ID: 1161105914

View in Genome Browser
Species Human (GRCh38)
Location 19:2443982-2444004
Sequence GTTGGATGTTCTTGGTGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 85}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161105914_1161105925 8 Left 1161105914 19:2443982-2444004 CCCCGGCACCAAGAACATCCAAC 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1161105925 19:2444013-2444035 AATGCCTACGATGGGGCCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 101
1161105914_1161105923 0 Left 1161105914 19:2443982-2444004 CCCCGGCACCAAGAACATCCAAC 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG 0: 1
1: 0
2: 0
3: 4
4: 66
1161105914_1161105928 25 Left 1161105914 19:2443982-2444004 CCCCGGCACCAAGAACATCCAAC 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1161105928 19:2444030-2444052 CTGAGGTCAAACGCGTCTCACGG 0: 1
1: 0
2: 0
3: 4
4: 51
1161105914_1161105922 -1 Left 1161105914 19:2443982-2444004 CCCCGGCACCAAGAACATCCAAC 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1161105922 19:2444004-2444026 CCACAGGGAAATGCCTACGATGG 0: 1
1: 0
2: 2
3: 8
4: 86
1161105914_1161105924 1 Left 1161105914 19:2443982-2444004 CCCCGGCACCAAGAACATCCAAC 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1161105924 19:2444006-2444028 ACAGGGAAATGCCTACGATGGGG 0: 1
1: 0
2: 0
3: 5
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161105914 Original CRISPR GTTGGATGTTCTTGGTGCCG GGG (reversed) Intronic
900775979 1:4585794-4585816 GTTGGATGACTTTGGTGCCAAGG - Intergenic
905030318 1:34878509-34878531 GTTGTATCTTCTTGGTGGCTTGG - Intronic
909963554 1:81879722-81879744 GTTGTATGGGCTTGGTGCAGTGG + Intronic
910360591 1:86411053-86411075 GTTGGCTGTTCATGGTGGGGCGG - Intergenic
911479062 1:98413508-98413530 CTTGGCTGTTGTTGGTGCAGAGG + Intergenic
916668930 1:166994312-166994334 GTTGGCTGTTCTTAGTGGCTGGG + Intronic
1065741755 10:28803249-28803271 GTTGGACATTCCTGGTCCCGAGG - Intergenic
1072939105 10:99743634-99743656 TTTTGAAGTTCTTGGTGCAGTGG - Intronic
1074789992 10:116877138-116877160 CTTGGCTGTGCTTGGTGCCTTGG - Intronic
1078491841 11:11776740-11776762 GATAGATGTTCTTGGAGCAGAGG - Intergenic
1081235484 11:40642644-40642666 GTTAAATGTTCTAGGTGCTGAGG - Intronic
1082784053 11:57307184-57307206 CTTTAATGTTCTTGGTGCAGGGG - Intronic
1098877483 12:75881479-75881501 TTTGGATCTTCTTGGTGCAGGGG + Intergenic
1099100523 12:78434216-78434238 ATTGTATGTTCTTGGTGCCCTGG + Intergenic
1102455060 12:113065904-113065926 GTGTGATGTTCTTGGTGCATGGG + Intronic
1103834813 12:123810119-123810141 GCCAGATGTTCTTGGTGCTGGGG - Intronic
1107158933 13:37202762-37202784 GTTGGAAGTACTTGGTGGAGTGG + Intergenic
1109799172 13:67352719-67352741 GTTGGATGTTTGTGGTGCTCAGG - Intergenic
1112930378 13:104728454-104728476 GTTGTATGCTCTAGGTGCTGTGG + Intergenic
1116400662 14:44503002-44503024 GTTGGATGTTTCTGGAGCTGAGG - Intergenic
1116782850 14:49255248-49255270 GTTGGATGTTGTTGGTGTATAGG - Intergenic
1118044017 14:61947059-61947081 GTTGGAGGTTCTTGGTTGGGAGG + Intergenic
1118801374 14:69192516-69192538 GCTTGATGTTCTTGGTGGTGAGG + Intronic
1119266154 14:73264301-73264323 GTTGGATCTTCTGGGAGTCGCGG - Exonic
1123123765 14:105930168-105930190 GTTGGGTGTCCATGGTGCCCTGG + Intronic
1123123836 14:105930408-105930430 GTTGGGTGTCCATGGTGCCCTGG + Intronic
1123123852 14:105930456-105930478 GTTGGGTGTCCATGGTGCCCTGG + Intronic
1130273069 15:82462481-82462503 GCTGGATGTCCTGGGTGCCCAGG + Intergenic
1130465422 15:84189852-84189874 GCTGGATGTCCTGGGTGCCCAGG + Intergenic
1130467515 15:84199976-84199998 GTGGGATGTTCTCGCTGCTGGGG + Intergenic
1130487271 15:84404968-84404990 GCTGGATGTCCTGGGTGCCCAGG - Intergenic
1130496751 15:84473566-84473588 GTGGGATGTTCTCGCTGCTGGGG - Intergenic
1130498843 15:84483684-84483706 GCTGGATGTCCTGGGTGCCCAGG - Intergenic
1130587710 15:85194447-85194469 GCTGGATGTCCTGGGTGCCCAGG + Intergenic
1130589806 15:85204574-85204596 GTGGGATGTTCTCGCTGCTGGGG + Intergenic
1131561823 15:93450515-93450537 ATTGGATATTCTGGGTGTCGTGG - Intergenic
1132671536 16:1104007-1104029 TTTGGATGTTCTTGGTGGGTTGG + Intergenic
1133025517 16:2987478-2987500 GGTGGATGGACTTGGAGCCGGGG - Intergenic
1133883419 16:9804353-9804375 GTTGGATGCTCTTGGTTCTAAGG - Intronic
1134328234 16:13226691-13226713 GTTGGATTTTCTTGGTATCTGGG + Intronic
1136677899 16:31930325-31930347 TTTGGATGTTGTTGGTGTAGGGG - Intergenic
1139287845 16:65831539-65831561 CTTGGATGTTCTTGGGGTTGAGG - Intergenic
1141420989 16:83915411-83915433 CTTTGATGATCTTGGAGCCGAGG - Exonic
1142229986 16:88895596-88895618 TCTGGATGTTCTTGGTGGAGCGG + Intronic
1149127982 17:53258588-53258610 CTTGGATGTTGTTGGTGTCTAGG - Intergenic
1156712788 18:39966755-39966777 GTTGGATGTCCTTTATCCCGGGG + Intergenic
1156725616 18:40122758-40122780 ACTGGATGTTCCAGGTGCCGTGG - Intergenic
1156985929 18:43351480-43351502 GTTGGATATGCTTGGTCCCCAGG + Intergenic
1161105914 19:2443982-2444004 GTTGGATGTTCTTGGTGCCGGGG - Intronic
1162083948 19:8237262-8237284 GTTGGAACTGCTGGGTGCCGTGG + Intronic
1167441615 19:49512622-49512644 GCTGGATGTTCTTGGAGTCAGGG + Exonic
927320162 2:21734627-21734649 GTTGGCTGTTATTGGAGCCAGGG - Intergenic
927679751 2:25131844-25131866 CCTTGATGATCTTGGTGCCGAGG - Exonic
928904643 2:36356288-36356310 GGAGGATGTACTTGGTGGCGGGG + Exonic
929298610 2:40275836-40275858 GATGGATGTTGTTGGTGAAGTGG + Intronic
931557801 2:63523956-63523978 GTTGGATGTTTTTGGTGTGTAGG - Intronic
933080751 2:77982052-77982074 CTTGGATATTCTTGGTGTAGAGG - Intergenic
940851069 2:158688658-158688680 GTGGGCTGCTCTTGGTGCAGTGG - Intergenic
941579802 2:167280630-167280652 CTTGGATGTTCGTGGGGCTGGGG + Intergenic
943880464 2:193138231-193138253 ATTGCATGTTTTTGGTGCCTTGG - Intergenic
1170388491 20:15846825-15846847 GTTGTTTTTTCTTGATGCCGAGG - Intronic
1172361892 20:34318492-34318514 GTTGGATATCCCTGGTGCCTAGG + Intergenic
1178738927 21:35178430-35178452 GTTGGATATTCTTGTTGCATAGG - Intronic
1180077830 21:45472156-45472178 CTTGGGTGGTCTTGGTGTCGGGG - Intronic
1182584203 22:31334426-31334448 GCTGGGTGTTCTTGGTGTCCTGG - Intronic
1184637033 22:45841037-45841059 GTTGGAAGTGCTTGATACCGGGG + Intronic
951102453 3:18704330-18704352 CCTGGATGTTCTTGGTGTCTGGG - Intergenic
956854792 3:73265312-73265334 TTTGGCTGTTGTTGGTGCCTAGG - Intergenic
960644530 3:119864524-119864546 GTTGTATGTTCTTCCTGTCGAGG - Intronic
961364056 3:126388342-126388364 GTCGGATGTGGTTGGTGGCGGGG + Intergenic
966435690 3:179881393-179881415 GTTGGATGTTGTTGGTGAAGTGG + Intronic
967637799 3:191824504-191824526 GTTGGCTGTTGTTGGTGCATAGG - Intergenic
970814129 4:20133765-20133787 ATTGGATGGTCATGGTGCCAGGG - Intergenic
979638890 4:122989349-122989371 GGTGGATGGTCTTGGTGTCTAGG + Intronic
992027282 5:72682444-72682466 GTTGGATGTGCATGGTGGGGAGG + Intergenic
1010178262 6:73055032-73055054 CTTGGATGTTGTTGGTGCACAGG - Intronic
1010255900 6:73758028-73758050 TTTGGATTTTCTTGGTGGTGGGG + Intronic
1015795381 6:137006132-137006154 GTTGGATGCTCTTGATGCTTGGG + Intronic
1019181551 6:170190345-170190367 CTTGGGTGTCCTTGGTGCAGAGG - Intergenic
1024004702 7:45216832-45216854 GTGGGAAGTGCTTGGTGCCAGGG + Intergenic
1024418478 7:49135487-49135509 GTTTGATGTCCTTCGTGCCATGG - Intergenic
1028902690 7:96118822-96118844 TGTGGCTGTTGTTGGTGCCGTGG - Intergenic
1031976785 7:128099044-128099066 TTGGGCTGTTCTTGGTGCCAGGG + Intergenic
1032058057 7:128699270-128699292 GTTGGTTGTTTTTGGTGGTGGGG - Intergenic
1039486787 8:37916336-37916358 GTTTCTTGTTCTTGGTGCCCAGG + Intergenic
1039715447 8:40103324-40103346 GGTGGATGTTCTTGAGGCTGTGG + Intergenic
1046484749 8:114873035-114873057 GTTGAATGGTCTTGGTACCCTGG + Intergenic
1056877798 9:90351571-90351593 CTTGGATGTTGTTGGTGCATAGG - Intergenic
1060509628 9:124222489-124222511 TTTGCATGTTCTTTGTGACGCGG + Intergenic