ID: 1161105912

View in Genome Browser
Species Human (GRCh38)
Location 19:2443964-2443986
Sequence CGGGGTTTTGTCCCAGCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 70}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161105912_1161105925 26 Left 1161105912 19:2443964-2443986 CCAACAGCTGGGACAAAACCCCG 0: 1
1: 0
2: 1
3: 8
4: 70
Right 1161105925 19:2444013-2444035 AATGCCTACGATGGGGCCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 101
1161105912_1161105923 18 Left 1161105912 19:2443964-2443986 CCAACAGCTGGGACAAAACCCCG 0: 1
1: 0
2: 1
3: 8
4: 70
Right 1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG 0: 1
1: 0
2: 0
3: 4
4: 66
1161105912_1161105918 2 Left 1161105912 19:2443964-2443986 CCAACAGCTGGGACAAAACCCCG 0: 1
1: 0
2: 1
3: 8
4: 70
Right 1161105918 19:2443989-2444011 ACCAAGAACATCCAACCACAGGG 0: 1
1: 0
2: 1
3: 18
4: 182
1161105912_1161105924 19 Left 1161105912 19:2443964-2443986 CCAACAGCTGGGACAAAACCCCG 0: 1
1: 0
2: 1
3: 8
4: 70
Right 1161105924 19:2444006-2444028 ACAGGGAAATGCCTACGATGGGG 0: 1
1: 0
2: 0
3: 5
4: 92
1161105912_1161105922 17 Left 1161105912 19:2443964-2443986 CCAACAGCTGGGACAAAACCCCG 0: 1
1: 0
2: 1
3: 8
4: 70
Right 1161105922 19:2444004-2444026 CCACAGGGAAATGCCTACGATGG 0: 1
1: 0
2: 2
3: 8
4: 86
1161105912_1161105917 1 Left 1161105912 19:2443964-2443986 CCAACAGCTGGGACAAAACCCCG 0: 1
1: 0
2: 1
3: 8
4: 70
Right 1161105917 19:2443988-2444010 CACCAAGAACATCCAACCACAGG 0: 1
1: 0
2: 2
3: 11
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161105912 Original CRISPR CGGGGTTTTGTCCCAGCTGT TGG (reversed) Intronic
901654004 1:10758977-10758999 CGGGGATTTGTACCTGGTGTGGG - Intronic
901914686 1:12489339-12489361 CTGGGTTTTCTCCCATCAGTGGG - Intronic
902844776 1:19101412-19101434 TGGGGAATTGTACCAGCTGTGGG - Intronic
903193300 1:21668574-21668596 CAGGGTTTGGTGCCAGCTGCGGG - Intronic
903777825 1:25804618-25804640 GGGGGCATTGCCCCAGCTGTAGG - Intronic
904753686 1:32756310-32756332 CAGGGATTTGTTTCAGCTGTGGG + Intronic
905397863 1:37678768-37678790 AGGGGTTCTGACCCAGCTGAGGG + Intergenic
907619634 1:55963297-55963319 GTGGGTTTTGTCGCTGCTGTTGG - Intergenic
923047092 1:230363244-230363266 TGGGGATTAGTCCCACCTGTGGG - Intronic
924323320 1:242870853-242870875 AAGGCTTTTGTCCCAGCTGTGGG - Intergenic
1063243159 10:4192125-4192147 AGGGCTTTTGTCATAGCTGTGGG - Intergenic
1069902767 10:71715445-71715467 CGAGGTTTTGCCCCAGCACTGGG + Exonic
1071361826 10:84854558-84854580 CGAAGTTTTCTCACAGCTGTAGG + Intergenic
1072806275 10:98425678-98425700 CCTGGTTCTGTCCCAGCTGATGG - Exonic
1078764867 11:14286440-14286462 AAGGGTTTTGTCCCAGTAGTGGG - Intronic
1085210712 11:74775072-74775094 TGGGCTCTTGTCCCAGCTGTAGG - Intronic
1088123462 11:106396071-106396093 GGGGTTTTTATCCCAGATGTGGG - Intergenic
1088766863 11:112990346-112990368 CTGAGCTTAGTCCCAGCTGTGGG - Intronic
1089446252 11:118555012-118555034 CCTGATTTTATCCCAGCTGTCGG - Exonic
1090240258 11:125176668-125176690 CTGAGTTTTGTCCCTCCTGTGGG + Intronic
1092121255 12:6045598-6045620 CGGGATCTTGCCCCAGCTCTAGG + Intronic
1096793629 12:54060569-54060591 CGGGGTCGTGACCCAGCTGAAGG - Intergenic
1097870787 12:64600344-64600366 CAGGTTTTTGTCCCCCCTGTGGG + Intergenic
1101445781 12:104735977-104735999 CGGGGTTGTGGCCAGGCTGTGGG + Intronic
1105281120 13:18963095-18963117 CGGGGTCCAGTCCCAGCTCTGGG - Intergenic
1105290323 13:19049107-19049129 CGGGGTCCAGTCCCAGCTCTGGG - Intergenic
1105874437 13:24540386-24540408 CGGGGTTAGGACCCAGCTATAGG + Intergenic
1107664204 13:42672399-42672421 TGGGGTTTTTTTCCAGCTTTTGG - Intergenic
1113957918 13:114109042-114109064 TGGGGTTTTGACCCAGCTTGAGG - Intronic
1120442133 14:84555224-84555246 CTGGGTTTTCTTCCAGCTCTGGG + Intergenic
1121643349 14:95500910-95500932 CGGGATTTTGTGCCTGGTGTGGG - Intergenic
1125179817 15:36869884-36869906 CTGGATTTTCTCCCAGTTGTAGG - Intergenic
1129185793 15:73905722-73905744 CAGGGTTTTATCCCACCTGGGGG - Intergenic
1131983112 15:98015131-98015153 AGGGCTTTTCTCCCACCTGTAGG + Intergenic
1134609796 16:15598911-15598933 CGGGGTCTGGTCTCAGCTGAGGG + Exonic
1135737893 16:24947300-24947322 CTGGGTGCTGTCCCAGCTGGTGG - Intronic
1141346177 16:83248173-83248195 CTGTGCTTTGTCCCAGCTGGTGG - Intronic
1141574936 16:84957808-84957830 CAGGTTTTTCTCCCAGCAGTGGG + Intergenic
1141759691 16:86019773-86019795 GGAGGTTTTGTCCCATCTCTAGG - Intergenic
1142888889 17:2930188-2930210 AGCGGGATTGTCCCAGCTGTGGG + Intronic
1152378710 17:79931206-79931228 CGGGGGTTTGTCCCTGCTGTGGG + Intergenic
1154167443 18:12026753-12026775 CCGCCTTTTGTCCCAGCTGTGGG + Intronic
1161105912 19:2443964-2443986 CGGGGTTTTGTCCCAGCTGTTGG - Intronic
1161590535 19:5127306-5127328 CGGGGCTCTGTCCTTGCTGTGGG - Intronic
1161748109 19:6074182-6074204 CGGGGTTTTGTAGCAGGGGTGGG + Intronic
1165226538 19:34359200-34359222 CGGGGGTTTGTCCCTGGTGTTGG - Intergenic
1165592420 19:36981034-36981056 CTGGCCTTTGTCCCAGCTCTTGG - Intronic
1166935230 19:46328303-46328325 CTGGCTTTTGTCCCAGCTCCTGG - Intronic
1167346037 19:48946349-48946371 CCGGGTTTTGTGCCAGGTGAGGG + Intergenic
925594414 2:5541001-5541023 CGGGGATTTGGCTCAGCTGGTGG + Intergenic
926161709 2:10494453-10494475 TGGGGTTTTGATCCAGCTGCTGG - Intergenic
928632753 2:33210756-33210778 CTGGCTTTTCTCCCAGCTGGTGG + Intronic
929231787 2:39567752-39567774 AGTGGTTTTGGCCCAGCTGCAGG + Intergenic
934117540 2:88811281-88811303 GGGGATTTTGCCTCAGCTGTGGG - Intergenic
940910596 2:159206366-159206388 CTGGGTTTTGCCCCTGATGTGGG + Intronic
941839382 2:170063872-170063894 CTGGGCTGTGTACCAGCTGTGGG + Intronic
942327980 2:174791719-174791741 CCTGGTTTTGTCCCAGGTCTGGG - Intergenic
947333777 2:229058363-229058385 TGGTGTCTTGTCCTAGCTGTTGG + Intronic
948672278 2:239576178-239576200 TGGGGTTTGATCCCAGCTGCTGG + Intergenic
1171071412 20:22072194-22072216 CGGGATTTTGTCCCAGGAATGGG - Intergenic
1173165869 20:40687065-40687087 GGGGTTTCAGTCCCAGCTGTAGG - Exonic
1175184992 20:57174026-57174048 TTGGGTTCTGTCCCAGCTGCAGG + Intronic
1180278752 22:10672595-10672617 CGAGGTTTCGCCCAAGCTGTAGG + Intergenic
1185213756 22:49587016-49587038 GGGGGTTGTGGCCCAGCTGTTGG + Intronic
951921771 3:27862532-27862554 CGTGGCCTTATCCCAGCTGTGGG - Intergenic
971113957 4:23620893-23620915 CAGGGTTTTCTCCCCGCTTTTGG + Intergenic
977655878 4:99520053-99520075 TGGGGTTTTTTCCCACATGTAGG - Intronic
981712953 4:147726751-147726773 AGGGGTATTGTCTCACCTGTAGG + Intergenic
984068724 4:175084143-175084165 CAGTGTTTAGTCCCAGCTGTAGG + Intergenic
987856289 5:23424141-23424163 TGGCTTTTTGTCCCAACTGTGGG + Intergenic
995804619 5:116037616-116037638 AGGGGTTTTGTGCCATCTGCTGG + Intronic
1000554135 5:162703052-162703074 GGGGGTTTTGTTCCAGTTGTTGG + Intergenic
1006220328 6:32484337-32484359 CAGGGTTTTGTCCCCGCGGGTGG + Intergenic
1009996218 6:70898333-70898355 TGGGTTTTTGTCCCACCTATGGG - Intronic
1019411819 7:909912-909934 CCAGGTCTTGTCCCACCTGTGGG + Intronic
1026941490 7:74290047-74290069 CGGGGGTTTGGCCCTTCTGTTGG + Intronic
1035846311 8:2868654-2868676 CGGTGTTCAGTACCAGCTGTAGG - Intergenic
1039426954 8:37493952-37493974 CGGGGTTTAGTCACATCTGTGGG + Intergenic
1047353852 8:124101375-124101397 AAGGGTTTTGTCTCAGCTTTTGG + Intronic
1060735608 9:126064832-126064854 TTGGTTTTAGTCCCAGCTGTAGG - Intergenic