276778 GTGATGTAGTCCCAGCTGTTCGG + Intergenic
1133662956 16:7936779-7936801 GGGCTTTAGTCCCAGCTACTGGG - Intergenic
1133868269 16:9664116-9664138 GGGCTTTCACCCCAGCTGTTTGG - Intergenic
1135686848 16:24504700-24504722 GGCCTATTGTCCCAGCTATTTGG - Intergenic
1138097546 16:54223848-54223870 GGCCTGTAGTCCCAGCTGTTTGG + Intergenic
1139300518 16:65941777-65941799 TGGGTTTAATCCCAGCTGTGTGG - Intergenic
1141346176 16:83248172-83248194 TGTGCTTTGTCCCAGCTGGTGGG - Intronic
1141759690 16:86019772-86019794 GAGGTTTTGTCCCATCTCTAGGG - Intergenic
1142604331 17:1073307-1073329 GGGTTTCTCTCCCAGCTGCTCGG - Intronic
1142919153 17:3169469-3169491 TGGGTTCTGACCCAGCTGCTGGG - Intergenic
1143704137 17:8685193-8685215 GGGCTGTAGTCCCAGCTATTCGG + Intergenic
1145878070 17:28335011-28335033 GGAGCTTAGTCCCAGCTCTTGGG - Intronic
1146282630 17:31554875-31554897 AAGGGTTTGTCCCAGCTGCTTGG - Intergenic
1147959279 17:44156359-44156381 TGGGCATGGTCCCAGCTGTTCGG - Intronic
1152179476 17:78809746-78809768 CGTCTGTTGTCCCAGCTGTTTGG - Intronic
1154062044 18:11071418-11071440 TGGGCGTTGTCCCAGGTGTTTGG + Intronic
1158318209 18:56235513-56235535 GGAGTTTTCTCCCTGCTGTCAGG + Intergenic
1160896632 19:1405751-1405773 GGGTTTTAGTCCCAGCTACTTGG + Intergenic
1160996404 19:1884089-1884111 GGGGTCCTGTCCCAGCTTTGAGG - Intronic
1161105911 19:2443963-2443985 GGGGTTTTGTCCCAGCTGTTGGG - Intronic
1161502227 19:4622750-4622772 CCAGTTTGGTCCCAGCTGTTGGG + Intergenic
1162748839 19:12815688-12815710 ATGGTGTAGTCCCAGCTGTTCGG - Intronic
1163475003 19:17520781-17520803 GGACTCTTGTCCCTGCTGTTTGG + Intronic
1165592419 19:36981033-36981055 TGGCCTTTGTCCCAGCTCTTGGG - Intronic
925594415 2:5541002-5541024 GGGGATTTGGCTCAGCTGGTGGG + Intergenic
925620009 2:5782808-5782830 GGGGTGTAGTCCCAGCTATTCGG - Intergenic
925920147 2:8632713-8632735 GGGGCTGTGGCCCAGATGTTGGG - Intergenic
926064071 2:9823213-9823235 GAGGTTTTGCCCCAGTAGTTGGG + Intergenic
928830021 2:35470323-35470345 GAGCTGTTGTCCCAGCTGCTTGG - Intergenic
930307527 2:49694177-49694199 GGGCTTTTGTCCTGGTTGTTGGG + Intergenic
931291556 2:60878693-60878715 GGCATGTAGTCCCAGCTGTTTGG + Intergenic
933822854 2:86130172-86130194 GGGCGTTAGTCCCAGCTGCTCGG + Intronic
943003205 2:182356606-182356628 GGGGTGTGGTCCCAGCTATGTGG + Intronic
944078635 2:195759724-195759746 GGTCTTTAGTCCCAGCTGCTTGG + Intronic
944775705 2:202962363-202962385 GGGCTGTAGTCCCAGCTATTTGG + Intronic
946375529 2:219306732-219306754 GTGCTTTTGTCCTAACTGTTTGG + Intronic
947545433 2:231007176-231007198 GGGGTATTGTCTAAGCTGATTGG + Intronic
947819883 2:233062181-233062203 GGGATCTTGTCCTGGCTGTTTGG + Intronic
1170217103 20:13902990-13903012 GGGCTGTAGTCCCAGCTGCTTGG + Intronic
1172567503 20:35942140-35942162 GGGGTGTAGTCCCAGCTACTTGG + Intronic
1173587877 20:44197990-44198012 GGTGTTCTGTCCCAAATGTTTGG - Intronic
1177717961 21:24865307-24865329 GGGCTTTAGTCCCAGTTGTTTGG + Intergenic
1179023589 21:37660433-37660455 GGTGTTCTGGCCCAGCTGTGAGG + Intronic
1180910793 22:19448519-19448541 TGCTTTTGGTCCCAGCTGTTCGG - Intergenic
1181396843 22:22629022-22629044 GAGGTGTGGTCCCTGCTGTTAGG + Intergenic
1181499538 22:23308072-23308094 GAGGTGTGGTCCCTGCTGTTAGG + Intronic
1185213757 22:49587017-49587039 GGGGTTGTGGCCCAGCTGTTGGG + Intronic
949546220 3:5075097-5075119 GGCCTATTGTCCCAGCTATTTGG + Intergenic
954597394 3:51838109-51838131 TGGCTCTGGTCCCAGCTGTTTGG + Intergenic
955037573 3:55283750-55283772 TGGTTTTTGTCCCAGGTTTTTGG - Intergenic
955437688 3:58920214-58920236 TGGCTGTGGTCCCAGCTGTTTGG - Intronic
957487608 3:80882834-80882856 GGGGTCTTGTGCAAGGTGTTTGG - Intergenic
959648332 3:108727259-108727281 GAGGGTTTGTGCAAGCTGTTTGG - Intergenic
960961372 3:123072729-123072751 AGGGTTTTGCCCCAGCTTTGTGG + Intronic
966961030 3:184938902-184938924 TGCCTTTTGTCCCAGCTGTACGG + Intronic
967356102 3:188573513-188573535 GGGGCATTGTCCCAGCGTTTCGG + Intronic
967378448 3:188831340-188831362 AGGGTTCAGTCCCAGCAGTTAGG + Intronic
969465872 4:7356049-7356071 GGGCCTTTGCACCAGCTGTTTGG + Intronic
971784845 4:31086983-31087005 AGGCTTCTGTCCCTGCTGTTTGG - Intronic
971803149 4:31318595-31318617 TGGGTTCTGGCCCAGCTTTTTGG + Intergenic
973192374 4:47400432-47400454 GGGGTTTGGGCCCAGCTGCCAGG + Intronic
973822628 4:54676366-54676388 TGGGCTTTGTCACAGCTGTCAGG + Intronic
974583081 4:63832470-63832492 GCGCTGTAGTCCCAGCTGTTGGG - Intergenic
981167486 4:141578625-141578647 GGAATTTTGCCCCAGCTGTTTGG + Intergenic
981247960 4:142562630-142562652 TGGGTTTTGTGCAACCTGTTGGG - Intronic
983860304 4:172697914-172697936 GGGGTTTTGATCCAGGTGCTTGG - Intronic
984126487 4:175816983-175817005 GGGGTGTAGTCCCAGCTCCTCGG - Intronic
984361065 4:178733276-178733298 TGCGTCTAGTCCCAGCTGTTTGG - Intergenic
984585920 4:181564164-181564186 GGGTGTTTGTCCCAGCTACTTGG - Intergenic
986440382 5:7776355-7776377 GGCATTTTGTCCCATCCGTTTGG + Intronic
989237038 5:39160001-39160023 GGGGTTTTTTCCAAGAAGTTTGG - Intronic
990647334 5:57859145-57859167 GGCTTGTTGACCCAGCTGTTTGG - Intergenic
991665943 5:69000154-69000176 GGGGTTATGTCCCAGCATTTAGG + Intergenic
998085628 5:139320181-139320203 CGCCTGTTGTCCCAGCTGTTGGG + Intronic
998164666 5:139836238-139836260 GGGGTGTTGACCTTGCTGTTTGG + Intronic
999270811 5:150295401-150295423 GGGTGCTTGTCCCAGCTGTGTGG - Intergenic
1001363190 5:171108536-171108558 CGGCTGTGGTCCCAGCTGTTTGG - Intronic
1005428141 6:25725724-25725746 GGCCTGTAGTCCCAGCTGTTCGG - Intergenic
1006616513 6:35331678-35331700 GGGCTGTAGTCCCAGCTGCTTGG + Intergenic
1007364059 6:41377969-41377991 GGGATTTGGCCCCAGCTGTCAGG - Intergenic
1007873823 6:45071615-45071637 GGGGATCTGTCCCAGTTATTAGG + Intronic
1007896549 6:45367210-45367232 GTGGTTTTGGCCTGGCTGTTAGG - Intronic
1009395087 6:63190393-63190415 GGGCTTTTGTCCCACCTCTGTGG + Intergenic
1009996217 6:70898332-70898354 GGGTTTTTGTCCCACCTATGGGG - Intronic
1011500787 6:87987157-87987179 GTGGTATTATTCCAGCTGTTTGG - Intergenic
1014426197 6:121309840-121309862 GGGGTTTTGTCACATCACTTAGG - Intronic
1015355562 6:132273484-132273506 GGTTTGTGGTCCCAGCTGTTTGG - Intergenic
1015709494 6:136123866-136123888 GGGTTTTTATTTCAGCTGTTTGG + Intronic
1019418486 7:937815-937837 GGTTTTCTGTCACAGCTGTTAGG + Intronic
1022211476 7:28214385-28214407 GCTGTTTTCTCCCAACTGTTAGG + Intergenic
1023135789 7:37050202-37050224 GGTGTGTTGTCCCAGCTACTTGG - Intronic
1028808738 7:95059937-95059959 GGTGTTTTGCCTCAGATGTTGGG + Intronic
1031937427 7:127749972-127749994 TGCCTTTGGTCCCAGCTGTTTGG + Intronic
1036638780 8:10569270-10569292 GTGGTTTTGTCCCAACTTTGAGG - Intergenic
1036769914 8:11571856-11571878 GGGCTTGTGTCCCAGCTGCGTGG - Intergenic
1037737394 8:21578623-21578645 GTGGCTTTGTCCCAGCTGACAGG + Intergenic
1037823852 8:22148905-22148927 GTGGTCGTGGCCCAGCTGTTTGG - Exonic
1039512103 8:38100408-38100430 TGGCTTTAGTCCCAGCTATTTGG - Intergenic
1039975737 8:42363266-42363288 GTGGTGTAGTCCCAGCTCTTTGG + Intronic
1044935620 8:97290935-97290957 GAGGCTTTCTCCCAGCTGGTAGG + Intergenic
1045190448 8:99876976-99876998 GTGGTGTAGTCCCAGCTGCTTGG - Exonic
1048270393 8:133023500-133023522 GGGGTTTTGTGGAAGCTCTTTGG + Intronic
1051904548 9:22080204-22080226 TGGGTTTTCCCCAAGCTGTTTGG + Intergenic
1053111995 9:35469150-35469172 TGTGTTTTGTCCTAGCAGTTGGG + Intergenic
1055761308 9:79611322-79611344 GGGTTTTTGTCCATACTGTTAGG + Intronic
1056598838 9:88030141-88030163 GGCCTGTTGTCCCAGCTGCTTGG - Intergenic
1057314217 9:93958549-93958571 GGGGGTGTGTCCCAGGCGTTGGG - Intergenic
1057361644 9:94378717-94378739 GGGGTCTAGTGGCAGCTGTTTGG - Intronic
1061046161 9:128166264-128166286 GGTGTTTTGTCCTGGGTGTTGGG + Exonic
1061145057 9:128792688-128792710 GGTGGATTGTCCCAGCGGTTGGG + Intronic
1061991277 9:134160037-134160059 GGGGCTTTGTCCCCGGTGGTGGG + Intergenic
1186023064 X:5278455-5278477 GGTGTGTAGTCCCAGCTGCTTGG + Intergenic
1186418499 X:9404556-9404578 GGCCTTCTCTCCCAGCTGTTTGG + Intergenic
1186418840 X:9407463-9407485 GGCCTTCTCTCCCAGCTGTTTGG + Intergenic
1186418950 X:9408394-9408416 GGCCTTCTCTCCCAGCTGTTTGG + Intergenic
1186419059 X:9409325-9409347 GGCCTTCTCTCCCAGCTGTTTGG + Intergenic
1186419168 X:9410256-9410278 GGCTTTCTCTCCCAGCTGTTTGG + Intergenic
1186419294 X:9411301-9411323 GGCCTTCTCTCCCAGCTGTTTGG + Intergenic
1186419397 X:9412233-9412255 GGCCTTCTCTCCCAGCTGTTTGG + Intergenic
1186419526 X:9413278-9413300 GGCCTTCTCTCCCAGCTGTTTGG + Intergenic
1187854165 X:23620854-23620876 GGCCTTTAGTCCCAGCTATTTGG - Intergenic
1187920652 X:24198326-24198348 GGGCTGTGGTCCCAGCTGCTCGG - Intronic
1191845060 X:65540954-65540976 GGGGTCCAGTCCTAGCTGTTTGG - Intergenic
1192816205 X:74595155-74595177 GGAGTTCTGGCCCTGCTGTTTGG - Intronic
1192867450 X:75150117-75150139 TGGGTTTTGTCCCTGCTTTCAGG - Intronic
1197199673 X:123737304-123737326 TGCCTTTAGTCCCAGCTGTTTGG - Intergenic