ID: 1161105915

View in Genome Browser
Species Human (GRCh38)
Location 19:2443983-2444005
Sequence GGTTGGATGTTCTTGGTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 144}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161105915_1161105928 24 Left 1161105915 19:2443983-2444005 CCCGGCACCAAGAACATCCAACC 0: 1
1: 0
2: 0
3: 13
4: 144
Right 1161105928 19:2444030-2444052 CTGAGGTCAAACGCGTCTCACGG 0: 1
1: 0
2: 0
3: 4
4: 51
1161105915_1161105923 -1 Left 1161105915 19:2443983-2444005 CCCGGCACCAAGAACATCCAACC 0: 1
1: 0
2: 0
3: 13
4: 144
Right 1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG 0: 1
1: 0
2: 0
3: 4
4: 66
1161105915_1161105925 7 Left 1161105915 19:2443983-2444005 CCCGGCACCAAGAACATCCAACC 0: 1
1: 0
2: 0
3: 13
4: 144
Right 1161105925 19:2444013-2444035 AATGCCTACGATGGGGCCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 101
1161105915_1161105924 0 Left 1161105915 19:2443983-2444005 CCCGGCACCAAGAACATCCAACC 0: 1
1: 0
2: 0
3: 13
4: 144
Right 1161105924 19:2444006-2444028 ACAGGGAAATGCCTACGATGGGG 0: 1
1: 0
2: 0
3: 5
4: 92
1161105915_1161105922 -2 Left 1161105915 19:2443983-2444005 CCCGGCACCAAGAACATCCAACC 0: 1
1: 0
2: 0
3: 13
4: 144
Right 1161105922 19:2444004-2444026 CCACAGGGAAATGCCTACGATGG 0: 1
1: 0
2: 2
3: 8
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161105915 Original CRISPR GGTTGGATGTTCTTGGTGCC GGG (reversed) Intronic
901195304 1:7436887-7436909 GGCTGGAGGTTGTGGGTGCCGGG + Intronic
902997356 1:20236956-20236978 TTGTGGATGGTCTTGGTGCCAGG - Intergenic
905487692 1:38315568-38315590 GGTTGGAAGTTCTGGAGGCCTGG + Intergenic
905974459 1:42164733-42164755 GGGTGGCTGTTCTGGATGCCAGG + Intergenic
907932770 1:59015789-59015811 GGATGGAGGTACTTGGTGGCAGG - Intergenic
912447835 1:109751193-109751215 GGTTGTATGTTCTGGGTCTCTGG + Intronic
914931971 1:151942964-151942986 GGTAAGATGTTCTGTGTGCCAGG - Intergenic
916668929 1:166994311-166994333 GGTTGGCTGTTCTTAGTGGCTGG + Intronic
923804459 1:237243300-237243322 GGTTAGAAGTTCTGGGAGCCTGG - Intronic
1064244075 10:13655636-13655658 TGTAGGAGATTCTTGGTGCCTGG - Intronic
1065452075 10:25869814-25869836 GGTTGAAGGCTCTTGGTACCTGG - Intergenic
1067101982 10:43340489-43340511 GGTCTGGTGCTCTTGGTGCCTGG + Intergenic
1069997554 10:72352042-72352064 GGTTGGATATTCTGAGGGCCTGG - Intronic
1073448318 10:103593983-103594005 GGATGGGTGTTTTTGGTGACAGG + Intergenic
1077042687 11:531545-531567 GGCTGGTTGCTCTTGGAGCCTGG - Intergenic
1078918725 11:15806604-15806626 GGATGGAATTTCTTTGTGCCTGG - Intergenic
1079255423 11:18824038-18824060 GCTTGGATGTTGTTGGTGTATGG + Intergenic
1079837337 11:25350821-25350843 GGGTGGTTGTTCTGGGGGCCCGG + Intergenic
1082784054 11:57307185-57307207 GCTTTAATGTTCTTGGTGCAGGG - Intronic
1082898432 11:58218647-58218669 GGATGGATGTTATGGGTGGCGGG + Intergenic
1084317274 11:68352905-68352927 GTTGGGAGGTACTTGGTGCCTGG + Intronic
1084969476 11:72762774-72762796 GGCTGGCTGTTCTTTCTGCCAGG - Intronic
1085878256 11:80434620-80434642 TGTTGGATGTTCTCTCTGCCTGG + Intergenic
1089200245 11:116720417-116720439 GGATGGAAGTTCTTCGTGCCTGG + Intergenic
1089749997 11:120644624-120644646 GGAAGGATGTTCTTGCAGCCAGG + Intronic
1092154662 12:6274426-6274448 GGCTGAATGTTCTAGGTGGCAGG - Intergenic
1095571581 12:43688839-43688861 GCTTGGATGTTGTTGGTGTATGG - Intergenic
1098877482 12:75881478-75881500 GTTTGGATCTTCTTGGTGCAGGG + Intergenic
1100030658 12:90186266-90186288 GGTTGGAGGTGCTAAGTGCCAGG + Intergenic
1100438998 12:94598241-94598263 GGTAGGATATTCCTGGAGCCAGG - Intronic
1102455059 12:113065903-113065925 AGTGTGATGTTCTTGGTGCATGG + Intronic
1102553487 12:113710315-113710337 TGGTTGATGTTCTGGGTGCCAGG - Intergenic
1102625916 12:114235355-114235377 GATTAGATGTTCCTGGTGGCTGG - Intergenic
1103248287 12:119477212-119477234 GGTTGCCAGTTCCTGGTGCCCGG + Intronic
1107618735 13:42201477-42201499 GGCTGGATGGTCTTAGTTCCTGG + Intronic
1111695528 13:91618701-91618723 GTTTGGAAGTTGTTGTTGCCTGG + Intronic
1111961465 13:94815399-94815421 CTTTGGAAGTTTTTGGTGCCTGG + Intergenic
1116935738 14:50738236-50738258 GTTTAGATGTTTTTGGTGCTTGG + Exonic
1117194374 14:53324798-53324820 GGTACCATCTTCTTGGTGCCTGG - Intergenic
1118221760 14:63860943-63860965 GGTTGGCTGCTCCTGGTCCCTGG - Intronic
1119701639 14:76759970-76759992 TGTGGGATGTACTTGGTGACTGG - Intergenic
1121094168 14:91204421-91204443 CGTTCTATGCTCTTGGTGCCAGG - Intronic
1121642000 14:95491059-95491081 GACTGGCTGTTCTTGGGGCCAGG + Intergenic
1121876239 14:97456129-97456151 GGGTGGATGTTCCTGCGGCCTGG + Intergenic
1122256045 14:100477335-100477357 GTTTGGATCTTCTTGGAGCTAGG - Intronic
1127802897 15:62493078-62493100 GGTCGGATGTTCATGGTTCAGGG + Intronic
1128453238 15:67819343-67819365 GGTTTGAAGGTCTTGGGGCCGGG - Intergenic
1130467514 15:84199975-84199997 GGTGGGATGTTCTCGCTGCTGGG + Intergenic
1130496752 15:84473567-84473589 GGTGGGATGTTCTCGCTGCTGGG - Intergenic
1130589805 15:85204573-85204595 GGTGGGATGTTCTCGCTGCTGGG + Intergenic
1131496958 15:92920846-92920868 CCTTTGATGTTCTTTGTGCCTGG - Intronic
1132787549 16:1666284-1666306 GCTTAGATGTTCTTGGTGAAGGG - Intronic
1133025518 16:2987479-2987501 GGGTGGATGGACTTGGAGCCGGG - Intergenic
1134179488 16:12036044-12036066 GGTTGGATTTTCTTTGTGTGTGG + Intronic
1134328233 16:13226690-13226712 AGTTGGATTTTCTTGGTATCTGG + Intronic
1135306227 16:21369835-21369857 GGTTGGATTTTCTTTGTGTGTGG + Intergenic
1136302966 16:29348972-29348994 GGTTGGATTTTCTTTGTGTGTGG + Intergenic
1136677900 16:31930326-31930348 GTTTGGATGTTGTTGGTGTAGGG - Intergenic
1137562145 16:49509807-49509829 GGTTGTATGTTCAGGCTGCCTGG + Intronic
1151409363 17:73911457-73911479 GGCTGGATGGACTTGCTGCCAGG - Intergenic
1152440337 17:80304767-80304789 GTGTGAATGTGCTTGGTGCCAGG - Intronic
1154025453 18:10703657-10703679 AGCTCGATATTCTTGGTGCCTGG - Intronic
1154513291 18:15134002-15134024 GGTATGCTGTTCTTGGTCCCAGG - Intergenic
1155648537 18:28111640-28111662 GGTTGAGTGTTCTTTCTGCCAGG - Intronic
1157924552 18:51749073-51749095 GGTTGGATGTTCCAGCTTCCAGG + Intergenic
1159304055 18:66616517-66616539 GATTGGGTGTTCTCGGTGTCTGG - Intergenic
1160932327 19:1576672-1576694 GGGTGGATGTGCTTGGAGCCTGG - Exonic
1161105915 19:2443983-2444005 GGTTGGATGTTCTTGGTGCCGGG - Intronic
1161139529 19:2639434-2639456 GTTTGGGTGTCCTTGGTGGCCGG - Intronic
1163360478 19:16842893-16842915 GGGTGGACATTCTTGGTGCCAGG + Intronic
1163943425 19:20515322-20515344 GGTTGGTAGTCCTTGGTCCCTGG + Intergenic
1165851335 19:38851873-38851895 GGTCGGATCTTCCTGGTGTCCGG - Intronic
1166176107 19:41071723-41071745 GGTTGGATGTTGTTGGTGTATGG + Intergenic
1166356950 19:42232972-42232994 GGATGGATGTTATTGATCCCTGG + Intronic
1167441614 19:49512621-49512643 GGCTGGATGTTCTTGGAGTCAGG + Exonic
1167555523 19:50192838-50192860 GGATGGAGGTGCCTGGTGCCAGG + Intronic
925566994 2:5266740-5266762 GGTGGGCTGGTCTTGGTCCCAGG - Intergenic
926206597 2:10838346-10838368 GATTGTGTGTTCTAGGTGCCAGG + Intergenic
927320163 2:21734628-21734650 GGTTGGCTGTTATTGGAGCCAGG - Intergenic
928109808 2:28497451-28497473 GGTTGGAGGTTGTTGGTATCAGG + Intronic
929693278 2:44092285-44092307 GGTTGTATGGTCCTGGTGCATGG + Intergenic
931872480 2:66476295-66476317 GAGGGGATGTTTTTGGTGCCAGG - Intronic
932416693 2:71577843-71577865 GGTTGGATTTTCTGGGTGCTAGG + Intronic
932482764 2:72057335-72057357 GGTTGGCTGTTGTTGGTGTATGG + Intergenic
938513539 2:131978613-131978635 GGTATGCTGTTCTTGGTCCCAGG - Intergenic
940058457 2:149538236-149538258 GGGTGGAAGTTCTAGGAGCCAGG + Intergenic
941487327 2:166098703-166098725 GCTTGGATGTTATTGGTGTATGG - Intronic
941579801 2:167280629-167280651 GCTTGGATGTTCGTGGGGCTGGG + Intergenic
942231334 2:173863324-173863346 GCTCAGATGTACTTGGTGCCAGG - Intergenic
944527368 2:200633728-200633750 GTTGGGATTTTCTTGGTTCCTGG + Intronic
944545138 2:200791454-200791476 GGCTGGATGTTCCTGGCTCCTGG - Intergenic
948816078 2:240511015-240511037 TGTTGGGTCTTCTTGGGGCCAGG - Intronic
1171233556 20:23506975-23506997 GGTTGGCAGTTCTTGGAGCTTGG + Intergenic
1172385612 20:34532044-34532066 GGTTGGCTGTTCTTGCTACCTGG - Intronic
1175230495 20:57470733-57470755 GGCTGGTTGTCCTTGGAGCCAGG - Intergenic
1175724857 20:61310736-61310758 GGTTGGGTTTTCCTGGGGCCTGG + Intronic
1175926116 20:62472417-62472439 GGGTGGCTGTTCTAGATGCCTGG - Intronic
1179192583 21:39136075-39136097 GGTTGTATGTTCTACGGGCCTGG - Intergenic
1179451286 21:41470105-41470127 GGTTGGAAGTGCTTAGTGGCAGG - Intronic
1181171913 22:21014728-21014750 GGATGGAGGTTCCTGGTGCAGGG - Intronic
1181629669 22:24143947-24143969 GGTTGGCTGCTCTGGGTGCCGGG + Intronic
1181985929 22:26799830-26799852 GGTTGGAAGTTCTGGGTGATTGG + Intergenic
1183258304 22:36777278-36777300 GGTGGAATGTTCTAGGTGTCTGG - Intergenic
1184655585 22:45940509-45940531 GGGAGGCTGTACTTGGTGCCAGG - Intronic
951102455 3:18704331-18704353 TCCTGGATGTTCTTGGTGTCTGG - Intergenic
954611535 3:51947041-51947063 GGCTGGATGTGATGGGTGCCTGG + Intronic
958088765 3:88848891-88848913 GCTTGGATGTTCTTGGTATATGG + Intergenic
962805369 3:138923278-138923300 GGCTGCATGTCCTTGGGGCCTGG + Intergenic
966722924 3:183082167-183082189 GGTAGGAAATTCTTGGTGTCCGG - Intronic
967681310 3:192367223-192367245 GGTTGCATTTTCTGGATGCCTGG - Intronic
968911701 4:3479734-3479756 GCCTGGCTGGTCTTGGTGCCTGG + Intronic
970814130 4:20133766-20133788 CATTGGATGGTCATGGTGCCAGG - Intergenic
975896707 4:79101478-79101500 GTTTGGATGTTATTGGTGTATGG + Intergenic
976522083 4:86039910-86039932 GGTTGGCTGGGCTTGGTGTCTGG - Intronic
977565241 4:98574174-98574196 GGTTGGCTGTTTTTGGTAACGGG - Intronic
977631479 4:99248090-99248112 GGCTGGAAATTCTTGCTGCCAGG - Intergenic
985808755 5:2068149-2068171 GGTTGCATGTTCTGGGGGTCAGG - Intergenic
986516778 5:8572910-8572932 AGTTAGATTTTCTTAGTGCCAGG + Intergenic
987207384 5:15641409-15641431 GGTAGGAAGTTCTTGGTGCATGG + Intronic
987276499 5:16368700-16368722 GGATGGAAGCACTTGGTGCCTGG - Intergenic
987741141 5:21910290-21910312 AATTTGATGTTCTTGATGCCAGG - Intronic
988193929 5:27976293-27976315 GCTTGGATGTTGTTGGTGTATGG + Intergenic
994466398 5:100138665-100138687 TGTTGGAGGTTATTGGTGGCTGG - Intergenic
995758027 5:115531951-115531973 GGCTGTTTGTTCTTGGTGCTGGG - Intronic
1001858256 5:175031519-175031541 TGTTGGATTTTCTTGGGGCTTGG + Intergenic
1002860223 6:1073586-1073608 TGTTCGCTGTTCTTGGTGCTGGG + Intergenic
1003062956 6:2876566-2876588 GGTTGGATGCTGTGGGCGCCTGG - Intergenic
1004037958 6:11942678-11942700 AGTTTGATGATCTTGGTGACTGG + Intergenic
1006850698 6:37096194-37096216 GGTTAGATGATCTTGGGGGCAGG - Intergenic
1007613269 6:43164498-43164520 TTTTGGCTGTGCTTGGTGCCAGG + Intergenic
1010947164 6:81988865-81988887 GTTTGGACTTTCTTGGTGCTTGG - Intergenic
1015571076 6:134621996-134622018 GACTGGATGTTCTTGGCACCTGG - Intergenic
1015795380 6:137006131-137006153 TGTTGGATGCTCTTGATGCTTGG + Intronic
1024004701 7:45216831-45216853 GGTGGGAAGTGCTTGGTGCCAGG + Intergenic
1024405364 7:48973116-48973138 GCTTGGATGTTATTGGTGTATGG - Intergenic
1026542499 7:71292317-71292339 GGTTGGGTGTTCTAAGTGCTGGG + Intronic
1031976784 7:128099043-128099065 TTTGGGCTGTTCTTGGTGCCAGG + Intergenic
1032515355 7:132502586-132502608 GGTGGGCAGTTCTTGGTGCAGGG - Intronic
1039386356 8:37139304-37139326 GATTGGATGTGCTTTGGGCCAGG - Intergenic
1041427142 8:57734940-57734962 GCTTGGATGTTCTTGATGTATGG + Intergenic
1043651795 8:82604200-82604222 GGAACTATGTTCTTGGTGCCAGG - Intergenic
1044212105 8:89562102-89562124 TGTTAGATGTTCTAGGTGCTGGG - Intergenic
1051601814 9:18882515-18882537 GGTTGGAGGGTATAGGTGCCCGG + Intronic
1052071403 9:24085974-24085996 GCTTGGCTGTTGTTGGTGCATGG + Intergenic
1055098109 9:72435172-72435194 GGATGAATGTTCTTGTTGGCTGG + Intergenic
1055465243 9:76558977-76558999 GGTTTGTGGTTCTTGGTGCTGGG - Intergenic
1056041244 9:82669815-82669837 AGTGGGATGTGCTTGGTTCCAGG - Intergenic
1056439288 9:86604274-86604296 GGTGAGATGGTCTTTGTGCCTGG + Intergenic
1061559366 9:131393273-131393295 GGTGGGATGATTTGGGTGCCAGG + Intergenic
1062190696 9:135246455-135246477 GGCTGGGTGTTCTTGGTGTGGGG + Intergenic
1062211940 9:135369661-135369683 GGTCTGATGTGCTGGGTGCCTGG - Intergenic
1190512219 X:51185144-51185166 TGTTGGATGGTTTTGGTACCAGG - Intergenic
1191171615 X:57453523-57453545 GGCTGGAAGTTCTAGCTGCCTGG - Intronic
1192982591 X:76362289-76362311 GCTTGGATGTTGTTGGTGTATGG + Intergenic
1194945286 X:100059559-100059581 GCTTGTAGGTCCTTGGTGCCTGG - Intergenic
1194962730 X:100254381-100254403 GTTTGGCTGTTCTTGGTGTATGG - Intergenic
1195687812 X:107601826-107601848 GGTTGCAGGTACTCGGTGCCTGG - Exonic
1195773917 X:108382469-108382491 AGTGAGATGTTCTTTGTGCCTGG - Intronic